banii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BanII
    Description:
    BanII 2 000 units
    Catalog Number:
    r0119s
    Price:
    69
    Size:
    2 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs banii
    BanII
    BanII 2 000 units
    https://www.bioz.com/result/banii/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    banii - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa"

    Article Title: Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa

    Journal: Gene Regulation and Systems Biology

    doi: 10.4137/GRSB.S14836

    Agarose gel electrophoresis showing variants of the G894T (rs1799983) polymorphism of the endothelial nitric oxide synthase gene. PCR products were digested in 2U of BanII restriction endonuclease. bp base pairs; Ladder: 100 bp ladder, where the 500 bp band stains most intensely, was used as a molecular weight marker.
    Figure Legend Snippet: Agarose gel electrophoresis showing variants of the G894T (rs1799983) polymorphism of the endothelial nitric oxide synthase gene. PCR products were digested in 2U of BanII restriction endonuclease. bp base pairs; Ladder: 100 bp ladder, where the 500 bp band stains most intensely, was used as a molecular weight marker.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Molecular Weight, Marker

    Related Articles

    Clone Assay:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: The monomer DNA sequences were cloned into Eco -RV site of the vector pUC57 from GenScript (Piscataway, NJ). .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA).

    Amplification:

    Article Title: Combined effects of cigarette smoking, alcohol drinking and eNOS Glu298Asp polymorphism on blood pressure in Chinese male hypertensive subjects
    Article Snippet: .. The eNOS Glu298Asp (G894→T) polymorphism was genotyped by PCR amplification of genomic DNA and subsequent restriction-endonuclease BanII (New England Biolabs, Beverly, MA) digestion. .. The PCR fragment size was 249 base pairs (bp).

    Article Title: Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa
    Article Snippet: .. For the G894T (rs1799983) polymorphism, amplified PCR products of 258 base pair band size were digested with 2U BanII (New England Biolabs, Boston MA) restriction endonuclease for 1 hour at 37 °C. ..

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ). ..

    Whole Genome Amplification:

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: In order to obtain unlimited quantities of centenarians’ DNA for different genotyping projects, an in vitro immortalization of genomic DNA was performed by means of whole-genome amplification using a commercially available kit (GenomiPhi, GE Healthcare, Piscataway, NJ, USA). .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ).

    Construct:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: SELP expression plasmids were constructed using our previously established procedures. .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA).

    Electrophoresis:

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ). ..

    Incubation:

    Article Title: The Alliance for Cellular Signaling Plasmid Collection
    Article Snippet: After incubation at room temperature for 1 h, 1 µl of Proteinase K was added, and reactions were incubated at 37 °C for 10 min. 5 µl of the reaction mixture was used to transform TOP10 cells (Invitrogen), and recombinants were selected on gentamicin plates (10 µg/ml). .. Entry clone candidates were identified by digestion with the BanII restriction enzyme (New England Biolabs).

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: .. Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml. .. Digestion was stopped by addition of EDTA to a 25 mM final concentration and 0.5% SDS.

    Expressing:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: SELP expression plasmids were constructed using our previously established procedures. .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA).

    Chromatography:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C. .. The linearized DNA was repurified by chromatography on a Poros HQ column in 0.5 M NaCl, 50 mM Tris, pH 7.9, and 5 mM EDTA and eluted with 1 M NaCl.

    Concentration Assay:

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml. .. Digestion was stopped by addition of EDTA to a 25 mM final concentration and 0.5% SDS.

    other:

    Article Title: ABCA3 Mutations Associated with Pediatric Interstitial Lung Disease
    Article Snippet: Restriction endonucleases BsrG1 and BanII were purchased from the New England Biolabs (Beverly, MA) and used with supplied reagents according to the manufacturer's instructions.

    Article Title: An intronic ABCA3 mutation responsible for respiratory disease
    Article Snippet: Restriction Digest Analysis Restriction endonuclease BanII was purchased from the New England Biolabs (Beverly, MA) and used with supplied reagants according to the manufacturer’s instructions.

    Article Title: Quantitation of Integrated HIV Provirus by Pulsed-Field Gel Electrophoresis and Droplet Digital PCR
    Article Snippet: After PFGE, the high-molecular-weight samples were treated with the BanII restriction enzyme (New England BioLabs), according to the manufacturer's protocol, in preparation for ddPCR.

    DNA Sequencing:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: .. The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C. .. The linearized DNA was repurified by chromatography on a Poros HQ column in 0.5 M NaCl, 50 mM Tris, pH 7.9, and 5 mM EDTA and eluted with 1 M NaCl.

    Sequencing:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: .. The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C. .. The linearized DNA was repurified by chromatography on a Poros HQ column in 0.5 M NaCl, 50 mM Tris, pH 7.9, and 5 mM EDTA and eluted with 1 M NaCl.

    Recombinant:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The recombinant strains were grown at 37°C in 500 mL flasks containing 100 mL of Luria-Bertani medium for overnight culture in a shaking incubator at 250 rpm.

    Staining:

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: Cells were disrupted using a Dounce homogenizer, and lysis was confirmed by trypan blue staining. .. Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml.

    Nucleic Acid Electrophoresis:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The purified monomer DNA was then self-ligated with T4 DNA ligase (New England Biolabs, Beverly, MA) for 8 h at 16°C to yield DNA multimers.

    Article Title: Widespread Impact of Chromosomal Inversions on Gene Expression Uncovers Robustness via Phenotypic Buffering
    Article Snippet: The restriction enzymes used were EcoRI , BanII , PvuI , HindIII , AseI , and EcoNI purchased from New England Biolabs. .. RFLP products were analyzed by gel electrophoresis in 1% (wt./vol.) agarose gels.

    Mutagenesis:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: Preparation of the cruciform-forming plasmid Plasmid pUC19AB was prepared by introducing two point mutations into pUC19 by QuickChange mutagenesis (Agilent, Santa Clara, CA) using the primers GAATTCGGGCTCGGTACTCGGGGATCCTCTAGAG, CTCTAGAGGATCCCCGAGTACCGAGCCCGAATTC, CCAGTGAATTCGGGCTCGGTACCCG and CGGGTACCGAGCCCGAATTCACTGG (Integrated DNA Technologies, San Diego, CA). .. The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C.

    Isolation:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The purified monomer DNA was then self-ligated with T4 DNA ligase (New England Biolabs, Beverly, MA) for 8 h at 16°C to yield DNA multimers.

    Purification:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C. .. 5′-phosphorylated cruciform-forming oligonucleotides 5′-CCGACAGCACGAGCCCATATATATATATATATATATA[Dabcyl-dT]ATATATATATATATATATATGGGCCAACCAACCAGCC-3′ and 5′-GGTTGGTTGGCCCATATATATATATATATATA[Fluorescein-dT]ATATATATATATATATATATATGGGCTCGTGCTG-3′ (Midland Certified Reagent Company, Midland, TX) were purified by polyacrylamide gel electrophoresis, lyophilized and dissolved in 10 mM Tris, pH 7.5, 5 mM MgCl2 , 1 mM EDTA.

    Article Title: The Alliance for Cellular Signaling Plasmid Collection
    Article Snippet: 150 ng of pDONR207 was combined with 50–150 ng of purified attB PCR product, 2 µl of BP Clonase enzyme, and 2 µl of BP Reaction Buffer (Invitrogen), and the volume was adjusted to 10 µl/reaction using Milli-Q purified water. .. Entry clone candidates were identified by digestion with the BanII restriction enzyme (New England Biolabs).

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: In Italian participants, genomic DNA was purified from peripheral blood samples using the QiaAmp DNA Mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ).

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The purified monomer DNA was then self-ligated with T4 DNA ligase (New England Biolabs, Beverly, MA) for 8 h at 16°C to yield DNA multimers.

    Article Title: Widespread Impact of Chromosomal Inversions on Gene Expression Uncovers Robustness via Phenotypic Buffering
    Article Snippet: Restriction Fragment Length Polymorphism Analysis PCR products were purified using QIAquick PCR purification kit (catalog no. 28104) following manufacturer’s instructions. .. The restriction enzymes used were EcoRI , BanII , PvuI , HindIII , AseI , and EcoNI purchased from New England Biolabs.

    Polymerase Chain Reaction:

    Article Title: Combined effects of cigarette smoking, alcohol drinking and eNOS Glu298Asp polymorphism on blood pressure in Chinese male hypertensive subjects
    Article Snippet: .. The eNOS Glu298Asp (G894→T) polymorphism was genotyped by PCR amplification of genomic DNA and subsequent restriction-endonuclease BanII (New England Biolabs, Beverly, MA) digestion. .. The PCR fragment size was 249 base pairs (bp).

    Article Title: The Alliance for Cellular Signaling Plasmid Collection
    Article Snippet: 150 ng of pDONR207 was combined with 50–150 ng of purified attB PCR product, 2 µl of BP Clonase enzyme, and 2 µl of BP Reaction Buffer (Invitrogen), and the volume was adjusted to 10 µl/reaction using Milli-Q purified water. .. Entry clone candidates were identified by digestion with the BanII restriction enzyme (New England Biolabs).

    Article Title: Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa
    Article Snippet: .. For the G894T (rs1799983) polymorphism, amplified PCR products of 258 base pair band size were digested with 2U BanII (New England Biolabs, Boston MA) restriction endonuclease for 1 hour at 37 °C. ..

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ). ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C. .. 5′-phosphorylated cruciform-forming oligonucleotides 5′-CCGACAGCACGAGCCCATATATATATATATATATATA[Dabcyl-dT]ATATATATATATATATATATGGGCCAACCAACCAGCC-3′ and 5′-GGTTGGTTGGCCCATATATATATATATATATA[Fluorescein-dT]ATATATATATATATATATATATGGGCTCGTGCTG-3′ (Midland Certified Reagent Company, Midland, TX) were purified by polyacrylamide gel electrophoresis, lyophilized and dissolved in 10 mM Tris, pH 7.5, 5 mM MgCl2 , 1 mM EDTA.

    Gel Extraction:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The purified monomer DNA was then self-ligated with T4 DNA ligase (New England Biolabs, Beverly, MA) for 8 h at 16°C to yield DNA multimers.

    Chromatin Immunoprecipitation:

    Article Title: Topography of Bovine Papillomavirus E2 Protein on the Viral Genome During the Cell Cycle
    Article Snippet: Paragraph title: Chromatin immunoprecipitation (ChIP) ... Following immunoprecipitation and washing, samples were resuspended in 100 μl of the appropriate restriction enzyme digest buffer, 1% bovine serum albumin (BSA) and either 30 units of BanII (New England Biolabs), 70 units high concentrate BglI (Promega), 70 units of BglI and 8 units PflM1 (New England Biolabs), or no enzyme.

    Plasmid Preparation:

    Article Title: Real-time detection of DNA topological changes with a fluorescently labeled cruciform
    Article Snippet: Paragraph title: Preparation of the cruciform-forming plasmid ... The nucleotide sequence was confirmed by UC Berkeley DNA Sequencing Facility. pUC19AB was prepared using a Nucleobond PC 10000 kit (Macherey-Nagel, Bethleham, PA) and linearized by digestion with BanII and AvaI (New England Biolabs, Ipswich, MA; 1.6 units/µg DNA) for 6 h at 37°C.

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: The monomer DNA sequences were cloned into Eco -RV site of the vector pUC57 from GenScript (Piscataway, NJ). .. The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA).

    Software:

    Article Title: Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa
    Article Snippet: For the G894T (rs1799983) polymorphism, amplified PCR products of 258 base pair band size were digested with 2U BanII (New England Biolabs, Boston MA) restriction endonuclease for 1 hour at 37 °C. .. Size of amplified PCR products and digested fragments were estimated with a TriDye 100 bp DNA ladder (New England Biolabs, Boston MA) and a Doc-It LS Image Analysis Software (UVP Life Sciences, Upland CA).

    Real-time Polymerase Chain Reaction:

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml. .. The DNA was then resuspended in Tris-EDTA and analyzed by QPCR using specific sets of primers, according to the type of DNA sample (mouse or rat).

    Positron Emission Tomography:

    Article Title: Design of Multistimuli Responsive Hydrogels Using Integrated Modeling and Genetically Engineered Silk–Elastin-Like Proteins
    Article Snippet: The monomer DNA sequences were liberated by digesting the pUC57 derivatives with BanII (New England Biolabs, Beverly, MA), isolated by preparative gel electrophoresis, and purified using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). .. The SELP multimer genes were inserted in the tailor-made expression vector, pET-19b3, and expressed under the T7 promoter in E. coli strain BL21Star (DE3) (Invitrogen, Carlsbad, CA).

    In Vitro:

    Article Title: Association of the K153R polymorphism in the myostatin gene and extreme longevity
    Article Snippet: In order to obtain unlimited quantities of centenarians’ DNA for different genotyping projects, an in vitro immortalization of genomic DNA was performed by means of whole-genome amplification using a commercially available kit (GenomiPhi, GE Healthcare, Piscataway, NJ, USA). .. The procedure for detecting the K153R polymorphism was based on PCR amplification, restriction cleavage with BanII (New England Biolabs, Ipswich, MA, USA) and separation of the DNA fragments by electrophoresis, as previously described (Ferrell et al. ).

    Ethanol Precipitation:

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml. .. The samples were then digested with 100 μg/ml proteinase K for 16 h at 37°C, and DNA was recovered by phenol-chloroform extraction and subsequent ethanol precipitation.

    Immunoprecipitation:

    Article Title: Topography of Bovine Papillomavirus E2 Protein on the Viral Genome During the Cell Cycle
    Article Snippet: .. Following immunoprecipitation and washing, samples were resuspended in 100 μl of the appropriate restriction enzyme digest buffer, 1% bovine serum albumin (BSA) and either 30 units of BanII (New England Biolabs), 70 units high concentrate BglI (Promega), 70 units of BglI and 8 units PflM1 (New England Biolabs), or no enzyme. .. Following overnight digestion, samples were washed twice with TE buffer and processed using the standard ChIP protocol.

    DNA Purification:

    Article Title: Combined effects of cigarette smoking, alcohol drinking and eNOS Glu298Asp polymorphism on blood pressure in Chinese male hypertensive subjects
    Article Snippet: Extraction of DNA and genotyping of polymorphisms The genomic DNA was extracted according to the instructions of the GoldMag DNA Purification Kit. .. The eNOS Glu298Asp (G894→T) polymorphism was genotyped by PCR amplification of genomic DNA and subsequent restriction-endonuclease BanII (New England Biolabs, Beverly, MA) digestion.

    Marker:

    Article Title: Widespread Impact of Chromosomal Inversions on Gene Expression Uncovers Robustness via Phenotypic Buffering
    Article Snippet: The restriction enzymes used were EcoRI , BanII , PvuI , HindIII , AseI , and EcoNI purchased from New England Biolabs. .. Hyperladder I (1 kb DNA ladder) was used as a standard DNA marker.

    Lysis:

    Article Title: The Ric-8B Gene Is Highly Expressed in Proliferating Preosteoblastic Cells and Downregulated during Osteoblast Differentiation in a SWI/SNF- and C/EBP?-Mediated Manner ▿
    Article Snippet: Cells were disrupted using a Dounce homogenizer, and lysis was confirmed by trypan blue staining. .. Two A 260 units of DNA were incubated with 500 U of EcoRI, BanII, or XmaI (MC3T3 samples) and with BanII or AvaI (ROSBRG1TA samples) restriction enzymes at 37°C for 30 min in the corresponding buffer (New England BioLabs), in a final volume of 1 ml.

    Variant Assay:

    Article Title: Combined effects of cigarette smoking, alcohol drinking and eNOS Glu298Asp polymorphism on blood pressure in Chinese male hypertensive subjects
    Article Snippet: The eNOS Glu298Asp (G894→T) polymorphism was genotyped by PCR amplification of genomic DNA and subsequent restriction-endonuclease BanII (New England Biolabs, Beverly, MA) digestion. .. When the G of the G894T variant was present, a 249bp fragment was reduced to 165bp and 84bp fragments, whereas the 249bp fragment was not digested if T was present.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs banii restriction enzyme
    Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains <t>Fermentas</t> O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® <t>BanII</t> restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
    Banii Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/banii restriction enzyme/product/New England Biolabs
    Average 92 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    banii restriction enzyme - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

    Journal: BMC Medical Genetics

    Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

    doi: 10.1186/1471-2350-13-34

    Figure Lengend Snippet: Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

    Article Snippet: To identify MTHFR 677 C > T, eNOS +894 G > T and eNOS −786 T > C variants, 1.0 U Fermentas Fast Digest® HinfI restriction enzyme, 1.0 U Fermentas Fast Digest® MspI restriction enzyme and 1.0 U of NEB® BanII restriction enzyme, respectively, were used in separate tubes to avoid errors.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay

    Polymerase chain reaction products digested by BanII restriction enzyme for the detection of E23K polymorphism of KANJ11 gene. Samples were electrophoresed using a 12% polyacrylamide gel and subsequent staining with ethidium bromide. Lane 1: Deoxyribonucleic acid ladder; lane 2: E23K heterozygotes; lane 3: K23 homozygotes; lane 4: E23 homozygotes. Small bands of 32 bp and 28 bp are not visible in this figure

    Journal: Advanced Biomedical Research

    Article Title: Association of KCNJ11 (E23K) gene polymorphism with susceptibility to type 2 diabetes in Iranian patients

    doi: 10.4103/2277-9175.148256

    Figure Lengend Snippet: Polymerase chain reaction products digested by BanII restriction enzyme for the detection of E23K polymorphism of KANJ11 gene. Samples were electrophoresed using a 12% polyacrylamide gel and subsequent staining with ethidium bromide. Lane 1: Deoxyribonucleic acid ladder; lane 2: E23K heterozygotes; lane 3: K23 homozygotes; lane 4: E23 homozygotes. Small bands of 32 bp and 28 bp are not visible in this figure

    Article Snippet: For digestion 8 μl of PCR product (210 bp) was digested by 3U of a restriction enzyme BanII (New England, BioLabs.

    Techniques: Polymerase Chain Reaction, Staining

    Agarose gel electrophoresis showing variants of the G894T (rs1799983) polymorphism of the endothelial nitric oxide synthase gene. PCR products were digested in 2U of BanII restriction endonuclease. bp base pairs; Ladder: 100 bp ladder, where the 500 bp band stains most intensely, was used as a molecular weight marker.

    Journal: Gene Regulation and Systems Biology

    Article Title: Endothelin-1 but not Endothelial Nitric Oxide Synthase Gene Polymorphism is Associated with Sickle Cell Disease in Africa

    doi: 10.4137/GRSB.S14836

    Figure Lengend Snippet: Agarose gel electrophoresis showing variants of the G894T (rs1799983) polymorphism of the endothelial nitric oxide synthase gene. PCR products were digested in 2U of BanII restriction endonuclease. bp base pairs; Ladder: 100 bp ladder, where the 500 bp band stains most intensely, was used as a molecular weight marker.

    Article Snippet: For the G894T (rs1799983) polymorphism, amplified PCR products of 258 base pair band size were digested with 2U BanII (New England Biolabs, Boston MA) restriction endonuclease for 1 hour at 37 °C.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Molecular Weight, Marker