Structured Review

GenScript bglii
Bglii, supplied by GenScript, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bglii/product/GenScript
Average 92 stars, based on 12 article reviews
Price from $9.99 to $1999.99
bglii - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: A Novel Antimycobacterial Compound Acts as an Intracellular Iron Chelator
Article Snippet: .. A fragment containing the 200 bp flanking fxbA separated by the linker AGATCT GTCCTA CTCGAG , where the underlined sequences are the restriction sites for BglII and XhoI, was synthesized and cloned into pUC57-simple (Genscript, USA) (see Fig. S1 in the supplemental material). .. The HygR cassette was amplified from pUV15TetORm ( ) by using primers BamHIHygF (AGATGGATCCTGACGTTCATCCATAGTTGCCTG) and XhoIHygR (AGATCTCGAGGCGGCTTTAGCTAATTAATTGG) and cloned into the BglII and XhoI sites of the flanking sequences.

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity
Article Snippet: .. ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA). ..

Article Title: Nuclear trafficking, histone cleavage and induction of apoptosis by the meningococcal App and Msp A autotransporters
Article Snippet: .. The cloned inserts were subsequently removed by digestion with BglII and SphI and ligated into pQE70, digested with the same enzymes, to yield plasmids pQE70pdapp and pQE70pdmspA respectively. pCold TF‐App, encoding App 43 G to 1179 N with N‐terminal TF and 6 × histidine tags, was constructed by GenScript Corporation utilizing the cold shock expression vector pCold TF. pCold TF‐MspA encoding MspA 27 S to 1152 A with N‐terminal TF and 6 × histidine tags was constructed by amplifying the relevant mspA fragment from MC58 using primers pColdTF‐MspA(F) and pColdTF‐MspA(R) (Table ). .. After digestion with KpnI and HindIII, the PCR product was ligated to KpnI‐ and HindIII‐digested pCold TF to yield pCold TF‐MspA.

Article Title: A recurrent kinase domain mutation in PRKCA defines chordoid glioma of the third ventricle
Article Snippet: .. A human wildtype PRKCA cDNA (CCDS11664) with flanking 5′ BglII and 3′ NotI restriction sites was synthesized by GenScript and cloned into the pCDF1-MCS2-EF1-Puro lentiviral expression vector (System Biosciences). .. D463H and D463A mutations were engineered into the pCDNA3- PRKCA and pCDF1- PRKCA constructs by site-directed mutagenesis using the QuikChange II XL kit (Stratagene) as directed by the manufacturer.

Transfection:

Article Title: NAMPT-Mediated Salvage Synthesis of NAD+ Controls Morphofunctional Changes of Macrophages
Article Snippet: .. DNA Constructs and Transfection pEYFP-N1-ΔATG-Lifeact was constructed as follows: Lifeact cDNA, containing human codon sequences flanked by a 5′ BglII and 3′ EcoRI restriction site, was synthesized by GenScript Corporation and provided in a pUC57 plasmid. .. The Lifeact-fragment did not contain a Kozak sequence, therefore, a forward primer (5′-CT C AG ATC T CC ACC ATG GGC GTG GCC GAC C-3′) was designed to induce a BglII site and a Kozak sequence in front of the Lifeact start codon and used together with the M13 universal reverse primer to amplify Lifeact from pUC57 by PCR.

shRNA:

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity
Article Snippet: .. ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA). ..

Synthesized:

Article Title: A Novel Antimycobacterial Compound Acts as an Intracellular Iron Chelator
Article Snippet: .. A fragment containing the 200 bp flanking fxbA separated by the linker AGATCT GTCCTA CTCGAG , where the underlined sequences are the restriction sites for BglII and XhoI, was synthesized and cloned into pUC57-simple (Genscript, USA) (see Fig. S1 in the supplemental material). .. The HygR cassette was amplified from pUV15TetORm ( ) by using primers BamHIHygF (AGATGGATCCTGACGTTCATCCATAGTTGCCTG) and XhoIHygR (AGATCTCGAGGCGGCTTTAGCTAATTAATTGG) and cloned into the BglII and XhoI sites of the flanking sequences.

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity
Article Snippet: .. ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA). ..

Article Title: A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging
Article Snippet: .. For the construction of AAV-FLEX-PKIalpha-IRES-mRuby2, the coding region of mouse PKIalpha (GenBank ID: NM_008862) was made by gene synthesis, followed by subcloning of the synthesized fragment into AAV-FLEX-tmeGFP-IRES-nls-mRuby2 via AvrII and BglII (Genscript). .. AAV-FLEX-tmeGFP-IRES-nls-mRuby2 was constructed by gene synthesis of IRES-nls-mRuby2 (Lam et al., ) and subsequent cloning into AAV-FLEX-FLIM-AKAR via XbaI and XhoI (Genscript). pBS-β-actin Cre was a gift from Susan Dymecki (Harvard Medical School).

Article Title: NAMPT-Mediated Salvage Synthesis of NAD+ Controls Morphofunctional Changes of Macrophages
Article Snippet: .. DNA Constructs and Transfection pEYFP-N1-ΔATG-Lifeact was constructed as follows: Lifeact cDNA, containing human codon sequences flanked by a 5′ BglII and 3′ EcoRI restriction site, was synthesized by GenScript Corporation and provided in a pUC57 plasmid. .. The Lifeact-fragment did not contain a Kozak sequence, therefore, a forward primer (5′-CT C AG ATC T CC ACC ATG GGC GTG GCC GAC C-3′) was designed to induce a BglII site and a Kozak sequence in front of the Lifeact start codon and used together with the M13 universal reverse primer to amplify Lifeact from pUC57 by PCR.

Article Title: Sequentially acting SOX proteins orchestrate astrocyte‐ and oligodendrocyte‐specific gene expression
Article Snippet: .. These DNA regions were synthesized by GenScript between BglII and XhoI sites and sub‐cloned into a pTK‐luc vector. .. Transactivation assays were performed in P19 cells as described elsewhere with the exception of 100ng of pTK‐luc vectors and 50ng of SOX and/or NFIA expression vectors: pCAGG‐Sox3 (mouse), pCAGG‐Sox9 (mouse), pCAGG‐Sox10 (rat), pCAGG‐Sox11 (mouse, M. Wegner, University of Erlangen), and pCAGG‐Nfia (mouse), alone or in combinations.

Article Title: Distinct transcription factor complexes act on a permissive chromatin landscape to establish regionalized gene expression in CNS stem cells
Article Snippet: .. Regions were synthesized by Genscript between BglII and XhoI sites, with orientation to TSS. .. These were then subcloned into an E1b-GFP-Tol2 vector ( ) or TKmax-luciferase reporters.

Article Title: A recurrent kinase domain mutation in PRKCA defines chordoid glioma of the third ventricle
Article Snippet: .. A human wildtype PRKCA cDNA (CCDS11664) with flanking 5′ BglII and 3′ NotI restriction sites was synthesized by GenScript and cloned into the pCDF1-MCS2-EF1-Puro lentiviral expression vector (System Biosciences). .. D463H and D463A mutations were engineered into the pCDNA3- PRKCA and pCDF1- PRKCA constructs by site-directed mutagenesis using the QuikChange II XL kit (Stratagene) as directed by the manufacturer.

Subcloning:

Article Title: A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging
Article Snippet: .. For the construction of AAV-FLEX-PKIalpha-IRES-mRuby2, the coding region of mouse PKIalpha (GenBank ID: NM_008862) was made by gene synthesis, followed by subcloning of the synthesized fragment into AAV-FLEX-tmeGFP-IRES-nls-mRuby2 via AvrII and BglII (Genscript). .. AAV-FLEX-tmeGFP-IRES-nls-mRuby2 was constructed by gene synthesis of IRES-nls-mRuby2 (Lam et al., ) and subsequent cloning into AAV-FLEX-FLIM-AKAR via XbaI and XhoI (Genscript). pBS-β-actin Cre was a gift from Susan Dymecki (Harvard Medical School).

Construct:

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity
Article Snippet: .. ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA). ..

Article Title: NAMPT-Mediated Salvage Synthesis of NAD+ Controls Morphofunctional Changes of Macrophages
Article Snippet: .. DNA Constructs and Transfection pEYFP-N1-ΔATG-Lifeact was constructed as follows: Lifeact cDNA, containing human codon sequences flanked by a 5′ BglII and 3′ EcoRI restriction site, was synthesized by GenScript Corporation and provided in a pUC57 plasmid. .. The Lifeact-fragment did not contain a Kozak sequence, therefore, a forward primer (5′-CT C AG ATC T CC ACC ATG GGC GTG GCC GAC C-3′) was designed to induce a BglII site and a Kozak sequence in front of the Lifeact start codon and used together with the M13 universal reverse primer to amplify Lifeact from pUC57 by PCR.

Article Title: Nuclear trafficking, histone cleavage and induction of apoptosis by the meningococcal App and Msp A autotransporters
Article Snippet: .. The cloned inserts were subsequently removed by digestion with BglII and SphI and ligated into pQE70, digested with the same enzymes, to yield plasmids pQE70pdapp and pQE70pdmspA respectively. pCold TF‐App, encoding App 43 G to 1179 N with N‐terminal TF and 6 × histidine tags, was constructed by GenScript Corporation utilizing the cold shock expression vector pCold TF. pCold TF‐MspA encoding MspA 27 S to 1152 A with N‐terminal TF and 6 × histidine tags was constructed by amplifying the relevant mspA fragment from MC58 using primers pColdTF‐MspA(F) and pColdTF‐MspA(R) (Table ). .. After digestion with KpnI and HindIII, the PCR product was ligated to KpnI‐ and HindIII‐digested pCold TF to yield pCold TF‐MspA.

Expressing:

Article Title: Nuclear trafficking, histone cleavage and induction of apoptosis by the meningococcal App and Msp A autotransporters
Article Snippet: .. The cloned inserts were subsequently removed by digestion with BglII and SphI and ligated into pQE70, digested with the same enzymes, to yield plasmids pQE70pdapp and pQE70pdmspA respectively. pCold TF‐App, encoding App 43 G to 1179 N with N‐terminal TF and 6 × histidine tags, was constructed by GenScript Corporation utilizing the cold shock expression vector pCold TF. pCold TF‐MspA encoding MspA 27 S to 1152 A with N‐terminal TF and 6 × histidine tags was constructed by amplifying the relevant mspA fragment from MC58 using primers pColdTF‐MspA(F) and pColdTF‐MspA(R) (Table ). .. After digestion with KpnI and HindIII, the PCR product was ligated to KpnI‐ and HindIII‐digested pCold TF to yield pCold TF‐MspA.

Article Title: A recurrent kinase domain mutation in PRKCA defines chordoid glioma of the third ventricle
Article Snippet: .. A human wildtype PRKCA cDNA (CCDS11664) with flanking 5′ BglII and 3′ NotI restriction sites was synthesized by GenScript and cloned into the pCDF1-MCS2-EF1-Puro lentiviral expression vector (System Biosciences). .. D463H and D463A mutations were engineered into the pCDNA3- PRKCA and pCDF1- PRKCA constructs by site-directed mutagenesis using the QuikChange II XL kit (Stratagene) as directed by the manufacturer.

Plasmid Preparation:

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity
Article Snippet: .. ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA). ..

Article Title: NAMPT-Mediated Salvage Synthesis of NAD+ Controls Morphofunctional Changes of Macrophages
Article Snippet: .. DNA Constructs and Transfection pEYFP-N1-ΔATG-Lifeact was constructed as follows: Lifeact cDNA, containing human codon sequences flanked by a 5′ BglII and 3′ EcoRI restriction site, was synthesized by GenScript Corporation and provided in a pUC57 plasmid. .. The Lifeact-fragment did not contain a Kozak sequence, therefore, a forward primer (5′-CT C AG ATC T CC ACC ATG GGC GTG GCC GAC C-3′) was designed to induce a BglII site and a Kozak sequence in front of the Lifeact start codon and used together with the M13 universal reverse primer to amplify Lifeact from pUC57 by PCR.

Article Title: Nuclear trafficking, histone cleavage and induction of apoptosis by the meningococcal App and Msp A autotransporters
Article Snippet: .. The cloned inserts were subsequently removed by digestion with BglII and SphI and ligated into pQE70, digested with the same enzymes, to yield plasmids pQE70pdapp and pQE70pdmspA respectively. pCold TF‐App, encoding App 43 G to 1179 N with N‐terminal TF and 6 × histidine tags, was constructed by GenScript Corporation utilizing the cold shock expression vector pCold TF. pCold TF‐MspA encoding MspA 27 S to 1152 A with N‐terminal TF and 6 × histidine tags was constructed by amplifying the relevant mspA fragment from MC58 using primers pColdTF‐MspA(F) and pColdTF‐MspA(R) (Table ). .. After digestion with KpnI and HindIII, the PCR product was ligated to KpnI‐ and HindIII‐digested pCold TF to yield pCold TF‐MspA.

Article Title: Sequentially acting SOX proteins orchestrate astrocyte‐ and oligodendrocyte‐specific gene expression
Article Snippet: .. These DNA regions were synthesized by GenScript between BglII and XhoI sites and sub‐cloned into a pTK‐luc vector. .. Transactivation assays were performed in P19 cells as described elsewhere with the exception of 100ng of pTK‐luc vectors and 50ng of SOX and/or NFIA expression vectors: pCAGG‐Sox3 (mouse), pCAGG‐Sox9 (mouse), pCAGG‐Sox10 (rat), pCAGG‐Sox11 (mouse, M. Wegner, University of Erlangen), and pCAGG‐Nfia (mouse), alone or in combinations.

Article Title: A recurrent kinase domain mutation in PRKCA defines chordoid glioma of the third ventricle
Article Snippet: .. A human wildtype PRKCA cDNA (CCDS11664) with flanking 5′ BglII and 3′ NotI restriction sites was synthesized by GenScript and cloned into the pCDF1-MCS2-EF1-Puro lentiviral expression vector (System Biosciences). .. D463H and D463A mutations were engineered into the pCDNA3- PRKCA and pCDF1- PRKCA constructs by site-directed mutagenesis using the QuikChange II XL kit (Stratagene) as directed by the manufacturer.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    GenScript bglii restriction cut site
    Construct for expressing soybean ferritin extracellularly in <t>Arabidopsis</t> . a Mature form of soybean ferritin H-1 (Sfer H-I) was used for gene synthesis. EP: the sequence encoding extension peptide; ABCD and E, the sequences corresponding to the A to E helixes of mature ferritin. b Vector pCAMBIA1305.2 was developed by pCAMBIA ( http://www.cambia.org ), which has a glycine-rich protein (GRP) signal peptide for extracellular targeting. For expression construct, the catalase intron-GusPlus gene cassette in above vector was replaced by the ferritin gene; nopaline synthase (nos) polyA was the terminator. c Confirmation of construct pCAMBIA1305.2-ferritin by restriction enzyme digestion. Lanes 1 and 2 , uncut and <t>BglII-BstEII</t> cut empty vector (1305.2), respectively; the latter was digested into two bands, including the 1980 bp GUSplus gene. Lanes 3 and 4 , uncut and BglII-BstEII cut construct (pCAMBIA1305.2-ferritin), respectively; the latter was digested into two bands, including the 623 bp ferritin gene
    Bglii Restriction Cut Site, supplied by GenScript, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii restriction cut site/product/GenScript
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bglii restriction cut site - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    92
    GenScript bglii
    Construct for expressing soybean ferritin extracellularly in <t>Arabidopsis</t> . a Mature form of soybean ferritin H-1 (Sfer H-I) was used for gene synthesis. EP: the sequence encoding extension peptide; ABCD and E, the sequences corresponding to the A to E helixes of mature ferritin. b Vector pCAMBIA1305.2 was developed by pCAMBIA ( http://www.cambia.org ), which has a glycine-rich protein (GRP) signal peptide for extracellular targeting. For expression construct, the catalase intron-GusPlus gene cassette in above vector was replaced by the ferritin gene; nopaline synthase (nos) polyA was the terminator. c Confirmation of construct pCAMBIA1305.2-ferritin by restriction enzyme digestion. Lanes 1 and 2 , uncut and <t>BglII-BstEII</t> cut empty vector (1305.2), respectively; the latter was digested into two bands, including the 1980 bp GUSplus gene. Lanes 3 and 4 , uncut and BglII-BstEII cut construct (pCAMBIA1305.2-ferritin), respectively; the latter was digested into two bands, including the 623 bp ferritin gene
    Bglii, supplied by GenScript, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii/product/GenScript
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bglii - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    GenScript bglii bamhi codon optimized synthetic dna fragment
    Construct for expressing soybean ferritin extracellularly in <t>Arabidopsis</t> . a Mature form of soybean ferritin H-1 (Sfer H-I) was used for gene synthesis. EP: the sequence encoding extension peptide; ABCD and E, the sequences corresponding to the A to E helixes of mature ferritin. b Vector pCAMBIA1305.2 was developed by pCAMBIA ( http://www.cambia.org ), which has a glycine-rich protein (GRP) signal peptide for extracellular targeting. For expression construct, the catalase intron-GusPlus gene cassette in above vector was replaced by the ferritin gene; nopaline synthase (nos) polyA was the terminator. c Confirmation of construct pCAMBIA1305.2-ferritin by restriction enzyme digestion. Lanes 1 and 2 , uncut and <t>BglII-BstEII</t> cut empty vector (1305.2), respectively; the latter was digested into two bands, including the 1980 bp GUSplus gene. Lanes 3 and 4 , uncut and BglII-BstEII cut construct (pCAMBIA1305.2-ferritin), respectively; the latter was digested into two bands, including the 623 bp ferritin gene
    Bglii Bamhi Codon Optimized Synthetic Dna Fragment, supplied by GenScript, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii bamhi codon optimized synthetic dna fragment/product/GenScript
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bglii bamhi codon optimized synthetic dna fragment - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    Construct for expressing soybean ferritin extracellularly in Arabidopsis . a Mature form of soybean ferritin H-1 (Sfer H-I) was used for gene synthesis. EP: the sequence encoding extension peptide; ABCD and E, the sequences corresponding to the A to E helixes of mature ferritin. b Vector pCAMBIA1305.2 was developed by pCAMBIA ( http://www.cambia.org ), which has a glycine-rich protein (GRP) signal peptide for extracellular targeting. For expression construct, the catalase intron-GusPlus gene cassette in above vector was replaced by the ferritin gene; nopaline synthase (nos) polyA was the terminator. c Confirmation of construct pCAMBIA1305.2-ferritin by restriction enzyme digestion. Lanes 1 and 2 , uncut and BglII-BstEII cut empty vector (1305.2), respectively; the latter was digested into two bands, including the 1980 bp GUSplus gene. Lanes 3 and 4 , uncut and BglII-BstEII cut construct (pCAMBIA1305.2-ferritin), respectively; the latter was digested into two bands, including the 623 bp ferritin gene

    Journal: Biotechnology for Biofuels

    Article Title: Directed plant cell-wall accumulation of iron: embedding co-catalyst for efficient biomass conversion

    doi: 10.1186/s13068-016-0639-2

    Figure Lengend Snippet: Construct for expressing soybean ferritin extracellularly in Arabidopsis . a Mature form of soybean ferritin H-1 (Sfer H-I) was used for gene synthesis. EP: the sequence encoding extension peptide; ABCD and E, the sequences corresponding to the A to E helixes of mature ferritin. b Vector pCAMBIA1305.2 was developed by pCAMBIA ( http://www.cambia.org ), which has a glycine-rich protein (GRP) signal peptide for extracellular targeting. For expression construct, the catalase intron-GusPlus gene cassette in above vector was replaced by the ferritin gene; nopaline synthase (nos) polyA was the terminator. c Confirmation of construct pCAMBIA1305.2-ferritin by restriction enzyme digestion. Lanes 1 and 2 , uncut and BglII-BstEII cut empty vector (1305.2), respectively; the latter was digested into two bands, including the 1980 bp GUSplus gene. Lanes 3 and 4 , uncut and BglII-BstEII cut construct (pCAMBIA1305.2-ferritin), respectively; the latter was digested into two bands, including the 623 bp ferritin gene

    Article Snippet: The nucleotide sequence for SferH-1 mature protein was codon-optimized according to the codon-usage frequencies of Arabidopsis , and synthesized with a BglII restriction cut site at the 5′-end and a BstEII cut site at the 3′-end by GenScript (Piscataway, NJ).

    Techniques: Construct, Expressing, Sequencing, Plasmid Preparation