bamhi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BamHI
    Description:
    BamHI 50 000 units
    Catalog Number:
    r0136l
    Price:
    249
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bamhi
    BamHI
    BamHI 50 000 units
    https://www.bioz.com/result/bamhi/product/New England Biolabs
    Average 99 stars, based on 98 article reviews
    Price from $9.99 to $1999.99
    bamhi - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit"

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0127321

    Distinct Influences of the Ku80 C-terminus on DNA-PK Activation with Linearized Plasmid DNA. a) DNA-PK kinase stimulation with plasmid DNA linearized with EcoRV generating blunt-ended termini and with KpnI generating 4 base 3’ single stranded overhangs. b) DNA-PK kinase stimulation with plasmid DNA linearized with XhoI and BamHI generating 4 base 5’ single stranded overhangs. DNA substrates are depicted pictorially. DNA termini generated by digestion are depicted below each graph indicating locations of pyrimidines (Py) and purines (Pu). Kinase activity is reported as the mean and SD of pmol of phosphate transferred. Asterisks indicate statistically significant differences compared to wild type (p
    Figure Legend Snippet: Distinct Influences of the Ku80 C-terminus on DNA-PK Activation with Linearized Plasmid DNA. a) DNA-PK kinase stimulation with plasmid DNA linearized with EcoRV generating blunt-ended termini and with KpnI generating 4 base 3’ single stranded overhangs. b) DNA-PK kinase stimulation with plasmid DNA linearized with XhoI and BamHI generating 4 base 5’ single stranded overhangs. DNA substrates are depicted pictorially. DNA termini generated by digestion are depicted below each graph indicating locations of pyrimidines (Py) and purines (Pu). Kinase activity is reported as the mean and SD of pmol of phosphate transferred. Asterisks indicate statistically significant differences compared to wild type (p

    Techniques Used: Activation Assay, Plasmid Preparation, Generated, Activity Assay

    2) Product Images from "The P-SSP7 Cyanophage Has a Linear Genome with Direct Terminal Repeats"

    Article Title: The P-SSP7 Cyanophage Has a Linear Genome with Direct Terminal Repeats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0036710

    Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).
    Figure Legend Snippet: Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).

    Techniques Used: Clone Assay, Nucleic Acid Electrophoresis, Plasmid Preparation, Lambda DNA Preparation

    Schematic illustration of the arrangement of the P-SSP7 genome. (A) Sequencing of the ends of the P-SSP7 genome extracted directly from phage particles. Arrows, and numbers under the arrows, indicate the sequences acquired: Blue from the entire genome and green from end fragments produced by digestion of the genome with the BamHI and PmeI restriction enzymes. The positions of the primers used for sequencing are shown in black type at the beginning of the arrows. Genome numbering for the primers and sequences is that for the originally published sequence [5] . The purple line denotes the 728 bp region found to be upstream of ORF1 in this study, but positioned downstream of ORF54 in the originally published sequence. The repeat regions are shown in red at both ends of the genome. (B) Diagram showing the arrangement of the P-SSP7 genome as originally published (GenBank accession numbers: AY939843.1, [5] and GU071093 [16] . (C) Diagram of the revised genome arrangement based on the results from this study (updated GeneBank submission, accession number: AY939843.2).
    Figure Legend Snippet: Schematic illustration of the arrangement of the P-SSP7 genome. (A) Sequencing of the ends of the P-SSP7 genome extracted directly from phage particles. Arrows, and numbers under the arrows, indicate the sequences acquired: Blue from the entire genome and green from end fragments produced by digestion of the genome with the BamHI and PmeI restriction enzymes. The positions of the primers used for sequencing are shown in black type at the beginning of the arrows. Genome numbering for the primers and sequences is that for the originally published sequence [5] . The purple line denotes the 728 bp region found to be upstream of ORF1 in this study, but positioned downstream of ORF54 in the originally published sequence. The repeat regions are shown in red at both ends of the genome. (B) Diagram showing the arrangement of the P-SSP7 genome as originally published (GenBank accession numbers: AY939843.1, [5] and GU071093 [16] . (C) Diagram of the revised genome arrangement based on the results from this study (updated GeneBank submission, accession number: AY939843.2).

    Techniques Used: Sequencing, Produced

    Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).
    Figure Legend Snippet: Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).

    Techniques Used: Clone Assay, Nucleic Acid Electrophoresis, Plasmid Preparation, Lambda DNA Preparation

    3) Product Images from "Chlamydomonas reinhardtii hydin is a central pair protein required for flagellar motility"

    Article Title: Chlamydomonas reinhardtii hydin is a central pair protein required for flagellar motility

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200611115

    HY3 gene-silencing vector and anti-hydin antibody. (A) C. reinhardtii HY3 , which encodes hydin, is a gene of 17.7 kb. Fragment A, corresponding to exon 3 of HY3 , and a BamHI–SalI piece of fragment A were cloned into bacterial expression vectors, and the fusion proteins were used for antibody production and purification. A gene-silencing vector was constructed from fragment A, fragment S (another PCR product of HY3 ), a triple HA tag, and the promoter and terminator region of the LC8 gene. (B) Coomassie-stained gel (a; 4–20% SDS-PAGE) and Western blot (b; 7.5% SDS-PAGE) of isolated axonemes of CC3395 (control) and the HY3 RNAi strains hyN3 and hyN4. Anti-hydin specifically stained a band of ∼540 kD that was strongly reduced in the HY3 RNAi strains. (C) Western blots probed with anti-hydin and anti-IFT172 ( Cole et al., 1998 ) comparing the amount of hydin present in deflagellated cells (CB) and isolated flagella (Fla) or axonemes (Ax). (a) Equivalent numbers of cell bodies and flagellar pairs from ∼10 6 cells were loaded. (b) Equal amounts (∼25 μg) of cell body and axonemal protein were loaded. IFT172, an intraflagellar transport protein used as a control, is present in the cell body and flagella; a considerable amount remains with the axonemes ( Hou et al., 2004 ). (D) Immunofluorescence images of methanol-fixed cells of strains CC3395 (control), hyN4, and hyS2 labeled with anti-acetylated tubulin (a, d, and g) and anti-hydin (b, e, and h). Merged images (c, f, and i) reveal the localization of hydin to the flagella of wild-type cells and the reduction of hydin in the hydin RNAi cells. Note the shorter flagella in the latter. At least part of the fluorescence in the cell bodies stained with anti-hydin is background caused by chlorophyll autofluorescence. Bar, 5 μm.
    Figure Legend Snippet: HY3 gene-silencing vector and anti-hydin antibody. (A) C. reinhardtii HY3 , which encodes hydin, is a gene of 17.7 kb. Fragment A, corresponding to exon 3 of HY3 , and a BamHI–SalI piece of fragment A were cloned into bacterial expression vectors, and the fusion proteins were used for antibody production and purification. A gene-silencing vector was constructed from fragment A, fragment S (another PCR product of HY3 ), a triple HA tag, and the promoter and terminator region of the LC8 gene. (B) Coomassie-stained gel (a; 4–20% SDS-PAGE) and Western blot (b; 7.5% SDS-PAGE) of isolated axonemes of CC3395 (control) and the HY3 RNAi strains hyN3 and hyN4. Anti-hydin specifically stained a band of ∼540 kD that was strongly reduced in the HY3 RNAi strains. (C) Western blots probed with anti-hydin and anti-IFT172 ( Cole et al., 1998 ) comparing the amount of hydin present in deflagellated cells (CB) and isolated flagella (Fla) or axonemes (Ax). (a) Equivalent numbers of cell bodies and flagellar pairs from ∼10 6 cells were loaded. (b) Equal amounts (∼25 μg) of cell body and axonemal protein were loaded. IFT172, an intraflagellar transport protein used as a control, is present in the cell body and flagella; a considerable amount remains with the axonemes ( Hou et al., 2004 ). (D) Immunofluorescence images of methanol-fixed cells of strains CC3395 (control), hyN4, and hyS2 labeled with anti-acetylated tubulin (a, d, and g) and anti-hydin (b, e, and h). Merged images (c, f, and i) reveal the localization of hydin to the flagella of wild-type cells and the reduction of hydin in the hydin RNAi cells. Note the shorter flagella in the latter. At least part of the fluorescence in the cell bodies stained with anti-hydin is background caused by chlorophyll autofluorescence. Bar, 5 μm.

    Techniques Used: Plasmid Preparation, Clone Assay, Expressing, Purification, Construct, Polymerase Chain Reaction, Staining, SDS Page, Western Blot, Isolation, Immunofluorescence, Labeling, Fluorescence

    4) Product Images from "Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq"

    Article Title: Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq

    Journal: mBio

    doi: 10.1128/mBio.00315-10

    Tn-seq circle method. The steps used to amplify and sequence transposon insertion junctions are illustrated, beginning with a DNA fragment carrying a transposon insertion (top). First, total DNA from a mutant pool is sheared and end repaired, and one Illumina adaptor (A2) is ligated to all free ends (step 1). The sample is then digested with a restriction enzyme that cuts near one transposon end (in this work, BamHI, which cuts 114 bp from the transposon’s left end) (step 2). Following a size selection step, single-strand fragments which include the transposon end are circularized by templated ligation (step 3). Oligo, oligonucleotide. Fragments which have not circularized (representing most of the DNA in the sample) are degraded in a subsequent exonuclease step (step 4). The transposon-genome junctions from the circularized fragments are then amplified by quantitative PCR in a step in which the second required Illumina adaptor (A1) is introduced (step 5). The products are sequenced on an Illumina flow cell using a sequencing primer corresponding to the transposon end (Seq), and each sequence read is then mapped to the genome (step 6).
    Figure Legend Snippet: Tn-seq circle method. The steps used to amplify and sequence transposon insertion junctions are illustrated, beginning with a DNA fragment carrying a transposon insertion (top). First, total DNA from a mutant pool is sheared and end repaired, and one Illumina adaptor (A2) is ligated to all free ends (step 1). The sample is then digested with a restriction enzyme that cuts near one transposon end (in this work, BamHI, which cuts 114 bp from the transposon’s left end) (step 2). Following a size selection step, single-strand fragments which include the transposon end are circularized by templated ligation (step 3). Oligo, oligonucleotide. Fragments which have not circularized (representing most of the DNA in the sample) are degraded in a subsequent exonuclease step (step 4). The transposon-genome junctions from the circularized fragments are then amplified by quantitative PCR in a step in which the second required Illumina adaptor (A1) is introduced (step 5). The products are sequenced on an Illumina flow cell using a sequencing primer corresponding to the transposon end (Seq), and each sequence read is then mapped to the genome (step 6).

    Techniques Used: Sequencing, Mutagenesis, Selection, Ligation, Amplification, Real-time Polymerase Chain Reaction

    5) Product Images from "Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection"

    Article Title: Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0114208

    Lysates of N. gonorrhoeae fragments pECFP-N1 and damage DNA from VK2/E6E7 cells. A. DNA agarose gel showing the digestion of pECFP-N1 plasmid by HindIII (positive control, lane 2), MS11 P+ lysate (lane 3), and MS11 P+ HI lysate (lane 5). Lane 5 shows bacterial MS11 P+ lysate without pECFP-N1 and lane 1 shows uncut circular pECFP-N1. B. PFGE analysis of purified VK2/E6E7 genomic DNA treated for 24 h with: lane 1: PBS (negative control), lane 2: MS11 P+ lysate, lane 3: MS11 P+ HI lysate. Lane 4 shows bacterial MS11 P+ lysate without VK2/E6E7 genomic DNA. C. Graph showing quantification of DNA smears (measured directly underneath and below the band). Shown are smear pixel intensities of cellular DNA alone and cellular DNA exposed to bacterial lysates and HI bacterial lysates. D. PFGE showing genomic DNA subjected to commercial restriction enzymes for 24 h. Lane 1: DNA incubated with CutSmart reaction buffer (negative control). Lane 2: DNA incubated with NgoMIV. Lane 3: DNA incubated with MfeI, Lane 4: DNA incubated with NgoMIV and MfeI Lane 5: DNA incubated with NgoMIV and BamHI/KpnI/MfeI (BKM).
    Figure Legend Snippet: Lysates of N. gonorrhoeae fragments pECFP-N1 and damage DNA from VK2/E6E7 cells. A. DNA agarose gel showing the digestion of pECFP-N1 plasmid by HindIII (positive control, lane 2), MS11 P+ lysate (lane 3), and MS11 P+ HI lysate (lane 5). Lane 5 shows bacterial MS11 P+ lysate without pECFP-N1 and lane 1 shows uncut circular pECFP-N1. B. PFGE analysis of purified VK2/E6E7 genomic DNA treated for 24 h with: lane 1: PBS (negative control), lane 2: MS11 P+ lysate, lane 3: MS11 P+ HI lysate. Lane 4 shows bacterial MS11 P+ lysate without VK2/E6E7 genomic DNA. C. Graph showing quantification of DNA smears (measured directly underneath and below the band). Shown are smear pixel intensities of cellular DNA alone and cellular DNA exposed to bacterial lysates and HI bacterial lysates. D. PFGE showing genomic DNA subjected to commercial restriction enzymes for 24 h. Lane 1: DNA incubated with CutSmart reaction buffer (negative control). Lane 2: DNA incubated with NgoMIV. Lane 3: DNA incubated with MfeI, Lane 4: DNA incubated with NgoMIV and MfeI Lane 5: DNA incubated with NgoMIV and BamHI/KpnI/MfeI (BKM).

    Techniques Used: Agarose Gel Electrophoresis, Plasmid Preparation, Positive Control, Purification, Negative Control, Incubation

    6) Product Images from "Novel N4-Like Bacteriophages of Pectobacterium atrosepticum"

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum

    Journal: Pharmaceuticals

    doi: 10.3390/ph11020045

    Genomic DNA of Pectobacterium phages CB1, CB3, and CB4, BamHI-digested (lanes 3, 5, and 7, respectively) and undigested (lanes 2, 4, and 6, respectively). Lane 1, DNA marker (Hyperladder 1 kb, Bioline). Gel concentration 1% w / v agarose.
    Figure Legend Snippet: Genomic DNA of Pectobacterium phages CB1, CB3, and CB4, BamHI-digested (lanes 3, 5, and 7, respectively) and undigested (lanes 2, 4, and 6, respectively). Lane 1, DNA marker (Hyperladder 1 kb, Bioline). Gel concentration 1% w / v agarose.

    Techniques Used: Marker, Concentration Assay

    7) Product Images from "Probing hyper-negatively supercoiled mini-circles with nucleases and DNA binding proteins"

    Article Title: Probing hyper-negatively supercoiled mini-circles with nucleases and DNA binding proteins

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0202138

    Sites of structural changes induced by the hyper-negative supercoiling detected by Nuclease SI. (A) Experimental scheme. The red-filled circle designates 32 P. The different steps of the experiment are indicated: first (1), the digestion by the Nuclease SI; second (2), the digestion by (BamHI + BglII) or (BahmHI + HindIII); third (3), electrophoresis on a sequencing gel. (B) The enzymatic probe used to map the fine structure of the T -2 and T -6 topoisomers is Nuclease SI. Nuclease SI is at 2 mU microL -1 and DNA at 0.5 nM. After the Nuclease SI reaction, the samples are treated to remove the proteins. The DNAs are precipitated and submitted to the BamHI+HindIII double digestion to only visualize DNA fragments from one of the two radiolabeled strands. The reaction products are analyzed on two different sequencing gels (8% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 5) or the guanines and adenines (G+A lanes; lanes 2 and 6). (C) Same as 3B except that the samples are submitted to the BglII+BamHI double digestion to only visualize DNA fragments from the complementary radiolabeled strands. The reaction products are analyzed on two different sequencing gels (7% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 7) or the guanines and adenines (G+A lanes; lanes 2 and 6).
    Figure Legend Snippet: Sites of structural changes induced by the hyper-negative supercoiling detected by Nuclease SI. (A) Experimental scheme. The red-filled circle designates 32 P. The different steps of the experiment are indicated: first (1), the digestion by the Nuclease SI; second (2), the digestion by (BamHI + BglII) or (BahmHI + HindIII); third (3), electrophoresis on a sequencing gel. (B) The enzymatic probe used to map the fine structure of the T -2 and T -6 topoisomers is Nuclease SI. Nuclease SI is at 2 mU microL -1 and DNA at 0.5 nM. After the Nuclease SI reaction, the samples are treated to remove the proteins. The DNAs are precipitated and submitted to the BamHI+HindIII double digestion to only visualize DNA fragments from one of the two radiolabeled strands. The reaction products are analyzed on two different sequencing gels (8% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 5) or the guanines and adenines (G+A lanes; lanes 2 and 6). (C) Same as 3B except that the samples are submitted to the BglII+BamHI double digestion to only visualize DNA fragments from the complementary radiolabeled strands. The reaction products are analyzed on two different sequencing gels (7% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 7) or the guanines and adenines (G+A lanes; lanes 2 and 6).

    Techniques Used: Electrophoresis, Sequencing

    8) Product Images from "Probing hyper-negatively supercoiled mini-circles with nucleases and DNA binding proteins"

    Article Title: Probing hyper-negatively supercoiled mini-circles with nucleases and DNA binding proteins

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0202138

    Sites of structural changes induced by the hyper-negative supercoiling detected by Nuclease SI. (A) Experimental scheme. The red-filled circle designates 32 P. The different steps of the experiment are indicated: first (1), the digestion by the Nuclease SI; second (2), the digestion by (BamHI + BglII) or (BahmHI + HindIII); third (3), electrophoresis on a sequencing gel. (B) The enzymatic probe used to map the fine structure of the T -2 and T -6 topoisomers is Nuclease SI. Nuclease SI is at 2 mU microL -1 and DNA at 0.5 nM. After the Nuclease SI reaction, the samples are treated to remove the proteins. The DNAs are precipitated and submitted to the BamHI+HindIII double digestion to only visualize DNA fragments from one of the two radiolabeled strands. The reaction products are analyzed on two different sequencing gels (8% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 5) or the guanines and adenines (G+A lanes; lanes 2 and 6). (C) Same as 3B except that the samples are submitted to the BglII+BamHI double digestion to only visualize DNA fragments from the complementary radiolabeled strands. The reaction products are analyzed on two different sequencing gels (7% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 7) or the guanines and adenines (G+A lanes; lanes 2 and 6).
    Figure Legend Snippet: Sites of structural changes induced by the hyper-negative supercoiling detected by Nuclease SI. (A) Experimental scheme. The red-filled circle designates 32 P. The different steps of the experiment are indicated: first (1), the digestion by the Nuclease SI; second (2), the digestion by (BamHI + BglII) or (BahmHI + HindIII); third (3), electrophoresis on a sequencing gel. (B) The enzymatic probe used to map the fine structure of the T -2 and T -6 topoisomers is Nuclease SI. Nuclease SI is at 2 mU microL -1 and DNA at 0.5 nM. After the Nuclease SI reaction, the samples are treated to remove the proteins. The DNAs are precipitated and submitted to the BamHI+HindIII double digestion to only visualize DNA fragments from one of the two radiolabeled strands. The reaction products are analyzed on two different sequencing gels (8% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 5) or the guanines and adenines (G+A lanes; lanes 2 and 6). (C) Same as 3B except that the samples are submitted to the BglII+BamHI double digestion to only visualize DNA fragments from the complementary radiolabeled strands. The reaction products are analyzed on two different sequencing gels (7% to see long DNA fragments, 12% to see short DNA fragments) as indicated. G and G+A lanes correspond to the products of the Maxam and Gilbert reactions to identify specifically the guanines (G lanes; lanes 1 and 7) or the guanines and adenines (G+A lanes; lanes 2 and 6).

    Techniques Used: Electrophoresis, Sequencing

    9) Product Images from "Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena"

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena

    Journal: Genes

    doi: 10.3390/genes9040179

    Effect on cell sensitivity to 6mp of replacing wild-type APRT1 with the mutant gene. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pD127N-FZZ-PAC, with the mutant gene, FZZ tag containing polyA signal, and puromycin resistant cassette ( PAC ) (middle), and after homologous recombination (lower). Control plasmid carries wild-type APRT1 instead of the mutated version. ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and FZZ-tagged APRTase-expressing transformants. The molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Western blot analysis of FZZ-tagged APRTases. FZZ tag and APRTase were 17 kDa and 20 kDa, respectively, resulting in a single 37 kDa band. Tubulin-alpha was the loading control. ( D ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h.
    Figure Legend Snippet: Effect on cell sensitivity to 6mp of replacing wild-type APRT1 with the mutant gene. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pD127N-FZZ-PAC, with the mutant gene, FZZ tag containing polyA signal, and puromycin resistant cassette ( PAC ) (middle), and after homologous recombination (lower). Control plasmid carries wild-type APRT1 instead of the mutated version. ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and FZZ-tagged APRTase-expressing transformants. The molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Western blot analysis of FZZ-tagged APRTases. FZZ tag and APRTase were 17 kDa and 20 kDa, respectively, resulting in a single 37 kDa band. Tubulin-alpha was the loading control. ( D ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h.

    Techniques Used: Mutagenesis, Plasmid Preparation, Homologous Recombination, Southern Blot, Expressing, Molecular Weight, Western Blot

    Effect of partial APRT1 knockout on cell sensitivity to 6mp. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pΔAPRT1-NEO5, with paromomycin resistance cassette ( NEO5 ) (middle), and after homologous recombination (lower). ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and partial APRT1 knockout cells. Molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h. ( D ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after measurement of cell growth rates in 6mp. ( E ) Southern blot analysis of XhoI-and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after the induction of phenotypic assortment with 5 mg/mL paromomycin for 2 months. Molecular weight of signals against the probe corresponds to that predicted in the schematic in ( A ).
    Figure Legend Snippet: Effect of partial APRT1 knockout on cell sensitivity to 6mp. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pΔAPRT1-NEO5, with paromomycin resistance cassette ( NEO5 ) (middle), and after homologous recombination (lower). ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and partial APRT1 knockout cells. Molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h. ( D ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after measurement of cell growth rates in 6mp. ( E ) Southern blot analysis of XhoI-and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after the induction of phenotypic assortment with 5 mg/mL paromomycin for 2 months. Molecular weight of signals against the probe corresponds to that predicted in the schematic in ( A ).

    Techniques Used: Knock-Out, Plasmid Preparation, Homologous Recombination, Southern Blot, Molecular Weight

    10) Product Images from "Genetic Stabilization of the Drug-Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction-Modification System"

    Article Title: Genetic Stabilization of the Drug-Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction-Modification System

    Journal: mBio

    doi: 10.1128/mBio.00173-15

    Characterization of (R-M system) DpnIII demonstrating that R.DpnIII cleaves DNA at 5′ GATC 3′ and M.DpnIII methylates DNA at the cytosine. (A) Digestion of pUC19 and spectinomycin R with a histidine-tagged DpnIII-enriched fraction and Sau3AI, showing bands consistent with digestion at GATC. (B) Genomic DNA isolated from the WT and RMKO strains combined with endonucleases that cleave at GATC but are inhibited by methylation at different positions (cleavage by BamHI, BglII, and Sau3AI is inhibited by methylation of the cytosine, and cleavage by BclI and MboI is inhibited by methylation of the adenine). (C) WT and RMKO DNA mixed with Sau3AI and histidine-tagged DpnIII, where only the RMKO is susceptible to digestion. Further, WT DNA of strain 8140 is protected by digestion with Sau3AI and DpnIII. Enz., enzyme; MM, mass markers. The values to the left of panel A are molecular masses in base pairs.
    Figure Legend Snippet: Characterization of (R-M system) DpnIII demonstrating that R.DpnIII cleaves DNA at 5′ GATC 3′ and M.DpnIII methylates DNA at the cytosine. (A) Digestion of pUC19 and spectinomycin R with a histidine-tagged DpnIII-enriched fraction and Sau3AI, showing bands consistent with digestion at GATC. (B) Genomic DNA isolated from the WT and RMKO strains combined with endonucleases that cleave at GATC but are inhibited by methylation at different positions (cleavage by BamHI, BglII, and Sau3AI is inhibited by methylation of the cytosine, and cleavage by BclI and MboI is inhibited by methylation of the adenine). (C) WT and RMKO DNA mixed with Sau3AI and histidine-tagged DpnIII, where only the RMKO is susceptible to digestion. Further, WT DNA of strain 8140 is protected by digestion with Sau3AI and DpnIII. Enz., enzyme; MM, mass markers. The values to the left of panel A are molecular masses in base pairs.

    Techniques Used: Isolation, Methylation

    11) Product Images from "Genetic Stabilization of the Drug-Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction-Modification System"

    Article Title: Genetic Stabilization of the Drug-Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction-Modification System

    Journal: mBio

    doi: 10.1128/mBio.00173-15

    Characterization of (R-M system) DpnIII demonstrating that R.DpnIII cleaves DNA at 5′ GATC 3′ and M.DpnIII methylates DNA at the cytosine. (A) Digestion of pUC19 and spectinomycin R with a histidine-tagged DpnIII-enriched fraction and Sau3AI, showing bands consistent with digestion at GATC. (B) Genomic DNA isolated from the WT and RMKO strains combined with endonucleases that cleave at GATC but are inhibited by methylation at different positions (cleavage by BamHI, BglII, and Sau3AI is inhibited by methylation of the cytosine, and cleavage by BclI and MboI is inhibited by methylation of the adenine). (C) WT and RMKO DNA mixed with Sau3AI and histidine-tagged DpnIII, where only the RMKO is susceptible to digestion. Further, WT DNA of strain 8140 is protected by digestion with Sau3AI and DpnIII. Enz., enzyme; MM, mass markers. The values to the left of panel A are molecular masses in base pairs.
    Figure Legend Snippet: Characterization of (R-M system) DpnIII demonstrating that R.DpnIII cleaves DNA at 5′ GATC 3′ and M.DpnIII methylates DNA at the cytosine. (A) Digestion of pUC19 and spectinomycin R with a histidine-tagged DpnIII-enriched fraction and Sau3AI, showing bands consistent with digestion at GATC. (B) Genomic DNA isolated from the WT and RMKO strains combined with endonucleases that cleave at GATC but are inhibited by methylation at different positions (cleavage by BamHI, BglII, and Sau3AI is inhibited by methylation of the cytosine, and cleavage by BclI and MboI is inhibited by methylation of the adenine). (C) WT and RMKO DNA mixed with Sau3AI and histidine-tagged DpnIII, where only the RMKO is susceptible to digestion. Further, WT DNA of strain 8140 is protected by digestion with Sau3AI and DpnIII. Enz., enzyme; MM, mass markers. The values to the left of panel A are molecular masses in base pairs.

    Techniques Used: Isolation, Methylation

    12) Product Images from "Design and Characterization of Bioengineered Cancer-Like Stem Cells"

    Article Title: Design and Characterization of Bioengineered Cancer-Like Stem Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0141172

    Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.
    Figure Legend Snippet: Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.

    Techniques Used: Subcloning, Clone Assay, DNA Sequencing

    Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.
    Figure Legend Snippet: Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.

    Techniques Used: Subcloning, Clone Assay, DNA Sequencing

    13) Product Images from "Enhanced antifungal activity of bovine lactoferrin-producing probiotic Lactobacillus casei in the murine model of vulvovaginal candidiasis"

    Article Title: Enhanced antifungal activity of bovine lactoferrin-producing probiotic Lactobacillus casei in the murine model of vulvovaginal candidiasis

    Journal: BMC Microbiology

    doi: 10.1186/s12866-018-1370-x

    Construction and expression of the secretion plasmid pPG612.1-BLF in L.casei . a The synthetic BLF gene fragment (2.1kp) was digested with restriction enzymes BamHI and XhoI, and ligated into the sticky end of the plasmid pPG612.1 which was also digested with the same restriction enzyme, resulting in the plasmid pPG612.1-BLF (5.6kp). b The plasmid pPG612.1-BLF was electroporated into L.casei using a BioRad GenePulser with single electric pulse (voltage, 1.5 kV; capacitance, 25 μF; and resistance, 400 Ω.). PCR amplification of the BamHI site and XhoI site of the plasmid pPG612.1-BLF which was extracted from the L.casei /pPG612.1-BLF strain resulted in 500 bp and 800 bp products, respectively. Lane 1, PCR product of XhoI site; Lane 2, PCR product of BamHI site. M, DNA maker. c BLF was detected in the supernatant and pellet of L.casei /pPG612.1-BLF culture by Western blotting, indicating the expression and secretion of BLF by L.casei /pPG612.1-BLF. Lane 1, supernatant of L.casei /pPG612.1-BLF culture; Lane 2, pellet of L.casei /pPG612.1-BLF culture; Lane 3, supernatant of L.casei /pPG612.1 culture; Lane 4, pellet of L.casei /pPG612.1 culture
    Figure Legend Snippet: Construction and expression of the secretion plasmid pPG612.1-BLF in L.casei . a The synthetic BLF gene fragment (2.1kp) was digested with restriction enzymes BamHI and XhoI, and ligated into the sticky end of the plasmid pPG612.1 which was also digested with the same restriction enzyme, resulting in the plasmid pPG612.1-BLF (5.6kp). b The plasmid pPG612.1-BLF was electroporated into L.casei using a BioRad GenePulser with single electric pulse (voltage, 1.5 kV; capacitance, 25 μF; and resistance, 400 Ω.). PCR amplification of the BamHI site and XhoI site of the plasmid pPG612.1-BLF which was extracted from the L.casei /pPG612.1-BLF strain resulted in 500 bp and 800 bp products, respectively. Lane 1, PCR product of XhoI site; Lane 2, PCR product of BamHI site. M, DNA maker. c BLF was detected in the supernatant and pellet of L.casei /pPG612.1-BLF culture by Western blotting, indicating the expression and secretion of BLF by L.casei /pPG612.1-BLF. Lane 1, supernatant of L.casei /pPG612.1-BLF culture; Lane 2, pellet of L.casei /pPG612.1-BLF culture; Lane 3, supernatant of L.casei /pPG612.1 culture; Lane 4, pellet of L.casei /pPG612.1 culture

    Techniques Used: Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Western Blot

    14) Product Images from "Evidence Suggesting Absence of Mitochondrial DNA Methylation"

    Article Title: Evidence Suggesting Absence of Mitochondrial DNA Methylation

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2017.00166

    BamHI digestion prior to bisulfite sequencing decreases cytosine unconvertion rate. Targeted bisulfite sequencing was used to compare undigested and digested DNA methylation levels at five different regions of the mtDNA from human muscle cells and SKOV3 cells ( N = 3). (A) Drawing displays the mtDNA regions investigated by targeted bisulfite sequencing. (B) Percentage methylation for undigested and digested mtDNA. Full circle represents cytosines in CpG context whereas open circle is cytosines in non-CpG context. Results are presented with a min-max interval and a sign test was used to test for significant methylation differences. D-loop (6–298) P = 2.02E-41 (Lonza) and P = 1.40E-24 (SKOV3); D-loop (279–458): P = 5.00E-12 (Lonza) and P = 8.20E-08 (SKOV3); tRNA-F+12S: P = 9.22E-15 (Lonza) and P = 1.29E-9 (SKOV3); 16S: P = 6.50E-05; ND5: P = 1.70E-05 (Lonza) and P = 9.97E-13 (SKOV3); CYTB: P = 2.96E-09 (Lonza), and P = 6.68E-13 (SKOV3). D-loop (6–298) includes origin of replication and tRNA-F+12S includes heavy strand promoter 2. P H1 : heavy-strand promoter 1; P H2 : Heavy-strand promote 2; P L : Light-strand promoter; OH: Origin of replication from heavy-strand; O L : Origin of replication from light-strand. ND: not determined.
    Figure Legend Snippet: BamHI digestion prior to bisulfite sequencing decreases cytosine unconvertion rate. Targeted bisulfite sequencing was used to compare undigested and digested DNA methylation levels at five different regions of the mtDNA from human muscle cells and SKOV3 cells ( N = 3). (A) Drawing displays the mtDNA regions investigated by targeted bisulfite sequencing. (B) Percentage methylation for undigested and digested mtDNA. Full circle represents cytosines in CpG context whereas open circle is cytosines in non-CpG context. Results are presented with a min-max interval and a sign test was used to test for significant methylation differences. D-loop (6–298) P = 2.02E-41 (Lonza) and P = 1.40E-24 (SKOV3); D-loop (279–458): P = 5.00E-12 (Lonza) and P = 8.20E-08 (SKOV3); tRNA-F+12S: P = 9.22E-15 (Lonza) and P = 1.29E-9 (SKOV3); 16S: P = 6.50E-05; ND5: P = 1.70E-05 (Lonza) and P = 9.97E-13 (SKOV3); CYTB: P = 2.96E-09 (Lonza), and P = 6.68E-13 (SKOV3). D-loop (6–298) includes origin of replication and tRNA-F+12S includes heavy strand promoter 2. P H1 : heavy-strand promoter 1; P H2 : Heavy-strand promote 2; P L : Light-strand promoter; OH: Origin of replication from heavy-strand; O L : Origin of replication from light-strand. ND: not determined.

    Techniques Used: Methylation Sequencing, DNA Methylation Assay, Methylation

    15) Product Images from "PhaQ, a New Class of Poly-?-Hydroxybutyrate (PHB)-Responsive Repressor, Regulates phaQ and phaP (Phasin) Expression in Bacillus megaterium through Interaction with PHB"

    Article Title: PhaQ, a New Class of Poly-?-Hydroxybutyrate (PHB)-Responsive Repressor, Regulates phaQ and phaP (Phasin) Expression in Bacillus megaterium through Interaction with PHB

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.10.3015-3021.2004

    DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.
    Figure Legend Snippet: DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.

    Techniques Used: Footprinting, Binding Assay, Labeling, Incubation

    DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.
    Figure Legend Snippet: DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.

    Techniques Used: Footprinting, Binding Assay, Labeling, Incubation

    16) Product Images from "Determining DNA Supercoiling Enthalpy by Isothermal Titration Calorimetry"

    Article Title: Determining DNA Supercoiling Enthalpy by Isothermal Titration Calorimetry

    Journal: Biochimie

    doi: 10.1016/j.biochi.2012.08.002

    (A) The plasmid map of pXXZ6. Restriction enzyme recognition sites of BamHI, HindIII, and Nt.BbvCI are shown. For supercoiled pXXZ6 used in this study, the supercoiling density was determined to be −0.061. (B) DNA intercalator ethidium bromide
    Figure Legend Snippet: (A) The plasmid map of pXXZ6. Restriction enzyme recognition sites of BamHI, HindIII, and Nt.BbvCI are shown. For supercoiled pXXZ6 used in this study, the supercoiling density was determined to be −0.061. (B) DNA intercalator ethidium bromide

    Techniques Used: Plasmid Preparation

    17) Product Images from "SETD2-dependent H3K36me3 plays a critical role in epigenetic regulation of the HPV31 life cycle"

    Article Title: SETD2-dependent H3K36me3 plays a critical role in epigenetic regulation of the HPV31 life cycle

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1007367

    SETD2 is necessary for productive viral replication. (A) CIN612 cells were transiently transduced with either a scramble control shRNA (shScram) or one of two SETD2 shRNAs (shSetd2#1 and shSetd2#2) for 72hrs. At this time, DNA and protein were either harvested as an undifferentiated (T0) sample, or cells were grown in high calcium medium to induce differentiation (72hr). DNA was digested with BamHI, which does not cut the viral genome, and Southern blot analysis was performed using the HPV31 genome as a probe. Lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate the decrease in SETD2 and H3K36me3 upon shRNA-mediated knockdown. Involucrin and K10 were used as markers of differentiation, and p84 and histone H3.1 (H3.1) served as loading controls. (B) CIN612 cells were transduced with lentivirus expressing either control guide RNAs (sgCTR) or guide RNAs targeting SETD2 (sgSETD2 #1 and sgSETD2 #2) and selected with puromycin. Following selection, DNA and protein were harvested from the heterogenous population of cells. DNA was digested with BamHI (non-cutter) and Southern blot analysis performed using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of SETD2, involucrin and K10 as differentiation controls, with GAPDH as a loading control. (A, B) Fold change in episome copy number for SETD2 knockdown using shRNAs as well as guide RNAs was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Shown is the fold change relative to shScram T0 (A) and sgCTR T0 (B), which are set to one. Error bars represent means +/- standard error. Statistics were assayed using a student’s t test. *p≤ .05. WB = western blot. Ca = calcium.
    Figure Legend Snippet: SETD2 is necessary for productive viral replication. (A) CIN612 cells were transiently transduced with either a scramble control shRNA (shScram) or one of two SETD2 shRNAs (shSetd2#1 and shSetd2#2) for 72hrs. At this time, DNA and protein were either harvested as an undifferentiated (T0) sample, or cells were grown in high calcium medium to induce differentiation (72hr). DNA was digested with BamHI, which does not cut the viral genome, and Southern blot analysis was performed using the HPV31 genome as a probe. Lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate the decrease in SETD2 and H3K36me3 upon shRNA-mediated knockdown. Involucrin and K10 were used as markers of differentiation, and p84 and histone H3.1 (H3.1) served as loading controls. (B) CIN612 cells were transduced with lentivirus expressing either control guide RNAs (sgCTR) or guide RNAs targeting SETD2 (sgSETD2 #1 and sgSETD2 #2) and selected with puromycin. Following selection, DNA and protein were harvested from the heterogenous population of cells. DNA was digested with BamHI (non-cutter) and Southern blot analysis performed using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of SETD2, involucrin and K10 as differentiation controls, with GAPDH as a loading control. (A, B) Fold change in episome copy number for SETD2 knockdown using shRNAs as well as guide RNAs was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Shown is the fold change relative to shScram T0 (A) and sgCTR T0 (B), which are set to one. Error bars represent means +/- standard error. Statistics were assayed using a student’s t test. *p≤ .05. WB = western blot. Ca = calcium.

    Techniques Used: Transduction, shRNA, Southern Blot, Expressing, Selection, Western Blot, Software

    H3K36me3 is required for productive viral replication. (A) CIN612 cells were left untreated (UT) or transduced with lentivirus expressing either wild-type (WT) H3.3 or the H3.3K36M mutant. 72hr post-transduction, cells were harvested as a T0 (undifferentiated) or differentiated in high calcium medium for 72hr. (B) CIN612 cells were transduced with either pLenti-control (CTR) or pLenti-FLAG-KDM4A. Following selection in puromycin, cells were harvested as a T0 (undifferentiated) or were induced in high calcium for 72hr. For (A) and (B) DNA and protein were harvested at the indicated time points. DNA was digested with BamHI (non-cutter) and Southern blotting analysis was performed to analyze episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of H3K36me3, with H3.1 serving as a loading control. Involucrin and K10 were used as markers of differentiation and GAPDH as loading control. For (B) western blot analysis was performed using an antibody to FLAG to detect KDM4A. For (A) and (B), fold change in episome copy number was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to (A) UT T0 and (B) pLenti-CTR, which are set to one. Error bars represent means ± standard errors. Statistics were assayed using a student’s t test. * p
    Figure Legend Snippet: H3K36me3 is required for productive viral replication. (A) CIN612 cells were left untreated (UT) or transduced with lentivirus expressing either wild-type (WT) H3.3 or the H3.3K36M mutant. 72hr post-transduction, cells were harvested as a T0 (undifferentiated) or differentiated in high calcium medium for 72hr. (B) CIN612 cells were transduced with either pLenti-control (CTR) or pLenti-FLAG-KDM4A. Following selection in puromycin, cells were harvested as a T0 (undifferentiated) or were induced in high calcium for 72hr. For (A) and (B) DNA and protein were harvested at the indicated time points. DNA was digested with BamHI (non-cutter) and Southern blotting analysis was performed to analyze episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of H3K36me3, with H3.1 serving as a loading control. Involucrin and K10 were used as markers of differentiation and GAPDH as loading control. For (B) western blot analysis was performed using an antibody to FLAG to detect KDM4A. For (A) and (B), fold change in episome copy number was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to (A) UT T0 and (B) pLenti-CTR, which are set to one. Error bars represent means ± standard errors. Statistics were assayed using a student’s t test. * p

    Techniques Used: Transduction, Expressing, Mutagenesis, Selection, Southern Blot, Western Blot, Software

    18) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.
    Figure Legend Snippet: Experimental design for the Bioanalyzer 2100 to identify site-specific endonuclease inhibition by opioid compounds, HindIII, EcoRI, BamHI and SalI.

    Techniques Used: Inhibition

    ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.
    Figure Legend Snippet: ( A ) Electrograms generated using the Bioanalyzer 2100 of 742 bp dsDNA fragment with treatment by endonucleases BamHI, HindIII, SalI and EcoRI. Electrograms of the 742 bp fragment were pre-incubated for 5 h with either ( B ) MC3 , ( C ) HC3 and ( D ) OC3 , followed by exposure over night to the type II restriction endonuclease.

    Techniques Used: Generated, Incubation

    19) Product Images from "Ruler elements in chromatin remodelers set nucleosome array spacing and phasing"

    Article Title: Ruler elements in chromatin remodelers set nucleosome array spacing and phasing

    Journal: bioRxiv

    doi: 10.1101/2020.02.28.969618

    Quantification of barrier-aligned nucleosome array features depending on barrier, remodeler and nucleosome density. (A) Composite plots of same MNase-seq data for INO80 as in Figure 1D but aligned at anti-Reb1 SLIM-ChlP-defined Reb1 sites (left), or at BamHI sites (right) of SGD chromatin reconstituted at the indicated nucleosome densities and incubated with INO80 and BamHI. (B) Scheme defining array features quantified from barrier-aligned composite plots as in panel A. (C) – (D) Array feature values for the indicated combinations of barrier, remodeler and nucleosome density plotted in different ways allowing comparison between barriers (especially panel C), values (especially panel D) and remodelers (especially panel E). Chd1 refers to the Chd1/FACT complex. Panel D and Figure S2A-C show individual replicates, panels C and E replicate averages.
    Figure Legend Snippet: Quantification of barrier-aligned nucleosome array features depending on barrier, remodeler and nucleosome density. (A) Composite plots of same MNase-seq data for INO80 as in Figure 1D but aligned at anti-Reb1 SLIM-ChlP-defined Reb1 sites (left), or at BamHI sites (right) of SGD chromatin reconstituted at the indicated nucleosome densities and incubated with INO80 and BamHI. (B) Scheme defining array features quantified from barrier-aligned composite plots as in panel A. (C) – (D) Array feature values for the indicated combinations of barrier, remodeler and nucleosome density plotted in different ways allowing comparison between barriers (especially panel C), values (especially panel D) and remodelers (especially panel E). Chd1 refers to the Chd1/FACT complex. Panel D and Figure S2A-C show individual replicates, panels C and E replicate averages.

    Techniques Used: Incubation

    associated with Figures 1 and 2. (A) SDS-PAGE analyses of purified remodeler complexes. (B) Composite plots as in Figure 1D for individual replicates and the indicated combinations of remodeler, Reb1 and nucleosome density. “no remodeler” denotes absence of remodeler. (C) Composite plots aligned at in vivo +1 nucleosome positions (left), Reb1 (middle) or BamHI (right) sites for MNase-seq analysis of SGD chromatin assembled at high nucleosome density and incubated with the indicated remodelers as in Figure 2A (no refill) or with doubling remodeler concentration for the second half of incubation time (refill).
    Figure Legend Snippet: associated with Figures 1 and 2. (A) SDS-PAGE analyses of purified remodeler complexes. (B) Composite plots as in Figure 1D for individual replicates and the indicated combinations of remodeler, Reb1 and nucleosome density. “no remodeler” denotes absence of remodeler. (C) Composite plots aligned at in vivo +1 nucleosome positions (left), Reb1 (middle) or BamHI (right) sites for MNase-seq analysis of SGD chromatin assembled at high nucleosome density and incubated with the indicated remodelers as in Figure 2A (no refill) or with doubling remodeler concentration for the second half of incubation time (refill).

    Techniques Used: SDS Page, Purification, In Vivo, Incubation, Concentration Assay

    20) Product Images from "RNA aptamer inhibitors of a restriction endonuclease"

    Article Title: RNA aptamer inhibitors of a restriction endonuclease

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv702

    In vitro selection process. ( A ) RNA aptamer library format, random region and tetraloop highlighted in black. ( B ) Fraction of RNA recovered from selections against BamHI (blue circles), KpnI (green triangles) and PacI (red squares), as a function of selection round.
    Figure Legend Snippet: In vitro selection process. ( A ) RNA aptamer library format, random region and tetraloop highlighted in black. ( B ) Fraction of RNA recovered from selections against BamHI (blue circles), KpnI (green triangles) and PacI (red squares), as a function of selection round.

    Techniques Used: In Vitro, Selection

    21) Product Images from "TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression"

    Article Title: TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0186568

    pET-BccI untreated and digested. 1 : DNA ladder. 2 : pET-BccI untreated. 3 : pET-BccI digested with BccI. 4 , 5 , 6 : pET-BccI digested with EcoRI, BamHI and HindIII, respectively.
    Figure Legend Snippet: pET-BccI untreated and digested. 1 : DNA ladder. 2 : pET-BccI untreated. 3 : pET-BccI digested with BccI. 4 , 5 , 6 : pET-BccI digested with EcoRI, BamHI and HindIII, respectively.

    Techniques Used: Positron Emission Tomography

    Screening for E . coli colonies transformed with recombinant pET-BccI. Plasmid preparations from cultures inoculated with transformed colonies were digested with BamHI and subjected to electrophoresis. A ) For BRP recombinants pET-BccI screening, the presence of a 283 bp DNA band indicated there was no recombination (A3, A7, A9), whereas the presence of a 636 bp insert DNA band showed a successful recombination (A2, A4, A5, A6, A8). B ) For CAT recombinants pET-BccI screening, again the presence of a 283 bp DNA band indicated there was no recombination (B2, B5, B6, B8), whereas the presence of a 924 bp insert DNA band showed a successful recombination (B3, B4, B7, B9).
    Figure Legend Snippet: Screening for E . coli colonies transformed with recombinant pET-BccI. Plasmid preparations from cultures inoculated with transformed colonies were digested with BamHI and subjected to electrophoresis. A ) For BRP recombinants pET-BccI screening, the presence of a 283 bp DNA band indicated there was no recombination (A3, A7, A9), whereas the presence of a 636 bp insert DNA band showed a successful recombination (A2, A4, A5, A6, A8). B ) For CAT recombinants pET-BccI screening, again the presence of a 283 bp DNA band indicated there was no recombination (B2, B5, B6, B8), whereas the presence of a 924 bp insert DNA band showed a successful recombination (B3, B4, B7, B9).

    Techniques Used: Transformation Assay, Recombinant, Positron Emission Tomography, Plasmid Preparation, Electrophoresis

    The novel protein-expression vector pET-BccI. The pET-26b (+) derived plasmid has a pBR322 origin of replication, which together with the ROP protein regulates the plasmid copy number per bacterial cell. The kanamycin resistance gene enables positive selection of the transformed E . coli cells in the presence of kanamycin. BamHI, EcoRI and HindIII recognition sites, flanking both sites of the T7 promoter, cloning site and T7 terminator cassette, facilitate the screening of the transformed colonies for the recombinant transformants. The cloning site of pET-BccI, composed of two adjacent reverse BccI recognition sites, provides single 5΄-T and C overhangs after digestion with BccI, which are suitable for the ligation of DNA molecules with complementary edges.
    Figure Legend Snippet: The novel protein-expression vector pET-BccI. The pET-26b (+) derived plasmid has a pBR322 origin of replication, which together with the ROP protein regulates the plasmid copy number per bacterial cell. The kanamycin resistance gene enables positive selection of the transformed E . coli cells in the presence of kanamycin. BamHI, EcoRI and HindIII recognition sites, flanking both sites of the T7 promoter, cloning site and T7 terminator cassette, facilitate the screening of the transformed colonies for the recombinant transformants. The cloning site of pET-BccI, composed of two adjacent reverse BccI recognition sites, provides single 5΄-T and C overhangs after digestion with BccI, which are suitable for the ligation of DNA molecules with complementary edges.

    Techniques Used: Expressing, Plasmid Preparation, Positron Emission Tomography, Derivative Assay, Selection, Transformation Assay, Clone Assay, Recombinant, Ligation

    22) Product Images from "High-resolution Genetic and Physical Map of the Lgn1 Interval in C57BL/6J Implicates Naip2 or Naip5 in Legionella pneumophila Pathogenesis"

    Article Title: High-resolution Genetic and Physical Map of the Lgn1 Interval in C57BL/6J Implicates Naip2 or Naip5 in Legionella pneumophila Pathogenesis

    Journal: Genome Research

    doi:

    Southern blot analysis of BamHI- and EcoRI-digested BAC DNA identifies six copies of Naip exon 11 and five copies of Naip exon 3. Correlation of the restriction fragments with specific Naip loci was done by comparison of the bands on the BAC blot with predicted fragments from genomic sequence and our previous physical map of the 129 Naip ). Horizontal bars and numbers indicate position and size (kb) of fragments in 1-kb ladder molecular weight marker (GIBCO). ( A ) BamHI-digested DNA probed with Naip exon 11 identifies six Naip exon 11 loci. 129 haplotype genomic sequence predicts the observed 14.3-kb fragment mapping to Naip1 , a 9-kb fragment mapping to Naip2 , an 8.6-kb fragment mapping to Naip5 , and a doublet of 3.5 kb and 3.6 kb mapping to Naip6 and Naip3 . The remaining 2.2-kb band maps to Δ Naip , as observed in the 129 haplotype (data not shown). Asterisk indicates vector junction fragments mapping to Naip1 and Naip2. ( B ) EcoRI-digested DN A probed with Naip exon 3 identifies five Naip exon 3 loci. 129 haplotype genomic sequence predicts the observed 10.2-kb fragment mapping to Naip5 , an 8.5-kb fragment mapping to Naip2 , a 7.5-kb fragment mapping to Naip1 , a 7.2-kb fragment mapping to Naip6 , and 2.1-kb mapping to Naip3 .
    Figure Legend Snippet: Southern blot analysis of BamHI- and EcoRI-digested BAC DNA identifies six copies of Naip exon 11 and five copies of Naip exon 3. Correlation of the restriction fragments with specific Naip loci was done by comparison of the bands on the BAC blot with predicted fragments from genomic sequence and our previous physical map of the 129 Naip ). Horizontal bars and numbers indicate position and size (kb) of fragments in 1-kb ladder molecular weight marker (GIBCO). ( A ) BamHI-digested DNA probed with Naip exon 11 identifies six Naip exon 11 loci. 129 haplotype genomic sequence predicts the observed 14.3-kb fragment mapping to Naip1 , a 9-kb fragment mapping to Naip2 , an 8.6-kb fragment mapping to Naip5 , and a doublet of 3.5 kb and 3.6 kb mapping to Naip6 and Naip3 . The remaining 2.2-kb band maps to Δ Naip , as observed in the 129 haplotype (data not shown). Asterisk indicates vector junction fragments mapping to Naip1 and Naip2. ( B ) EcoRI-digested DN A probed with Naip exon 3 identifies five Naip exon 3 loci. 129 haplotype genomic sequence predicts the observed 10.2-kb fragment mapping to Naip5 , an 8.5-kb fragment mapping to Naip2 , a 7.5-kb fragment mapping to Naip1 , a 7.2-kb fragment mapping to Naip6 , and 2.1-kb mapping to Naip3 .

    Techniques Used: Southern Blot, BAC Assay, Sequencing, Molecular Weight, Marker, Plasmid Preparation

    23) Product Images from "High-resolution Genetic and Physical Map of the Lgn1 Interval in C57BL/6J Implicates Naip2 or Naip5 in Legionella pneumophila Pathogenesis"

    Article Title: High-resolution Genetic and Physical Map of the Lgn1 Interval in C57BL/6J Implicates Naip2 or Naip5 in Legionella pneumophila Pathogenesis

    Journal: Genome Research

    doi:

    Southern blot analysis of BamHI- and EcoRI-digested BAC DNA identifies six copies of Naip exon 11 and five copies of Naip exon 3. Correlation of the restriction fragments with specific Naip loci was done by comparison of the bands on the BAC blot with predicted fragments from genomic sequence and our previous physical map of the 129 Naip ). Horizontal bars and numbers indicate position and size (kb) of fragments in 1-kb ladder molecular weight marker (GIBCO). ( A ) BamHI-digested DNA probed with Naip exon 11 identifies six Naip exon 11 loci. 129 haplotype genomic sequence predicts the observed 14.3-kb fragment mapping to Naip1 , a 9-kb fragment mapping to Naip2 , an 8.6-kb fragment mapping to Naip5 , and a doublet of 3.5 kb and 3.6 kb mapping to Naip6 and Naip3 . The remaining 2.2-kb band maps to Δ Naip , as observed in the 129 haplotype (data not shown). Asterisk indicates vector junction fragments mapping to Naip1 and Naip2. ( B ) EcoRI-digested DN A probed with Naip exon 3 identifies five Naip exon 3 loci. 129 haplotype genomic sequence predicts the observed 10.2-kb fragment mapping to Naip5 , an 8.5-kb fragment mapping to Naip2 , a 7.5-kb fragment mapping to Naip1 , a 7.2-kb fragment mapping to Naip6 , and 2.1-kb mapping to Naip3 .
    Figure Legend Snippet: Southern blot analysis of BamHI- and EcoRI-digested BAC DNA identifies six copies of Naip exon 11 and five copies of Naip exon 3. Correlation of the restriction fragments with specific Naip loci was done by comparison of the bands on the BAC blot with predicted fragments from genomic sequence and our previous physical map of the 129 Naip ). Horizontal bars and numbers indicate position and size (kb) of fragments in 1-kb ladder molecular weight marker (GIBCO). ( A ) BamHI-digested DNA probed with Naip exon 11 identifies six Naip exon 11 loci. 129 haplotype genomic sequence predicts the observed 14.3-kb fragment mapping to Naip1 , a 9-kb fragment mapping to Naip2 , an 8.6-kb fragment mapping to Naip5 , and a doublet of 3.5 kb and 3.6 kb mapping to Naip6 and Naip3 . The remaining 2.2-kb band maps to Δ Naip , as observed in the 129 haplotype (data not shown). Asterisk indicates vector junction fragments mapping to Naip1 and Naip2. ( B ) EcoRI-digested DN A probed with Naip exon 3 identifies five Naip exon 3 loci. 129 haplotype genomic sequence predicts the observed 10.2-kb fragment mapping to Naip5 , an 8.5-kb fragment mapping to Naip2 , a 7.5-kb fragment mapping to Naip1 , a 7.2-kb fragment mapping to Naip6 , and 2.1-kb mapping to Naip3 .

    Techniques Used: Southern Blot, BAC Assay, Sequencing, Molecular Weight, Marker, Plasmid Preparation

    24) Product Images from "Phenotypic and Molecular Analysis of Tellurite Resistance among Enterohemorrhagic Escherichia coli O157:H7 and Sorbitol-Fermenting O157:NM Clinical Isolates"

    Article Title: Phenotypic and Molecular Analysis of Tellurite Resistance among Enterohemorrhagic Escherichia coli O157:H7 and Sorbitol-Fermenting O157:NM Clinical Isolates

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.43.1.452-454.2005

    Hybridization of BamHI-PstI-digested genomic DNA from EHEC O157 strains and controls with the terC probe. M, molecular weight marker (1-kb DNA ladder; Gibco-BRL). In lanes 1 to 7, the following strains are displayed (serotype, Te-MIC in micrograms per
    Figure Legend Snippet: Hybridization of BamHI-PstI-digested genomic DNA from EHEC O157 strains and controls with the terC probe. M, molecular weight marker (1-kb DNA ladder; Gibco-BRL). In lanes 1 to 7, the following strains are displayed (serotype, Te-MIC in micrograms per

    Techniques Used: Hybridization, Molecular Weight, Marker

    25) Product Images from "Enhanced antifungal activity of bovine lactoferrin-producing probiotic Lactobacillus casei in the murine model of vulvovaginal candidiasis"

    Article Title: Enhanced antifungal activity of bovine lactoferrin-producing probiotic Lactobacillus casei in the murine model of vulvovaginal candidiasis

    Journal: BMC Microbiology

    doi: 10.1186/s12866-018-1370-x

    Construction and expression of the secretion plasmid pPG612.1-BLF in L.casei . a The synthetic BLF gene fragment (2.1kp) was digested with restriction enzymes BamHI and XhoI, and ligated into the sticky end of the plasmid pPG612.1 which was also digested with the same restriction enzyme, resulting in the plasmid pPG612.1-BLF (5.6kp). b The plasmid pPG612.1-BLF was electroporated into L.casei using a BioRad GenePulser with single electric pulse (voltage, 1.5 kV; capacitance, 25 μF; and resistance, 400 Ω.). PCR amplification of the BamHI site and XhoI site of the plasmid pPG612.1-BLF which was extracted from the L.casei /pPG612.1-BLF strain resulted in 500 bp and 800 bp products, respectively. Lane 1, PCR product of XhoI site; Lane 2, PCR product of BamHI site. M, DNA maker. c BLF was detected in the supernatant and pellet of L.casei /pPG612.1-BLF culture by Western blotting, indicating the expression and secretion of BLF by L.casei /pPG612.1-BLF. Lane 1, supernatant of L.casei /pPG612.1-BLF culture; Lane 2, pellet of L.casei /pPG612.1-BLF culture; Lane 3, supernatant of L.casei /pPG612.1 culture; Lane 4, pellet of L.casei /pPG612.1 culture
    Figure Legend Snippet: Construction and expression of the secretion plasmid pPG612.1-BLF in L.casei . a The synthetic BLF gene fragment (2.1kp) was digested with restriction enzymes BamHI and XhoI, and ligated into the sticky end of the plasmid pPG612.1 which was also digested with the same restriction enzyme, resulting in the plasmid pPG612.1-BLF (5.6kp). b The plasmid pPG612.1-BLF was electroporated into L.casei using a BioRad GenePulser with single electric pulse (voltage, 1.5 kV; capacitance, 25 μF; and resistance, 400 Ω.). PCR amplification of the BamHI site and XhoI site of the plasmid pPG612.1-BLF which was extracted from the L.casei /pPG612.1-BLF strain resulted in 500 bp and 800 bp products, respectively. Lane 1, PCR product of XhoI site; Lane 2, PCR product of BamHI site. M, DNA maker. c BLF was detected in the supernatant and pellet of L.casei /pPG612.1-BLF culture by Western blotting, indicating the expression and secretion of BLF by L.casei /pPG612.1-BLF. Lane 1, supernatant of L.casei /pPG612.1-BLF culture; Lane 2, pellet of L.casei /pPG612.1-BLF culture; Lane 3, supernatant of L.casei /pPG612.1 culture; Lane 4, pellet of L.casei /pPG612.1 culture

    Techniques Used: Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Western Blot

    26) Product Images from "Comparative analysis of the end-joining activity of several DNA ligases"

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0190062

    Wild type DNA ligase λ DNA digest ligation assay. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1 ), NruI (G/C Blunt, 2 ), BstNI (5′ SBO, 3 ), Hpy188I (3′SBO, 4 ), NdeI (2 BO, 5 ) and BamHI (4 BO, 6 ), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in the presence of T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 6% polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and, hLig3 (D), respectively. E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.
    Figure Legend Snippet: Wild type DNA ligase λ DNA digest ligation assay. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1 ), NruI (G/C Blunt, 2 ), BstNI (5′ SBO, 3 ), Hpy188I (3′SBO, 4 ), NdeI (2 BO, 5 ) and BamHI (4 BO, 6 ), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in the presence of T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 6% polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and, hLig3 (D), respectively. E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Techniques Used: Ligation, Agarose Gel Electrophoresis, Staining

    Effect of DBDs on blunt/cohesive end λ DNA Re-ligation. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1), NruI (G/C Blunt, 2), BstNI (5′ SBO, 3), Hpy188I (3′SBO, 4), NdeI (2 BO, 5) and BamHI (4 BO, 6), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). (E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.
    Figure Legend Snippet: Effect of DBDs on blunt/cohesive end λ DNA Re-ligation. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1), NruI (G/C Blunt, 2), BstNI (5′ SBO, 3), Hpy188I (3′SBO, 4), NdeI (2 BO, 5) and BamHI (4 BO, 6), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). (E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Techniques Used: Ligation, Agarose Gel Electrophoresis, Staining

    27) Product Images from "Functional and Genome Sequence-Driven Characterization of tal Effector Gene Repertoires Reveals Novel Variants With Altered Specificities in Closely Related Malian Xanthomonas oryzae pv. oryzae Strains"

    Article Title: Functional and Genome Sequence-Driven Characterization of tal Effector Gene Repertoires Reveals Novel Variants With Altered Specificities in Closely Related Malian Xanthomonas oryzae pv. oryzae Strains

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.01657

    A Survey of tal gene diversity in a set of Malian Xoo strains. (A) Genomic patterns of tal content as determined by Southern blot. The genomic DNAs were digested with BamHI prior to electrophoresis on a 1% agarose gel. Following transfer, bands corresponding to tal sequences were detected with a probe encompassing part of the N-terminal coding region of TalF from MAI1. The names of tal genes corresponding to MAI1 fragments are indicated on the left. (B) Detection of talC in Malian Xoo genomes. A portion of the N-terminal region of tal coding sequences was amplified by PCR with primers flanking a segment that is specifically deleted in talC and separated on a 1.5% agarose gel. Detection of a shorter 152 bp product as compared to the predominant ∼224 bp product is indicative of the presence of talC . Purified plasmid DNA containing talF or talC and genomic DNA from strains KACC10331 (Korea) and PXO86 (Philippines) or BAI3 (Burkina Faso) were used, respectively, as negative or positive controls. The single gel image was broken down into three subpanels for assembling the figure. For each of them, the first lane was loaded with a 100 bp Marker and the numbers on the left indicate fragment size in bp. Strain names are indicated on top of the blot and gel images.
    Figure Legend Snippet: A Survey of tal gene diversity in a set of Malian Xoo strains. (A) Genomic patterns of tal content as determined by Southern blot. The genomic DNAs were digested with BamHI prior to electrophoresis on a 1% agarose gel. Following transfer, bands corresponding to tal sequences were detected with a probe encompassing part of the N-terminal coding region of TalF from MAI1. The names of tal genes corresponding to MAI1 fragments are indicated on the left. (B) Detection of talC in Malian Xoo genomes. A portion of the N-terminal region of tal coding sequences was amplified by PCR with primers flanking a segment that is specifically deleted in talC and separated on a 1.5% agarose gel. Detection of a shorter 152 bp product as compared to the predominant ∼224 bp product is indicative of the presence of talC . Purified plasmid DNA containing talF or talC and genomic DNA from strains KACC10331 (Korea) and PXO86 (Philippines) or BAI3 (Burkina Faso) were used, respectively, as negative or positive controls. The single gel image was broken down into three subpanels for assembling the figure. For each of them, the first lane was loaded with a 100 bp Marker and the numbers on the left indicate fragment size in bp. Strain names are indicated on top of the blot and gel images.

    Techniques Used: Southern Blot, Electrophoresis, Agarose Gel Electrophoresis, Amplification, Polymerase Chain Reaction, Purification, Plasmid Preparation, Marker

    28) Product Images from "Drug screening with human SMN2 reporter identifies SMN protein stabilizers to correct SMA pathology"

    Article Title: Drug screening with human SMN2 reporter identifies SMN protein stabilizers to correct SMA pathology

    Journal: Life Science Alliance

    doi: 10.26508/lsa.201800268

    Establishment of monoclonal SMN2-GFP reporter line in HEK293. (A) Representative images showing the monoclonal SMN2-GFP reporter line. Scale bar, 50 μm. (B) Southern blot showing expected GFP integration. All clones generate a 4,789-bp size DNA fragment comprising the GFP cassette after EcoRI and BamHI digestion. (C) Genomic DNA PCR analysis identifying correct GFP integration. (D) Western blot showing expression of SMNΔ7-GFP fusion proteins in all reporter lines generated. (E) Sequencing of the DNA sequences flanking the GFP cassette confirmed SMN2 gene rather than SMN1 gene integration. (F) GFP integration in SMN2 exon 8 showed normal splicing patterns as more than 90% SMN-Δ7 were spliced. (G) A small pool library screening identified 14 hits which brightened GFP fluorescence in the SMN2-GFP reporter line. Represented pictures before and after compound #8 (Z-FA-FMK) treatment are shown. Scale bar, 50 μm. (H) Quantification data showing that 14 hits significantly increased GFP intensity in the SMN2-GFP reporter cell line by more than 0.5-fold. Data were presented as mean ± SEM, n = 3. * P
    Figure Legend Snippet: Establishment of monoclonal SMN2-GFP reporter line in HEK293. (A) Representative images showing the monoclonal SMN2-GFP reporter line. Scale bar, 50 μm. (B) Southern blot showing expected GFP integration. All clones generate a 4,789-bp size DNA fragment comprising the GFP cassette after EcoRI and BamHI digestion. (C) Genomic DNA PCR analysis identifying correct GFP integration. (D) Western blot showing expression of SMNΔ7-GFP fusion proteins in all reporter lines generated. (E) Sequencing of the DNA sequences flanking the GFP cassette confirmed SMN2 gene rather than SMN1 gene integration. (F) GFP integration in SMN2 exon 8 showed normal splicing patterns as more than 90% SMN-Δ7 were spliced. (G) A small pool library screening identified 14 hits which brightened GFP fluorescence in the SMN2-GFP reporter line. Represented pictures before and after compound #8 (Z-FA-FMK) treatment are shown. Scale bar, 50 μm. (H) Quantification data showing that 14 hits significantly increased GFP intensity in the SMN2-GFP reporter cell line by more than 0.5-fold. Data were presented as mean ± SEM, n = 3. * P

    Techniques Used: Southern Blot, Clone Assay, Polymerase Chain Reaction, Western Blot, Expressing, Generated, Sequencing, Library Screening, Fluorescence

    29) Product Images from "Engineering of Bacteriophages Y2::dpoL1-C and Y2::luxAB for Efficient Control and Rapid Detection of the Fire Blight Pathogen, Erwinia amylovora"

    Article Title: Engineering of Bacteriophages Y2::dpoL1-C and Y2::luxAB for Efficient Control and Rapid Detection of the Fire Blight Pathogen, Erwinia amylovora

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00341-17

    Schematic representation of the construct generated by overlap PCR for cloning into pBluescript and subsequent homologous recombination with Y2 genomic DNA. Annealing regions of the primers are depicted by small black arrows, and the restriction sites of EcoRI and BamHI, as well as the RBS (thick vertical line), are indicated. The image is not drawn to scale.
    Figure Legend Snippet: Schematic representation of the construct generated by overlap PCR for cloning into pBluescript and subsequent homologous recombination with Y2 genomic DNA. Annealing regions of the primers are depicted by small black arrows, and the restriction sites of EcoRI and BamHI, as well as the RBS (thick vertical line), are indicated. The image is not drawn to scale.

    Techniques Used: Construct, Generated, Polymerase Chain Reaction, Clone Assay, Homologous Recombination

    30) Product Images from "The Effects of Apolipoprotein F Deficiency on High Density Lipoprotein Cholesterol Metabolism in Mice"

    Article Title: The Effects of Apolipoprotein F Deficiency on High Density Lipoprotein Cholesterol Metabolism in Mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0031616

    Generation of Apolipoprotein F Deficient Mice. A. Schematic diagram (not to scale) showing the wild type and deleted ApoF alleles. Features are depicted as follows: Exons- white arrows, Beta galactosidase reporter gene- “LacZ” black arrow, PGK promoter- grey arrow, Neomycin resistance gene- “Neo” black arrow, BamHI restriction sites- vertical lines, and the location of Southern Blotting probe- asterisk. B. Southern blot confirming successful targeting and genomic location of null allele: WT allele yields a 3.9 kb band, while the Null allele is 2.4 kb. The left panel contains ES cell DNA, while the right panel depicts livers from the mice. C. Real Time RT-PCR data on ApoF mRNA in the livers of female wild type (+/+), heterozygous (+/−), and homozygous (−/−) ApoF deficient mice.
    Figure Legend Snippet: Generation of Apolipoprotein F Deficient Mice. A. Schematic diagram (not to scale) showing the wild type and deleted ApoF alleles. Features are depicted as follows: Exons- white arrows, Beta galactosidase reporter gene- “LacZ” black arrow, PGK promoter- grey arrow, Neomycin resistance gene- “Neo” black arrow, BamHI restriction sites- vertical lines, and the location of Southern Blotting probe- asterisk. B. Southern blot confirming successful targeting and genomic location of null allele: WT allele yields a 3.9 kb band, while the Null allele is 2.4 kb. The left panel contains ES cell DNA, while the right panel depicts livers from the mice. C. Real Time RT-PCR data on ApoF mRNA in the livers of female wild type (+/+), heterozygous (+/−), and homozygous (−/−) ApoF deficient mice.

    Techniques Used: Mouse Assay, Southern Blot, Quantitative RT-PCR

    31) Product Images from "The P-SSP7 Cyanophage Has a Linear Genome with Direct Terminal Repeats"

    Article Title: The P-SSP7 Cyanophage Has a Linear Genome with Direct Terminal Repeats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0036710

    Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).
    Figure Legend Snippet: Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).

    Techniques Used: Clone Assay, Nucleic Acid Electrophoresis, Plasmid Preparation, Lambda DNA Preparation

    Schematic illustration of the arrangement of the P-SSP7 genome. (A) Sequencing of the ends of the P-SSP7 genome extracted directly from phage particles. Arrows, and numbers under the arrows, indicate the sequences acquired: Blue from the entire genome and green from end fragments produced by digestion of the genome with the BamHI and PmeI restriction enzymes. The positions of the primers used for sequencing are shown in black type at the beginning of the arrows. Genome numbering for the primers and sequences is that for the originally published sequence [5] . The purple line denotes the 728 bp region found to be upstream of ORF1 in this study, but positioned downstream of ORF54 in the originally published sequence. The repeat regions are shown in red at both ends of the genome. (B) Diagram showing the arrangement of the P-SSP7 genome as originally published (GenBank accession numbers: AY939843.1, [5] and GU071093 [16] . (C) Diagram of the revised genome arrangement based on the results from this study (updated GeneBank submission, accession number: AY939843.2).
    Figure Legend Snippet: Schematic illustration of the arrangement of the P-SSP7 genome. (A) Sequencing of the ends of the P-SSP7 genome extracted directly from phage particles. Arrows, and numbers under the arrows, indicate the sequences acquired: Blue from the entire genome and green from end fragments produced by digestion of the genome with the BamHI and PmeI restriction enzymes. The positions of the primers used for sequencing are shown in black type at the beginning of the arrows. Genome numbering for the primers and sequences is that for the originally published sequence [5] . The purple line denotes the 728 bp region found to be upstream of ORF1 in this study, but positioned downstream of ORF54 in the originally published sequence. The repeat regions are shown in red at both ends of the genome. (B) Diagram showing the arrangement of the P-SSP7 genome as originally published (GenBank accession numbers: AY939843.1, [5] and GU071093 [16] . (C) Diagram of the revised genome arrangement based on the results from this study (updated GeneBank submission, accession number: AY939843.2).

    Techniques Used: Sequencing, Produced

    Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).
    Figure Legend Snippet: Digestion and Southern analyses of the P-SSP7 genome. (A) Schematic genome map showing the positions of the restriction enzyme cleavage sites (red) and the expected fragment sizes after digestion with BamHI alone (top) and both BamHI and PmeI (bottom) based on the revised genome arrangement shown in Fig. 1C. (B) Restriction digestion of the P-SSP7 genome extracted from phage particles (lanes 3 and 4) and the genome cloned into a fosmid (lanes 5 and 6), with BamHI alone (lanes 3 and 5) or with BamHI and PmeI (lanes 4 and 6), separated by pulse field gel electrophoresis. Note that the only difference for digestion of the cloned genome is the presence of an additional fragment corresponding to the size of the fosmid vector. Fragments corresponding to the expected sizes shown in (A) are marked with the appropriate letter designations (a to f). Fragment size markers (M): 1 kb DNA ladder (lane 1) and Lambda DNA cut with HindIII (lane 2), are shown. (C) Southern analyses of the restriction digested DNA in (B) using 4 probes (denoted above the lanes) show that the repeat region appears twice on the genome on the same fragments as the first and last ORFs. The positions of the gene probes on the genome are shown as light blue boxes and the repeat region probe as green boxes in the top panel of (A). Lane numbering and fragment designations are the same as in (B).

    Techniques Used: Clone Assay, Nucleic Acid Electrophoresis, Plasmid Preparation, Lambda DNA Preparation

    32) Product Images from "Assessing the Amount of Quadruplex Structures Present within G2-Tract Synthetic Random-Sequence DNA Libraries"

    Article Title: Assessing the Amount of Quadruplex Structures Present within G2-Tract Synthetic Random-Sequence DNA Libraries

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0064131

    Regeneration of G 2 N 5 population from PCR products. (A) Sequence of the PCR product. PstI and BamHI restriction sites are shown in boxes. Restriction enzyme cleavage sites are represented by arrows. (B) Digestion of amplified DGR36 sequence with BamHI and PstI individually (lanes 2 and 3) and in combination (lane 4). Coloured arrows indicate fragments comprised of sequences of the same colour in Panel A. Fragments consisting of only the first fifteen nucleotides of the 5′ regions of the PCR products in the single enzyme digestion experiments cannot be seen as only polymerized segments acquire 32 P during amplification.
    Figure Legend Snippet: Regeneration of G 2 N 5 population from PCR products. (A) Sequence of the PCR product. PstI and BamHI restriction sites are shown in boxes. Restriction enzyme cleavage sites are represented by arrows. (B) Digestion of amplified DGR36 sequence with BamHI and PstI individually (lanes 2 and 3) and in combination (lane 4). Coloured arrows indicate fragments comprised of sequences of the same colour in Panel A. Fragments consisting of only the first fifteen nucleotides of the 5′ regions of the PCR products in the single enzyme digestion experiments cannot be seen as only polymerized segments acquire 32 P during amplification.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Amplification

    33) Product Images from "Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1"

    Article Title: Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0074159

    Targeting human PPP1R26P1 into mouse Rb1 intron 2. A) Top: structure of the human PPP1R26 gene on chromosome 9, consisting of four exons; non-coding sequences are indicated by lower box height. Four small CpG islands are represented by black lines below exon 4. Middle: mRNA structure of PPP1R26 . Below: scheme of exons 1 to 3 (black vertical boxes) of the human RB1 locus on chromosome 13. Integration of PPP1R26P1 in intron 2 of RB1 occurred in inverted orientation and skipping part of exon 1 of the PPP1R26 mRNA. The pseudogene has two larger CpG islands, CpG42 and CpG85, their methylation status is indicated by circles: filled – methylated, open – not methylated. Expression of RB1 is skewed in favor of the maternal allele indicated by a thicker arrow. The new exon 2B is shown as white box in PPP1R26P1 , it splices onto exon 3 of RB1 . The light gray boxes in intron 2 indicate ECRs A and B. B) Generation of modified ES cells. The order of targeting experiments is shown, indicating the number and designations of clones analyzed. Above the arrows the type of experiment is given: SNV or PPP1R26P1 construct: introduction of targeting vectors; PFGE: analysis of phasing of the two targeting events; Cre: removal of selection cassette by Cre expression. C) The targeting strategy in murine ES cells. Top: wild type mouse Rb1 locus on chromosome 14 is shown from exon 1 to 5 (black boxes), also showing the positions of ECRs A and B (grey boxes). Below: constructs used to introduce the SNV (indicated by P for the newly generated PstI restriction site) into exon 3 of Rb1 (SNV targeting vector) and to introduce human PPP1R26P1 (gray dotted box, positions of CpG42 and CpG85 shown as black lines) into intron 2 of Rb1 ( PPP1R26P1 targeting vector). The homology region of the latter was amplified by PCR, primers are indicated as black arrows. Both contracts contained a neomycin selection cassette (striped box) flanked by either loxP (white triangles) or loxP511 (black triangles) sites, respectively. Restriction enzymes: B: BamHI, E: EcoRI, H: HindIII, Hc: HincII, P: PstI, Sw: SwaI, X: XcmI. Southern blot probes are indicated in the top scheme as black lines and labeled. The two possible genomic combinations of targeted alleles are depicted in the lower panel: genotype SNV_ PPP1R26P1 /wt, having both targeting events and the same allele or genotype SNV / PPP1R26P1 with the two targeting events on different alleles. D) Southern blot analysis of targeted clones carrying the SNV in exon 3 of Rb1 . Probe SNP 5’ ext hybridized to HincII-digested genomic DNA shows an 8 kb fragment for the targeted allele in Rb1 _SNVneo and a 12 kb band for the targeted allele after selection cassette removal in Rb1 _SNV clones. E) Southern blot analysis for targeting of PPP1R26P1 into intron 2 of Rb1 . Probe KIAA 5’ ext hybridized to HincII-digested genomic DNA identifies a 4 kb fragment for the targeted allele in the SNV_ PPP1R26P1 neo clone and a 10kb fragment in SNV_ PPP1R26P1 clones after removal of the selection cassette. F) Southern blot analysis of PFGE to determine phasing of the two targeting events. Probe KIAA 5’ ext was hybridised to EcoRV-digested DNA to identify either a 23 kb and a 27 kb band in clones having genotype SNV_ PPP1R26P1 neo/wt (both events on one allele) or a 20kb and a 30kb fragment in clones with genotype SNV / PPP1R26P1 neo with the two events occurred on different alleles.
    Figure Legend Snippet: Targeting human PPP1R26P1 into mouse Rb1 intron 2. A) Top: structure of the human PPP1R26 gene on chromosome 9, consisting of four exons; non-coding sequences are indicated by lower box height. Four small CpG islands are represented by black lines below exon 4. Middle: mRNA structure of PPP1R26 . Below: scheme of exons 1 to 3 (black vertical boxes) of the human RB1 locus on chromosome 13. Integration of PPP1R26P1 in intron 2 of RB1 occurred in inverted orientation and skipping part of exon 1 of the PPP1R26 mRNA. The pseudogene has two larger CpG islands, CpG42 and CpG85, their methylation status is indicated by circles: filled – methylated, open – not methylated. Expression of RB1 is skewed in favor of the maternal allele indicated by a thicker arrow. The new exon 2B is shown as white box in PPP1R26P1 , it splices onto exon 3 of RB1 . The light gray boxes in intron 2 indicate ECRs A and B. B) Generation of modified ES cells. The order of targeting experiments is shown, indicating the number and designations of clones analyzed. Above the arrows the type of experiment is given: SNV or PPP1R26P1 construct: introduction of targeting vectors; PFGE: analysis of phasing of the two targeting events; Cre: removal of selection cassette by Cre expression. C) The targeting strategy in murine ES cells. Top: wild type mouse Rb1 locus on chromosome 14 is shown from exon 1 to 5 (black boxes), also showing the positions of ECRs A and B (grey boxes). Below: constructs used to introduce the SNV (indicated by P for the newly generated PstI restriction site) into exon 3 of Rb1 (SNV targeting vector) and to introduce human PPP1R26P1 (gray dotted box, positions of CpG42 and CpG85 shown as black lines) into intron 2 of Rb1 ( PPP1R26P1 targeting vector). The homology region of the latter was amplified by PCR, primers are indicated as black arrows. Both contracts contained a neomycin selection cassette (striped box) flanked by either loxP (white triangles) or loxP511 (black triangles) sites, respectively. Restriction enzymes: B: BamHI, E: EcoRI, H: HindIII, Hc: HincII, P: PstI, Sw: SwaI, X: XcmI. Southern blot probes are indicated in the top scheme as black lines and labeled. The two possible genomic combinations of targeted alleles are depicted in the lower panel: genotype SNV_ PPP1R26P1 /wt, having both targeting events and the same allele or genotype SNV / PPP1R26P1 with the two targeting events on different alleles. D) Southern blot analysis of targeted clones carrying the SNV in exon 3 of Rb1 . Probe SNP 5’ ext hybridized to HincII-digested genomic DNA shows an 8 kb fragment for the targeted allele in Rb1 _SNVneo and a 12 kb band for the targeted allele after selection cassette removal in Rb1 _SNV clones. E) Southern blot analysis for targeting of PPP1R26P1 into intron 2 of Rb1 . Probe KIAA 5’ ext hybridized to HincII-digested genomic DNA identifies a 4 kb fragment for the targeted allele in the SNV_ PPP1R26P1 neo clone and a 10kb fragment in SNV_ PPP1R26P1 clones after removal of the selection cassette. F) Southern blot analysis of PFGE to determine phasing of the two targeting events. Probe KIAA 5’ ext was hybridised to EcoRV-digested DNA to identify either a 23 kb and a 27 kb band in clones having genotype SNV_ PPP1R26P1 neo/wt (both events on one allele) or a 20kb and a 30kb fragment in clones with genotype SNV / PPP1R26P1 neo with the two events occurred on different alleles.

    Techniques Used: Methylation, Expressing, Modification, Clone Assay, Construct, Selection, Introduce, Generated, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Southern Blot, Labeling

    34) Product Images from "Simple and Cost-Effective Restriction Endonuclease Analysis of Human Adenoviruses"

    Article Title: Simple and Cost-Effective Restriction Endonuclease Analysis of Human Adenoviruses

    Journal: BioMed Research International

    doi: 10.1155/2014/363790

    Picture of the REA. (a) REA pattern for BamHI and SmaI (fast digest). (b) REA pattern for BglII and HindIII . M shows Lambda DNA-HindIII digest marker. Numbers 1, 3, 4, and 37 show HAdV-1, -3, -4, and -37, respectively.
    Figure Legend Snippet: Picture of the REA. (a) REA pattern for BamHI and SmaI (fast digest). (b) REA pattern for BglII and HindIII . M shows Lambda DNA-HindIII digest marker. Numbers 1, 3, 4, and 37 show HAdV-1, -3, -4, and -37, respectively.

    Techniques Used: Lambda DNA Preparation, Marker

    35) Product Images from "Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains"

    Article Title: Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004829

    BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).
    Figure Legend Snippet: BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).

    Techniques Used: Polymerase Chain Reaction

    36) Product Images from "Development of a Tet-On inducible expression system for the anhydrobiotic cell line, Pv11"

    Article Title: Development of a Tet-On inducible expression system for the anhydrobiotic cell line, Pv11

    Journal: bioRxiv

    doi: 10.1101/2020.05.29.123570

    Map of pPv121-MCS vector. The multiple cloning site of the vector comprises BamHI, HindIII, XhoI and SacII sites.
    Figure Legend Snippet: Map of pPv121-MCS vector. The multiple cloning site of the vector comprises BamHI, HindIII, XhoI and SacII sites.

    Techniques Used: Plasmid Preparation, Clone Assay

    37) Product Images from "SETD2-dependent H3K36me3 plays a critical role in epigenetic regulation of the HPV31 life cycle"

    Article Title: SETD2-dependent H3K36me3 plays a critical role in epigenetic regulation of the HPV31 life cycle

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1007367

    SETD2 is necessary for productive viral replication. (A) CIN612 cells were transiently transduced with either a scramble control shRNA (shScram) or one of two SETD2 shRNAs (shSetd2#1 and shSetd2#2) for 72hrs. At this time, DNA and protein were either harvested as an undifferentiated (T0) sample, or cells were grown in high calcium medium to induce differentiation (72hr). DNA was digested with BamHI, which does not cut the viral genome, and Southern blot analysis was performed using the HPV31 genome as a probe. Lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate the decrease in SETD2 and H3K36me3 upon shRNA-mediated knockdown. Involucrin and K10 were used as markers of differentiation, and p84 and histone H3.1 (H3.1) served as loading controls. (B) CIN612 cells were transduced with lentivirus expressing either control guide RNAs (sgCTR) or guide RNAs targeting SETD2 (sgSETD2 #1 and sgSETD2 #2) and selected with puromycin. Following selection, DNA and protein were harvested from the heterogenous population of cells. DNA was digested with BamHI (non-cutter) and Southern blot analysis performed using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of SETD2, involucrin and K10 as differentiation controls, with GAPDH as a loading control. (A, B) Fold change in episome copy number for SETD2 knockdown using shRNAs as well as guide RNAs was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Shown is the fold change relative to shScram T0 (A) and sgCTR T0 (B), which are set to one. Error bars represent means +/- standard error. Statistics were assayed using a student’s t test. *p≤ .05. WB = western blot. Ca = calcium.
    Figure Legend Snippet: SETD2 is necessary for productive viral replication. (A) CIN612 cells were transiently transduced with either a scramble control shRNA (shScram) or one of two SETD2 shRNAs (shSetd2#1 and shSetd2#2) for 72hrs. At this time, DNA and protein were either harvested as an undifferentiated (T0) sample, or cells were grown in high calcium medium to induce differentiation (72hr). DNA was digested with BamHI, which does not cut the viral genome, and Southern blot analysis was performed using the HPV31 genome as a probe. Lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate the decrease in SETD2 and H3K36me3 upon shRNA-mediated knockdown. Involucrin and K10 were used as markers of differentiation, and p84 and histone H3.1 (H3.1) served as loading controls. (B) CIN612 cells were transduced with lentivirus expressing either control guide RNAs (sgCTR) or guide RNAs targeting SETD2 (sgSETD2 #1 and sgSETD2 #2) and selected with puromycin. Following selection, DNA and protein were harvested from the heterogenous population of cells. DNA was digested with BamHI (non-cutter) and Southern blot analysis performed using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of SETD2, involucrin and K10 as differentiation controls, with GAPDH as a loading control. (A, B) Fold change in episome copy number for SETD2 knockdown using shRNAs as well as guide RNAs was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Shown is the fold change relative to shScram T0 (A) and sgCTR T0 (B), which are set to one. Error bars represent means +/- standard error. Statistics were assayed using a student’s t test. *p≤ .05. WB = western blot. Ca = calcium.

    Techniques Used: Transduction, shRNA, Southern Blot, Expressing, Selection, Western Blot, Software

    H3K36me3 is required for productive viral replication. (A) CIN612 cells were left untreated (UT) or transduced with lentivirus expressing either wild-type (WT) H3.3 or the H3.3K36M mutant. 72hr post-transduction, cells were harvested as a T0 (undifferentiated) or differentiated in high calcium medium for 72hr. (B) CIN612 cells were transduced with either pLenti-control (CTR) or pLenti-FLAG-KDM4A. Following selection in puromycin, cells were harvested as a T0 (undifferentiated) or were induced in high calcium for 72hr. For (A) and (B) DNA and protein were harvested at the indicated time points. DNA was digested with BamHI (non-cutter) and Southern blotting analysis was performed to analyze episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of H3K36me3, with H3.1 serving as a loading control. Involucrin and K10 were used as markers of differentiation and GAPDH as loading control. For (B) western blot analysis was performed using an antibody to FLAG to detect KDM4A. For (A) and (B), fold change in episome copy number was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to (A) UT T0 and (B) pLenti-CTR, which are set to one. Error bars represent means ± standard errors. Statistics were assayed using a student’s t test. * p
    Figure Legend Snippet: H3K36me3 is required for productive viral replication. (A) CIN612 cells were left untreated (UT) or transduced with lentivirus expressing either wild-type (WT) H3.3 or the H3.3K36M mutant. 72hr post-transduction, cells were harvested as a T0 (undifferentiated) or differentiated in high calcium medium for 72hr. (B) CIN612 cells were transduced with either pLenti-control (CTR) or pLenti-FLAG-KDM4A. Following selection in puromycin, cells were harvested as a T0 (undifferentiated) or were induced in high calcium for 72hr. For (A) and (B) DNA and protein were harvested at the indicated time points. DNA was digested with BamHI (non-cutter) and Southern blotting analysis was performed to analyze episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the levels of H3K36me3, with H3.1 serving as a loading control. Involucrin and K10 were used as markers of differentiation and GAPDH as loading control. For (B) western blot analysis was performed using an antibody to FLAG to detect KDM4A. For (A) and (B), fold change in episome copy number was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to (A) UT T0 and (B) pLenti-CTR, which are set to one. Error bars represent means ± standard errors. Statistics were assayed using a student’s t test. * p

    Techniques Used: Transduction, Expressing, Mutagenesis, Selection, Southern Blot, Western Blot, Software

    38) Product Images from "PhaQ, a New Class of Poly-?-Hydroxybutyrate (PHB)-Responsive Repressor, Regulates phaQ and phaP (Phasin) Expression in Bacillus megaterium through Interaction with PHB"

    Article Title: PhaQ, a New Class of Poly-?-Hydroxybutyrate (PHB)-Responsive Repressor, Regulates phaQ and phaP (Phasin) Expression in Bacillus megaterium through Interaction with PHB

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.10.3015-3021.2004

    DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.
    Figure Legend Snippet: DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.

    Techniques Used: Footprinting, Binding Assay, Labeling, Incubation

    DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.
    Figure Legend Snippet: DNase I footprinting analysis of PhaQ binding to the phaQ promoter region. (A) A 0.4-kb SmaI-HindIII DNA fragment containing the phaQ promoter region (positions −356 to +39) and labeled with 32 P at its HindIII site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. (B) A 0.36-kb BamHI-EcoRI DNA fragment containing the phaQ promoter region (positions −105 to + 249) and labeled with 32 P at its BamHI site was incubated in the absence or presence of the PhaQ protein. Lanes 1 and 6, no PhaQ protein; lanes 2 to 5 contained 1.5, 3, 6, and 12 ng of the PhaQ protein, respectively. The numbers on the left indicate the positions of bases relative to the transcriptional initiation site of phaQ . Solid brackets on the right denote the protected regions.

    Techniques Used: Footprinting, Binding Assay, Labeling, Incubation

    39) Product Images from "Homologous Recombination Repair Factors Rad51 and BRCA1 Are Necessary for Productive Replication of Human Papillomavirus 31"

    Article Title: Homologous Recombination Repair Factors Rad51 and BRCA1 Are Necessary for Productive Replication of Human Papillomavirus 31

    Journal: Journal of Virology

    doi: 10.1128/JVI.02495-15

    Knockdown of Rad51 and BRCA1 decreases HPV31 genome amplification upon differentiation. (A) HPV31-positive CIN612 cells were transduced with lentivirus containing control scramble shRNA sequences (scScram) or two shRNA sequences for Rad51 (shRad51) or BRCA1 (shBRCA1) to analyze efficiency of knockdown. Western blot analysis was performed using antibodies to Rad51 and BRCA1. GAPDH served as a loading control. (B) CIN612 cells were transduced with shScram, shRad51 #1, or shBRCA1 #1 and grown as a monolayer for 96 h. DNA was harvested at the indicated times, digested with BamHI (noncutter) or HindIII (which linearizes the viral genome), and examined by Southern blotting for changes in viral episome levels using the HPV31 genome as a probe. (C and D) CIN612 cells were left untreated (UT) or transiently transduced with lentivirus particles containing a control shRNA (shScram), Rad51 shRNA #1, or BRCA1 shRNA #1 for 48 h. At this time, either DNA and protein were harvested as a T 0 (undifferentiated) sample or cells were suspended in methylcellulose to induce differentiation for 24 and 48 h. DNA harvested at each time point was analyzed by Southern blotting using the HPV31 genome as a probe. Whole-cell lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate cellular differentiation (involucrin) and reduced Rad51 or BRCA1 protein in shRNA-transduced cells. GAPDH was used as a loading control. Fold change in episome copy number was determined by performing densitometry of episomal bands from four independent experiments using ImageJ software. Shown is the fold change relative to T 0 shScram, which is set to 1. Error bars represent means ± standard errors. *, P ≤ 0.05. WB, Western blot.
    Figure Legend Snippet: Knockdown of Rad51 and BRCA1 decreases HPV31 genome amplification upon differentiation. (A) HPV31-positive CIN612 cells were transduced with lentivirus containing control scramble shRNA sequences (scScram) or two shRNA sequences for Rad51 (shRad51) or BRCA1 (shBRCA1) to analyze efficiency of knockdown. Western blot analysis was performed using antibodies to Rad51 and BRCA1. GAPDH served as a loading control. (B) CIN612 cells were transduced with shScram, shRad51 #1, or shBRCA1 #1 and grown as a monolayer for 96 h. DNA was harvested at the indicated times, digested with BamHI (noncutter) or HindIII (which linearizes the viral genome), and examined by Southern blotting for changes in viral episome levels using the HPV31 genome as a probe. (C and D) CIN612 cells were left untreated (UT) or transiently transduced with lentivirus particles containing a control shRNA (shScram), Rad51 shRNA #1, or BRCA1 shRNA #1 for 48 h. At this time, either DNA and protein were harvested as a T 0 (undifferentiated) sample or cells were suspended in methylcellulose to induce differentiation for 24 and 48 h. DNA harvested at each time point was analyzed by Southern blotting using the HPV31 genome as a probe. Whole-cell lysates harvested at the indicated time points were analyzed by immunoblotting to demonstrate cellular differentiation (involucrin) and reduced Rad51 or BRCA1 protein in shRNA-transduced cells. GAPDH was used as a loading control. Fold change in episome copy number was determined by performing densitometry of episomal bands from four independent experiments using ImageJ software. Shown is the fold change relative to T 0 shScram, which is set to 1. Error bars represent means ± standard errors. *, P ≤ 0.05. WB, Western blot.

    Techniques Used: Amplification, Transduction, shRNA, Western Blot, Southern Blot, Cell Differentiation, Software

    Productive replication is abrogated in HFK-31 cells treated with an inhibitor of Rad51 activity, which reduces HR activity. (A) DNA was harvested from HFK-31 cells at T 0 as well as after differentiation in high-calcium medium for 72 h in the presence of DMSO (DM) or increasing concentrations of the Rad51 inhibitor B02. DMSO was added at a volume equal to that of the 30 μM concentration of B02. DNA was digested with BamHI (noncutter) or HindIII to linearize the viral genome and then analyzed by Southern blotting to examine episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the effect of B02 treatment on Rad51 levels and differentiation (involucrin). (B) Fold change in episome copy number in response to B02 treatment was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to DMSO (DM)–72-h Ca, which is set to 1. Error bars represent means ± standard errors. Statistics were assayed using a two-tailed t test. *, P
    Figure Legend Snippet: Productive replication is abrogated in HFK-31 cells treated with an inhibitor of Rad51 activity, which reduces HR activity. (A) DNA was harvested from HFK-31 cells at T 0 as well as after differentiation in high-calcium medium for 72 h in the presence of DMSO (DM) or increasing concentrations of the Rad51 inhibitor B02. DMSO was added at a volume equal to that of the 30 μM concentration of B02. DNA was digested with BamHI (noncutter) or HindIII to linearize the viral genome and then analyzed by Southern blotting to examine episome copy number using the HPV31 genome as a probe. Western blot analysis was performed to examine the effect of B02 treatment on Rad51 levels and differentiation (involucrin). (B) Fold change in episome copy number in response to B02 treatment was determined by performing densitometry of episomal bands from three independent experiments using ImageJ software. Graphed is the average fold change relative to DMSO (DM)–72-h Ca, which is set to 1. Error bars represent means ± standard errors. Statistics were assayed using a two-tailed t test. *, P

    Techniques Used: Activity Assay, Concentration Assay, Southern Blot, Western Blot, Software, Two Tailed Test

    40) Product Images from "Novel Function of the Fanconi Anemia Group J or RECQ1 Helicase to Disrupt Protein-DNA Complexes in a Replication Protein A-stimulated Manner *"

    Article Title: Novel Function of the Fanconi Anemia Group J or RECQ1 Helicase to Disrupt Protein-DNA Complexes in a Replication Protein A-stimulated Manner *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.542456

    Amino acid substitutions that inactivate DNA binding by RPA negatively affect its ability to stimulate FANCJ disruption of BamHI-E111A protein-DNA substrate interaction. A ). B , reaction mixtures containing BamHI-E111A-bound forked duplex DNA substrate, FANCJ, and either wild-type RPA ( RPA ) or mutant Aro1-RPA were incubated and analyzed as described under “Experimental Procedures.” Representative gel image showing proteinase K-digested products from at least three independent experiments is shown. Star denotes 5′- 32 P end label.
    Figure Legend Snippet: Amino acid substitutions that inactivate DNA binding by RPA negatively affect its ability to stimulate FANCJ disruption of BamHI-E111A protein-DNA substrate interaction. A ). B , reaction mixtures containing BamHI-E111A-bound forked duplex DNA substrate, FANCJ, and either wild-type RPA ( RPA ) or mutant Aro1-RPA were incubated and analyzed as described under “Experimental Procedures.” Representative gel image showing proteinase K-digested products from at least three independent experiments is shown. Star denotes 5′- 32 P end label.

    Techniques Used: Binding Assay, Recombinase Polymerase Amplification, Mutagenesis, Incubation

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Chlamydomonas reinhardtii hydin is a central pair protein required for flagellar motility
    Article Snippet: .. The PCR product was digested with HindIII and BamHI and ligated into pMAL-cR1 v. 2 digested with the same enzymes (New England Biolabs, Inc.). .. The construct was transformed into E. coli XL1 blue, and, for expression of the maltose-binding∷hydin fusion protein, into BL21.

    Clone Assay:

    Article Title: The development and application of new crystallization method for tobacco mosaic virus coat protein
    Article Snippet: .. Both plasmid PGEX-6P-1 (Novagen) and CP were digested with BamH I (NEB, 10 units/μL)/Xho I (NEB, 10 units/μL) and cloned into the same sites in PGEX-6P-1 (PGEX-6P-1-WT-GST-TMV-CP32 ). ..

    other:

    Article Title: Probing hyper-negatively supercoiled mini-circles with nucleases and DNA binding proteins
    Article Snippet: Escherichia coli topoisomerase I ( Ec TopoI), T4 polynucleotide kinase (PNK), calf intestinal phosphatase, T4 DNA ligase, DNAse I, BamHI, BglII and HindIII were from New England Biolabs.

    Plasmid Preparation:

    Article Title: The development and application of new crystallization method for tobacco mosaic virus coat protein
    Article Snippet: .. Both plasmid PGEX-6P-1 (Novagen) and CP were digested with BamH I (NEB, 10 units/μL)/Xho I (NEB, 10 units/μL) and cloned into the same sites in PGEX-6P-1 (PGEX-6P-1-WT-GST-TMV-CP32 ). ..

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: .. Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. The specific sequences recognized by the restriction enzymes and DNA termini generated are shown in .

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae
    Article Snippet: .. The ura3 -deficient S. cerevisiae strain BJ5465 ( α ura3–52 trp1 leu2Δ1 his3Δ200 pep4::HIS2 prb1Δ1.6R can1 GAL1 ) was obtained from LGCPromochem, the NucleoSpin Plasmid kit was purchased from Macherey-Nagel, and the restriction enzymes BamHI, NheI, SpeI, SacI, and NotI from New England Biolabs. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    New England Biolabs bamhi scai
    Knockout of pfhsp70x does not affect intraerythrocytic growth. (A) Schematic representation showing interruption of the PfHsp70x ORF with the hDHFR cassette. The Cas9-mediated double-stranded break in the pfhsp70x ORF is repaired using homology regions on the template plasmid while inserting an hDHFR cassette into the locus. (B) Southern blot analysis confirming knockout of PfHsp70x. Genomic DNA from independent knockout clones (A3, A7, B3, and B9) was isolated and digested with <t>BamHI</t> and <t>ScaI.</t> The membrane was hybridized with a biotin-labeled probe complementary to the first 800 bp of the pfhsp70x ORF. (C) Western blot analysis demonstrating loss of PfHsp70x protein expression in independent knockout clones. Schizont-stage parasites were purified on a Percoll gradient, and whole-cell lysate was used for analysis. The membrane was probed with antibody raised against PfHsp70x and antibody against plasmepsin V as a loading control. (D) Parental lines and independent PfHsp70x-KO clones (A7 and B3) were seeded at equal parasitemia in triplicate. Parasitemia was measured every 24 h using flow cytometry. Data are fit to an exponential growth equation and are represented as means ± SEM ( n = 3).
    Bamhi Scai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi scai/product/New England Biolabs
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi scai - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    88
    New England Biolabs bamhi fragments
    Functional analysis of the a locus genes of S. reilianum . (A) The S. reilianum strain SRZ2 ( a2b2 ) was transformed with the self-replicating plasmid <t>pNEBUC</t> or with a pNEBUC derivative, pSr-a1, containing the relevant mfa1.2 gene as a 4-kb <t>BamHI</t> fragment
    Bamhi Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 100 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi fragments/product/New England Biolabs
    Average 88 stars, based on 100 article reviews
    Price from $9.99 to $1999.99
    bamhi fragments - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    Knockout of pfhsp70x does not affect intraerythrocytic growth. (A) Schematic representation showing interruption of the PfHsp70x ORF with the hDHFR cassette. The Cas9-mediated double-stranded break in the pfhsp70x ORF is repaired using homology regions on the template plasmid while inserting an hDHFR cassette into the locus. (B) Southern blot analysis confirming knockout of PfHsp70x. Genomic DNA from independent knockout clones (A3, A7, B3, and B9) was isolated and digested with BamHI and ScaI. The membrane was hybridized with a biotin-labeled probe complementary to the first 800 bp of the pfhsp70x ORF. (C) Western blot analysis demonstrating loss of PfHsp70x protein expression in independent knockout clones. Schizont-stage parasites were purified on a Percoll gradient, and whole-cell lysate was used for analysis. The membrane was probed with antibody raised against PfHsp70x and antibody against plasmepsin V as a loading control. (D) Parental lines and independent PfHsp70x-KO clones (A7 and B3) were seeded at equal parasitemia in triplicate. Parasitemia was measured every 24 h using flow cytometry. Data are fit to an exponential growth equation and are represented as means ± SEM ( n = 3).

    Journal: mSphere

    Article Title: The Exported Chaperone PfHsp70x Is Dispensable for the Plasmodium falciparum Intraerythrocytic Life Cycle

    doi: 10.1128/mSphere.00363-17

    Figure Lengend Snippet: Knockout of pfhsp70x does not affect intraerythrocytic growth. (A) Schematic representation showing interruption of the PfHsp70x ORF with the hDHFR cassette. The Cas9-mediated double-stranded break in the pfhsp70x ORF is repaired using homology regions on the template plasmid while inserting an hDHFR cassette into the locus. (B) Southern blot analysis confirming knockout of PfHsp70x. Genomic DNA from independent knockout clones (A3, A7, B3, and B9) was isolated and digested with BamHI and ScaI. The membrane was hybridized with a biotin-labeled probe complementary to the first 800 bp of the pfhsp70x ORF. (C) Western blot analysis demonstrating loss of PfHsp70x protein expression in independent knockout clones. Schizont-stage parasites were purified on a Percoll gradient, and whole-cell lysate was used for analysis. The membrane was probed with antibody raised against PfHsp70x and antibody against plasmepsin V as a loading control. (D) Parental lines and independent PfHsp70x-KO clones (A7 and B3) were seeded at equal parasitemia in triplicate. Parasitemia was measured every 24 h using flow cytometry. Data are fit to an exponential growth equation and are represented as means ± SEM ( n = 3).

    Article Snippet: Ten micrograms of DNA was digested overnight with NcoI/XmnI for PfHsp70x-DDD and BamHI/ScaI for PfHsp70x-KO (New England Biolabs).

    Techniques: Knock-Out, Plasmid Preparation, Southern Blot, Clone Assay, Isolation, Labeling, Western Blot, Expressing, Purification, Flow Cytometry, Cytometry

    Functional analysis of the a locus genes of S. reilianum . (A) The S. reilianum strain SRZ2 ( a2b2 ) was transformed with the self-replicating plasmid pNEBUC or with a pNEBUC derivative, pSr-a1, containing the relevant mfa1.2 gene as a 4-kb BamHI fragment

    Journal:

    Article Title: Mating Type Loci of Sporisorium reilianum: Novel Pattern with Three a and Multiple b Specificities

    doi: 10.1128/EC.4.8.1317-1327.2005

    Figure Lengend Snippet: Functional analysis of the a locus genes of S. reilianum . (A) The S. reilianum strain SRZ2 ( a2b2 ) was transformed with the self-replicating plasmid pNEBUC or with a pNEBUC derivative, pSr-a1, containing the relevant mfa1.2 gene as a 4-kb BamHI fragment

    Article Snippet: Plasmids pCR2.1-TOPO, pCR4-TOPO, and pCR4Blunt-TOPO (Invitrogen) served for cloning and sequencing of fragments generated by PCR. pCR4BamHI is a derivative of pCR4-TOPO, containing a linker that introduces two BamHI sites, and was used for cloning and sequencing of genomic BamHI fragments. pNEBUC (G. Weinzierl, unpublished data) is a vector derived from pNEB (NEB) that contains a U. maydis autonomously replicating sequence ( ) and a mutated version of the IP subunit of the U. maydis succinate dehydrogenase gene, which confers resistance against the antibiotic carboxin ( ).

    Techniques: Functional Assay, Transformation Assay, Plasmid Preparation

    Functional assay of the b genes of S. reilianum . The S. reilianum strain SRZ1 ( a1b1 ) was transformed with the self-replicating plasmid pNEBUC or with a pNEBUC derivative, pSr-b2, containing the b2 locus of S. reilianum as a 9-kb BamHI fragment. Cells

    Journal:

    Article Title: Mating Type Loci of Sporisorium reilianum: Novel Pattern with Three a and Multiple b Specificities

    doi: 10.1128/EC.4.8.1317-1327.2005

    Figure Lengend Snippet: Functional assay of the b genes of S. reilianum . The S. reilianum strain SRZ1 ( a1b1 ) was transformed with the self-replicating plasmid pNEBUC or with a pNEBUC derivative, pSr-b2, containing the b2 locus of S. reilianum as a 9-kb BamHI fragment. Cells

    Article Snippet: Plasmids pCR2.1-TOPO, pCR4-TOPO, and pCR4Blunt-TOPO (Invitrogen) served for cloning and sequencing of fragments generated by PCR. pCR4BamHI is a derivative of pCR4-TOPO, containing a linker that introduces two BamHI sites, and was used for cloning and sequencing of genomic BamHI fragments. pNEBUC (G. Weinzierl, unpublished data) is a vector derived from pNEB (NEB) that contains a U. maydis autonomously replicating sequence ( ) and a mutated version of the IP subunit of the U. maydis succinate dehydrogenase gene, which confers resistance against the antibiotic carboxin ( ).

    Techniques: Functional Assay, Transformation Assay, Plasmid Preparation

    Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.

    Journal: PLoS ONE

    Article Title: Design and Characterization of Bioengineered Cancer-Like Stem Cells

    doi: 10.1371/journal.pone.0141172

    Figure Lengend Snippet: Sub-cloning of H ras V12 and LTg into pMSCV plasmids. (A) Genes of interest (i.e. HrasV12 or LTg) were inserted in between MSCV LTRs, and either GFP or RFP gene was used as a tracer gene. (B) Inserts cloned into pMSCV plasmids were confirmed by enzymatic digestions with either BamHI or EcoRI. M: DNA ladder, 1: pMSCV-GFP; 2: pMSCV-H ras V12-GFP; 3: pMSCV-GFP cut ; 4: pMSCV-H ras V12-GFP cut ; 5:pBABE-H ras V12 cut (+ control); 6: pMSCV-RFP; 7: pMSCV-SV40 LTg-RFP; 8: pMSCV-RFP cut 9: pMSCV-SV40 LTg-RFP cut ; 10: pBABE-SV40 LTg cut (+ control). White arrows indicate inserts. Sequences of insert were also verified by DNA sequencing.

    Article Snippet: Sub-Cloning of Genes to pMSCV To perform sub-cloning, Hras V12 and SV40 large T antigene (LTg) were separated from pBABE-Hras V12 and pBABE-SV40 LTg by the enzymatic digestion with BamHI and EcoRI (NEB, Ipswich, MA), or with BamHI (NEB), respectively.

    Techniques: Subcloning, Clone Assay, DNA Sequencing

    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Journal: eLife

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11

    doi: 10.7554/eLife.26176

    Figure Lengend Snippet: Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Article Snippet: Amplified PCR products were purified with a PCR Clean-up kit (Promega, Madison, WI), then 5′ sequences were digested with SacI plus BamHI (New England BioLabs, Ipswich, MA) and 3′ sequences with XhoI plus KpnI (New England BioLabs).

    Techniques: Non-Homologous End Joining, Construct, Expressing, Amplification, Clone Assay, Plasmid Preparation, Transformation Assay, Selection