Structured Review

Illumina Inc barcoded reverse primer
Barcoded Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded reverse primer/product/Illumina Inc
Average 90 stars, based on 2 article reviews
Price from $9.99 to $1999.99
barcoded reverse primer - by Bioz Stars, 2020-05
90/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
Article Snippet: .. Subsequently, 10μl of the sample was used to perform a PCR reaction by adding 1.3μl of barcoded reverse primer (10μM; Illumina), 12.5μl 2x iProof (BioRad Laboratories, Veenendaal, the Netherlands), 0.125μl forward primer (100μM; Illumina), and 1.075μl H2 O (final volume: 25μl; PCR program: 98°C, 30 sec – 24x [98°C, 10 sec ‐ 60°C, 30 sec ‐ 72°C, 30 sec] ‐ 72°C, 2 min ‐ 4°C, ∞ ). .. Sequencing of the barcoded samples was performed using the Illumina NextSeq500 system, with 2 × 151‐bp paired‐end reads; smMIP libraries required spike‐in of custom primers as described previously [O'Roak et al., ].

Sequencing:

Article Title: Biocide-mediated corrosion of coiled tubing
Article Snippet: .. The barcoded reverse primer (P7-N7XX-OHAF) had a 24 nucleotide 3’ Illumina sequencing adaptor (P7, CAAGCAGAAGACGGCATACGAGAT ), an eight nucleotide index N7XX and a 14 nucleotide reverse overhang adaptor (OHAF, GTCTCGTGGGCTCGG ). .. In case of samples, which had DNA concentrations less than 0.1 ng/μl, a boost PCR was performed.

Size-exclusion Chromatography:

Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
Article Snippet: .. Subsequently, 10μl of the sample was used to perform a PCR reaction by adding 1.3μl of barcoded reverse primer (10μM; Illumina), 12.5μl 2x iProof (BioRad Laboratories, Veenendaal, the Netherlands), 0.125μl forward primer (100μM; Illumina), and 1.075μl H2 O (final volume: 25μl; PCR program: 98°C, 30 sec – 24x [98°C, 10 sec ‐ 60°C, 30 sec ‐ 72°C, 30 sec] ‐ 72°C, 2 min ‐ 4°C, ∞ ). .. Sequencing of the barcoded samples was performed using the Illumina NextSeq500 system, with 2 × 151‐bp paired‐end reads; smMIP libraries required spike‐in of custom primers as described previously [O'Roak et al., ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Illumina Inc barcoded reverse primers
    Generating natively paired libraries for screening and next-generation sequencing (NGS). a V H and V L domains from each encapsulated B cell are amplified with specific primer sets and paired in-frame via complementary overhangs (green). A nested PCR with V H FR1 and V L FR4 primers generates full-length scFv with overhangs (purple) to enable <t>barcoded</t> paired MiSeq sequencing. V H and V L FR3, CDR3 and FR4 are sequenced with R2 and R1 primers, respectively, while the standard P5-specific primer provides the index read to enable demultiplexing. The amplicons can be cleaved of adapter sequences via Sfi1/Not1 restriction sites for subcloning into expression or phagemid vectors for library generation. b , c NGS data from a representative dataset where scFv libraries from one million stimulated B cells were generated in either emulsion or combinatorial fashion. b Emulsion libraries favored a 1:1 V L :V H ratio whereas combinatorial libraries were scrambled. c In the case where multiple pairings were seen, the dominant partner accounted for 96% of sequences in the emulsion library, whereas partners were more evenly distributed in the combinatorial library
    Barcoded Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcoded reverse primers/product/Illumina Inc
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    barcoded reverse primers - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    Image Search Results


    Generating natively paired libraries for screening and next-generation sequencing (NGS). a V H and V L domains from each encapsulated B cell are amplified with specific primer sets and paired in-frame via complementary overhangs (green). A nested PCR with V H FR1 and V L FR4 primers generates full-length scFv with overhangs (purple) to enable barcoded paired MiSeq sequencing. V H and V L FR3, CDR3 and FR4 are sequenced with R2 and R1 primers, respectively, while the standard P5-specific primer provides the index read to enable demultiplexing. The amplicons can be cleaved of adapter sequences via Sfi1/Not1 restriction sites for subcloning into expression or phagemid vectors for library generation. b , c NGS data from a representative dataset where scFv libraries from one million stimulated B cells were generated in either emulsion or combinatorial fashion. b Emulsion libraries favored a 1:1 V L :V H ratio whereas combinatorial libraries were scrambled. c In the case where multiple pairings were seen, the dominant partner accounted for 96% of sequences in the emulsion library, whereas partners were more evenly distributed in the combinatorial library

    Journal: Communications Biology

    Article Title: Recombinant human B cell repertoires enable screening for rare, specific, and natively paired antibodies

    doi: 10.1038/s42003-017-0006-2

    Figure Lengend Snippet: Generating natively paired libraries for screening and next-generation sequencing (NGS). a V H and V L domains from each encapsulated B cell are amplified with specific primer sets and paired in-frame via complementary overhangs (green). A nested PCR with V H FR1 and V L FR4 primers generates full-length scFv with overhangs (purple) to enable barcoded paired MiSeq sequencing. V H and V L FR3, CDR3 and FR4 are sequenced with R2 and R1 primers, respectively, while the standard P5-specific primer provides the index read to enable demultiplexing. The amplicons can be cleaved of adapter sequences via Sfi1/Not1 restriction sites for subcloning into expression or phagemid vectors for library generation. b , c NGS data from a representative dataset where scFv libraries from one million stimulated B cells were generated in either emulsion or combinatorial fashion. b Emulsion libraries favored a 1:1 V L :V H ratio whereas combinatorial libraries were scrambled. c In the case where multiple pairings were seen, the dominant partner accounted for 96% of sequences in the emulsion library, whereas partners were more evenly distributed in the combinatorial library

    Article Snippet: A final scale-up PCR was performed using common forward (Illu_scaleup_F) and barcoded reverse primers (Illu_R_N50X) to enable library construction and Illumina sequencing (Supplementary Table ).

    Techniques: Next-Generation Sequencing, Amplification, Nested PCR, Sequencing, Subcloning, Expressing, Generated