Structured Review

TaKaRa bamhi sites
Sequential conditional targeting of both <t>cortactin</t> alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal <t>BamHI</t>
Bamhi Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bamhi sites/product/TaKaRa
Average 93 stars, based on 118 article reviews
Price from $9.99 to $1999.99
bamhi sites - by Bioz Stars, 2020-07
93/100 stars

Images

1) Product Images from "Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases"

Article Title: Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E08-12-1180

Sequential conditional targeting of both cortactin alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal BamHI
Figure Legend Snippet: Sequential conditional targeting of both cortactin alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal BamHI

Techniques Used: Construct

2) Product Images from "Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system"

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system

Journal: Journal of reproductive immunology

doi: 10.1016/j.jri.2009.10.006

Confirmation of ZP3 insert cloned into yeast pAS2-1 vector (8.4 kb) at EcoRI and BamHI sites. (A) The ZP3 insert of 1 kb was PCR-amplified from pME18SFL3 using specific primers (lane a). The negative control (lane b) and the DNA molecular weight ladder
Figure Legend Snippet: Confirmation of ZP3 insert cloned into yeast pAS2-1 vector (8.4 kb) at EcoRI and BamHI sites. (A) The ZP3 insert of 1 kb was PCR-amplified from pME18SFL3 using specific primers (lane a). The negative control (lane b) and the DNA molecular weight ladder

Techniques Used: Clone Assay, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Negative Control, Molecular Weight

Confirmation of ZP3 insert cloned into mammalian pM vector (3.5 kb) at EcoRI and BamHI sites. The pM-ZP3 mammalian clone digested with EcoRI (lane b) or BamHI (lane c) alone did not show, but the clone digested with both the EcoRI and BamHI restriction
Figure Legend Snippet: Confirmation of ZP3 insert cloned into mammalian pM vector (3.5 kb) at EcoRI and BamHI sites. The pM-ZP3 mammalian clone digested with EcoRI (lane b) or BamHI (lane c) alone did not show, but the clone digested with both the EcoRI and BamHI restriction

Techniques Used: Clone Assay, Plasmid Preparation

Related Articles

Clone Assay:

Article Title: Monopolin Subunit Csm1 Associates with MIND Complex to Establish Monopolar Attachment of Sister Kinetochores at Meiosis I
Article Snippet: .. The ORF encoding Dsn1 was cloned into NcoI and BamHI sites of pGBKT7 (Clontech). .. Mutant versions of Dsn1 in pGBKT7 were generated by gap-repair.

Article Title: A Proximal Promoter Element Required for Positive Transcriptional Control by Guanosine Tetraphosphate and DksA Protein during the Stringent Response
Article Snippet: .. A PCR-amplified portion of the uspA promoter region was subcloned into EcoRI and BamHI sites of the in vitro transcription plasmid pTE103 ( ) using In-FusionTM Dry-Down PCR cloning kit (Clontech) creating pBG100-102. .. The pBG103 plasmid was constructed by GenScript USA Inc. pRLG597 was a kind gift from the Gourse laboratory ( ).

Article Title: ASIC2a-dependent increase of ASIC3 surface expression enhances the sustained component of the currents
Article Snippet: .. The cDNA encoding mouse ASIC2a was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and BamHI sites or mCherry-C1 (Clontech) using the EcoRI and KpnI sites. .. The cDNA-encoding mouse ASIC3 was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and KpnI sites.

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system
Article Snippet: .. This sequence was PCR-amplified using sense (5'CCGGAATTCATGGCCGGCAGCATTAACT 3') and antisense (5'CGCGGATCCCTTCTTTTATTCGGAAGCAG 3') primers, incorporating EcoRI and BamHI sites, respectively, and cloned into pAS2-1 GAL4 binding domain vector following the manufacturer’s protocol (Clontech Laboratories Inc., Mountain View, CA, USA). .. PCR amplification cycles involved: initial denaturation at 94° C for 5 min, 30 cycles at 94° C for 1 min, 55° C for 1 min, 72° C for 1 min, and the final extension at 72° C for 10 min.

Amplification:

Article Title: Autophagy-Related Proteins GABARAP and LC3B Label Structures of Similar Size but Different Shape in Super-Resolution Imaging
Article Snippet: .. Eukaryotic Plasmids The gene for GABARAP was subcloned from a GST-GABARAP-fusion plasmid (Addgene plasmid #73948 [ ], Addgene, Watertown, MA, USA) by PCR amplification into the XhoI and BamHI sites of peYFP-C1 (Clontech, Mountain View, CA, USA), yielding peYFP-C1/GABARAP [ ]. .. The fluorescent variant of LC3B was generated analogously, starting from a GST-fusion plasmid (Addgene plasmid #73949 [ ], Addgene) and yielding peYFP-C1/LC3B.

Article Title: ASIC2a-dependent increase of ASIC3 surface expression enhances the sustained component of the currents
Article Snippet: .. The cDNA encoding mouse ASIC2a was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and BamHI sites or mCherry-C1 (Clontech) using the EcoRI and KpnI sites. .. The cDNA-encoding mouse ASIC3 was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and KpnI sites.

In Vitro:

Article Title: A Proximal Promoter Element Required for Positive Transcriptional Control by Guanosine Tetraphosphate and DksA Protein during the Stringent Response
Article Snippet: .. A PCR-amplified portion of the uspA promoter region was subcloned into EcoRI and BamHI sites of the in vitro transcription plasmid pTE103 ( ) using In-FusionTM Dry-Down PCR cloning kit (Clontech) creating pBG100-102. .. The pBG103 plasmid was constructed by GenScript USA Inc. pRLG597 was a kind gift from the Gourse laboratory ( ).

Subcloning:

Article Title: Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases
Article Snippet: .. EGFP-tagged N-terminal cortactin was made by subcloning Cttn-NT into EcoR1 and BamHI sites of pEGFP-N1 vector (Clontech). .. For generation of the targeting constructs, a 7-kb genomic DNA fragment carrying cortactin gene exon 6-9 was used.

Construct:

Article Title: Identification of the gene encoding Brain Cell Membrane Protein 1 (BCMP1), a putative four-transmembrane protein distantly related to the Peripheral Myelin Protein 22 / Epithelial Membrane Proteins and the Claudins
Article Snippet: .. The construct encoding the EGFP-BCMP1 fusion protein was obtained by inserting a PCR fragment corresponding to the BCMP1 ORF between the EcoRI and BamHI sites in the pEGFP-C1 vector (Clontech). ..

Article Title: Role of TARP interaction in S-SCAM-mediated regulation of AMPA receptors
Article Snippet: .. GFP-StgC14 was constructed by inserting the following annealed oligonucleotides between the EcoRI and BamHI sites of pEGFP-C1 (Clontech): Top strand 5′-AATTCTCTCCACGCCAACACAGCCAACCGCCGGACCACGCCCGTATGAG -3′; Bottom strand 5′-TATCCTCATACGGGCGTGGTCCGGCGGTTGGCAGTGTTGGCGTGGAGAG-3′. .. Dissociated hippocampal neurons grown on top of coverslips that were pre-coated with 37.5 μg/ml poly- d -lysine (BD) and 2.5 μg/ml laminin (BD) in a standard 12-well tissue culture plate (Corning).

Polymerase Chain Reaction:

Article Title: Identification of the gene encoding Brain Cell Membrane Protein 1 (BCMP1), a putative four-transmembrane protein distantly related to the Peripheral Myelin Protein 22 / Epithelial Membrane Proteins and the Claudins
Article Snippet: .. The construct encoding the EGFP-BCMP1 fusion protein was obtained by inserting a PCR fragment corresponding to the BCMP1 ORF between the EcoRI and BamHI sites in the pEGFP-C1 vector (Clontech). ..

Article Title: Autophagy-Related Proteins GABARAP and LC3B Label Structures of Similar Size but Different Shape in Super-Resolution Imaging
Article Snippet: .. Eukaryotic Plasmids The gene for GABARAP was subcloned from a GST-GABARAP-fusion plasmid (Addgene plasmid #73948 [ ], Addgene, Watertown, MA, USA) by PCR amplification into the XhoI and BamHI sites of peYFP-C1 (Clontech, Mountain View, CA, USA), yielding peYFP-C1/GABARAP [ ]. .. The fluorescent variant of LC3B was generated analogously, starting from a GST-fusion plasmid (Addgene plasmid #73949 [ ], Addgene) and yielding peYFP-C1/LC3B.

Article Title: A Proximal Promoter Element Required for Positive Transcriptional Control by Guanosine Tetraphosphate and DksA Protein during the Stringent Response
Article Snippet: .. A PCR-amplified portion of the uspA promoter region was subcloned into EcoRI and BamHI sites of the in vitro transcription plasmid pTE103 ( ) using In-FusionTM Dry-Down PCR cloning kit (Clontech) creating pBG100-102. .. The pBG103 plasmid was constructed by GenScript USA Inc. pRLG597 was a kind gift from the Gourse laboratory ( ).

Article Title: ASIC2a-dependent increase of ASIC3 surface expression enhances the sustained component of the currents
Article Snippet: .. The cDNA encoding mouse ASIC2a was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and BamHI sites or mCherry-C1 (Clontech) using the EcoRI and KpnI sites. .. The cDNA-encoding mouse ASIC3 was amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and KpnI sites.

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system
Article Snippet: .. This sequence was PCR-amplified using sense (5'CCGGAATTCATGGCCGGCAGCATTAACT 3') and antisense (5'CGCGGATCCCTTCTTTTATTCGGAAGCAG 3') primers, incorporating EcoRI and BamHI sites, respectively, and cloned into pAS2-1 GAL4 binding domain vector following the manufacturer’s protocol (Clontech Laboratories Inc., Mountain View, CA, USA). .. PCR amplification cycles involved: initial denaturation at 94° C for 5 min, 30 cycles at 94° C for 1 min, 55° C for 1 min, 72° C for 1 min, and the final extension at 72° C for 10 min.

Sequencing:

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system
Article Snippet: .. This sequence was PCR-amplified using sense (5'CCGGAATTCATGGCCGGCAGCATTAACT 3') and antisense (5'CGCGGATCCCTTCTTTTATTCGGAAGCAG 3') primers, incorporating EcoRI and BamHI sites, respectively, and cloned into pAS2-1 GAL4 binding domain vector following the manufacturer’s protocol (Clontech Laboratories Inc., Mountain View, CA, USA). .. PCR amplification cycles involved: initial denaturation at 94° C for 5 min, 30 cycles at 94° C for 1 min, 55° C for 1 min, 72° C for 1 min, and the final extension at 72° C for 10 min.

Binding Assay:

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system
Article Snippet: .. This sequence was PCR-amplified using sense (5'CCGGAATTCATGGCCGGCAGCATTAACT 3') and antisense (5'CGCGGATCCCTTCTTTTATTCGGAAGCAG 3') primers, incorporating EcoRI and BamHI sites, respectively, and cloned into pAS2-1 GAL4 binding domain vector following the manufacturer’s protocol (Clontech Laboratories Inc., Mountain View, CA, USA). .. PCR amplification cycles involved: initial denaturation at 94° C for 5 min, 30 cycles at 94° C for 1 min, 55° C for 1 min, 72° C for 1 min, and the final extension at 72° C for 10 min.

Plasmid Preparation:

Article Title: Identification of the gene encoding Brain Cell Membrane Protein 1 (BCMP1), a putative four-transmembrane protein distantly related to the Peripheral Myelin Protein 22 / Epithelial Membrane Proteins and the Claudins
Article Snippet: .. The construct encoding the EGFP-BCMP1 fusion protein was obtained by inserting a PCR fragment corresponding to the BCMP1 ORF between the EcoRI and BamHI sites in the pEGFP-C1 vector (Clontech). ..

Article Title: Autophagy-Related Proteins GABARAP and LC3B Label Structures of Similar Size but Different Shape in Super-Resolution Imaging
Article Snippet: .. Eukaryotic Plasmids The gene for GABARAP was subcloned from a GST-GABARAP-fusion plasmid (Addgene plasmid #73948 [ ], Addgene, Watertown, MA, USA) by PCR amplification into the XhoI and BamHI sites of peYFP-C1 (Clontech, Mountain View, CA, USA), yielding peYFP-C1/GABARAP [ ]. .. The fluorescent variant of LC3B was generated analogously, starting from a GST-fusion plasmid (Addgene plasmid #73949 [ ], Addgene) and yielding peYFP-C1/LC3B.

Article Title: Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases
Article Snippet: .. EGFP-tagged N-terminal cortactin was made by subcloning Cttn-NT into EcoR1 and BamHI sites of pEGFP-N1 vector (Clontech). .. For generation of the targeting constructs, a 7-kb genomic DNA fragment carrying cortactin gene exon 6-9 was used.

Article Title: A Proximal Promoter Element Required for Positive Transcriptional Control by Guanosine Tetraphosphate and DksA Protein during the Stringent Response
Article Snippet: .. A PCR-amplified portion of the uspA promoter region was subcloned into EcoRI and BamHI sites of the in vitro transcription plasmid pTE103 ( ) using In-FusionTM Dry-Down PCR cloning kit (Clontech) creating pBG100-102. .. The pBG103 plasmid was constructed by GenScript USA Inc. pRLG597 was a kind gift from the Gourse laboratory ( ).

Article Title: Identification of human sperm proteins that interact with human zona pellucida3 (ZP3) using yeast two-hybrid system
Article Snippet: .. This sequence was PCR-amplified using sense (5'CCGGAATTCATGGCCGGCAGCATTAACT 3') and antisense (5'CGCGGATCCCTTCTTTTATTCGGAAGCAG 3') primers, incorporating EcoRI and BamHI sites, respectively, and cloned into pAS2-1 GAL4 binding domain vector following the manufacturer’s protocol (Clontech Laboratories Inc., Mountain View, CA, USA). .. PCR amplification cycles involved: initial denaturation at 94° C for 5 min, 30 cycles at 94° C for 1 min, 55° C for 1 min, 72° C for 1 min, and the final extension at 72° C for 10 min.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    TaKaRa bamhi sites
    Sequential conditional targeting of both <t>cortactin</t> alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal <t>BamHI</t>
    Bamhi Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi sites/product/TaKaRa
    Average 93 stars, based on 118 article reviews
    Price from $9.99 to $1999.99
    bamhi sites - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    88
    TaKaRa bamhi sites gst sharpin
    The UBL domain of <t>SHARPIN</t> mediates binding to integrin. (A) Schematic representation of SHARPIN with its functional domains and the SHARPIN fragments used in this study. (B) Pull-down experiments to determine the interaction between GFP-SHARPIN (full-length or fragments) and peptides corresponding to the cytoplasmic domain of ITGAL and ITGB2. (C) Far-Western analysis of <t>GST-SHARPIN</t> (full-length or fragments) binding to full-length ITGAL-ITGB2 or ITGAL-ITGB2 lacking both cytoplasmic tails. Loading controls for GST-SHARPIN (full-length or fragments) and both ITGAL-ITGB2s are shown. (D) Fluorescence polarization-based titration of GST-SHARPIN (full-length or fragments) binding to an integrin peptide corresponding to the conserved domain within the cytoplasmic tail of ITGA2. Average normalized binding curves are shown (mean ± s.e.m. ***: p
    Bamhi Sites Gst Sharpin, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi sites gst sharpin/product/TaKaRa
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi sites gst sharpin - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    91
    TaKaRa bamhi xhoi sites
    Production of the TK domain of the IRR of P. fucata polyclonal antibody. ( a ) pET28a plasmid was digested with two restriction enzymes <t>(BamHI</t> and <t>XhoI)</t> to check the successful cloning of the TK-encoding domain into a bacterial expression system. Lane 1, pET28a-TK digested by BamHI and XhoI; lane M, DNA Marker. ( b ) 15% SDS-PAGE analysis of recombinant TK after IPTG induction. Lane 1, total protein from uninduced E. coli harboring pET28a-TK; lane 2, total protein from induced E. coli harboring pET28a-TK (28 °C, 4 h after 0.5 mM IPTG induction); lane 3: the insoluble fraction after ultrasonication precipitation; lane 4, the soluble fraction after ultrasonication. ( c ) Purification of recombinant TK. Lane 1, the supernatant of the ultrasonication precipitate after solubilization in 8 M urea (used for TK purification); lane 2, the flow through; lane 3, the elution of NTAU-10, Lane 4: the elution of NTAU-50, Lane 5: the elution of NTAU-200. ( d ) Quantitative analysis of recombinant TK. Lane 1, BSA standard (1 μg); lane 2, BSA standard (2 μg); lane 3, BSA standard (4 μg); lane 4, BSA standard (8 μg); lane 5, recombinant TK (2 μl); lane 6, recombinant TK (4 μl). ( e ) Evaluation of the anti-TK polyclonal antibody by western blotting. Lane M, protein marker; lanes 1 and 2, purified recombinant TK analyzed by western blotting with 1:5,000 and 1:20,000 dilutions, respectively, of the purified antibody.
    Bamhi Xhoi Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xhoi sites/product/TaKaRa
    Average 91 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    bamhi xhoi sites - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    89
    TaKaRa bamh1 sites
    Construction and identification of human and mouse proIAPP C . elegans vectors. A. Schematic representation of human-proIAPP and mouse-proIAPP tissue-specific vector constructs. cDNA of human and mouse proIAPP with human and mouse signal peptide, respectively, were cloned into the <t>BamH1</t> restriction site of the pSX95.77YFP C . elegans vector to generate human and mouse pSX95.77YFP-proIAPP transgenes. Resulting constructs were digested with Sal1, blunt-ended and ligated into Gateway Cassette C.1 upstream of human and mouse coding sequences to create vectors pNG1 and pNG2. Destination vectors pNG1 and pNG2 were LR recombined with pLR22, pLR25 and pLR35 entry clones to generate human proIAPP plasmids: pPR3, pPR4 and pPR5 and mouse proIAPP plasmids: pPR8, pPR9 and pPR10. B. h-proIAPP sequence of construct pSX95.77YFP-prohIAPP with human signal peptide. Preproh-IAPP (1–89) peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. C. m-proIAPP sequence present in construct pSX95.77YFP-promIAPP with mouse signal peptide. Preprom-IAPP peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. Restriction sites used in the generation of these plasmids are underlined. No stop codon was included after each proIAPP sequence.
    Bamh1 Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamh1 sites/product/TaKaRa
    Average 89 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    bamh1 sites - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    Image Search Results


    Sequential conditional targeting of both cortactin alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal BamHI

    Journal: Molecular Biology of the Cell

    Article Title: Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases

    doi: 10.1091/mbc.E08-12-1180

    Figure Lengend Snippet: Sequential conditional targeting of both cortactin alleles in murine ES cells. (A) Targeting strategy for cortactin allele. Two targeting constructs carrying either a neomycin (harboring an internal BglII site) or a puromycin (harboring an internal BamHI

    Article Snippet: EGFP-tagged N-terminal cortactin was made by subcloning Cttn-NT into EcoR1 and BamHI sites of pEGFP-N1 vector (Clontech).

    Techniques: Construct

    The UBL domain of SHARPIN mediates binding to integrin. (A) Schematic representation of SHARPIN with its functional domains and the SHARPIN fragments used in this study. (B) Pull-down experiments to determine the interaction between GFP-SHARPIN (full-length or fragments) and peptides corresponding to the cytoplasmic domain of ITGAL and ITGB2. (C) Far-Western analysis of GST-SHARPIN (full-length or fragments) binding to full-length ITGAL-ITGB2 or ITGAL-ITGB2 lacking both cytoplasmic tails. Loading controls for GST-SHARPIN (full-length or fragments) and both ITGAL-ITGB2s are shown. (D) Fluorescence polarization-based titration of GST-SHARPIN (full-length or fragments) binding to an integrin peptide corresponding to the conserved domain within the cytoplasmic tail of ITGA2. Average normalized binding curves are shown (mean ± s.e.m. ***: p

    Journal: PLoS ONE

    Article Title: Mutually Exclusive Roles of SHARPIN in Integrin Inactivation and NF-κB Signaling

    doi: 10.1371/journal.pone.0143423

    Figure Lengend Snippet: The UBL domain of SHARPIN mediates binding to integrin. (A) Schematic representation of SHARPIN with its functional domains and the SHARPIN fragments used in this study. (B) Pull-down experiments to determine the interaction between GFP-SHARPIN (full-length or fragments) and peptides corresponding to the cytoplasmic domain of ITGAL and ITGB2. (C) Far-Western analysis of GST-SHARPIN (full-length or fragments) binding to full-length ITGAL-ITGB2 or ITGAL-ITGB2 lacking both cytoplasmic tails. Loading controls for GST-SHARPIN (full-length or fragments) and both ITGAL-ITGB2s are shown. (D) Fluorescence polarization-based titration of GST-SHARPIN (full-length or fragments) binding to an integrin peptide corresponding to the conserved domain within the cytoplasmic tail of ITGA2. Average normalized binding curves are shown (mean ± s.e.m. ***: p

    Article Snippet: For construction of the GFP- and GST-SHARPIN fragments, the corresponding DNA fragments were amplified from siRNA1-insensitive GFP-Sharpin using specific primers that introduce XhoI and XbaI (GFP-SHARPIN) or EcoRI and BamHI sites (GST-SHARPIN), followed by cloning into pEGFPC1 (Clontech) and pGEX4T-1 vectors, respectively.

    Techniques: Binding Assay, Functional Assay, Western Blot, Fluorescence, Titration

    Integrin and RNF31 binding to SHARPIN are mutually exclusive. (A) Pull-down assay showing that the presence of a peptide corresponding to the cytoplasmic domain of ITGAL prevents interaction between GST-SHARPIN and RNF31. (B) Co-immunoprecipitation of endogenous SHARPIN, RNF31 and ITGAL from Jurkat cells (a GFP antibody was used as negative control). (C) Pull-down of GFP-SHARPIN from HEK293 cells demonstrated that cells in suspension show decreased RNF31-SHARPIN interaction compared to adherent cells (n = 4). RNF31 binding was normalized to total RNF31 levels and the amount of pulled-down GFP-SHARPIN. (D) TNF-induced NF-κB promoter activity of PC3 cells, adherent to either 5 μg/ml fibronectin or poly-L-lysin (a substratum for integrin-independent cell adhesion), was measured using a luciferase reporter assay (n = 2 with 5 replicates each). (E) TNF-induced NF-κB promoter activity of PC3 cells or WT MEFs, incubated with a membrane-permeable ITGA1-tail peptide (α1-TAT) or a scrambled peptide (ScrTAT), was measured using a luciferase reporter assay (n = 2 with 6–9 replicates, and n = 3 with 3–5 replicates, respectively). All numerical data are mean ± s.e.m. ***: p

    Journal: PLoS ONE

    Article Title: Mutually Exclusive Roles of SHARPIN in Integrin Inactivation and NF-κB Signaling

    doi: 10.1371/journal.pone.0143423

    Figure Lengend Snippet: Integrin and RNF31 binding to SHARPIN are mutually exclusive. (A) Pull-down assay showing that the presence of a peptide corresponding to the cytoplasmic domain of ITGAL prevents interaction between GST-SHARPIN and RNF31. (B) Co-immunoprecipitation of endogenous SHARPIN, RNF31 and ITGAL from Jurkat cells (a GFP antibody was used as negative control). (C) Pull-down of GFP-SHARPIN from HEK293 cells demonstrated that cells in suspension show decreased RNF31-SHARPIN interaction compared to adherent cells (n = 4). RNF31 binding was normalized to total RNF31 levels and the amount of pulled-down GFP-SHARPIN. (D) TNF-induced NF-κB promoter activity of PC3 cells, adherent to either 5 μg/ml fibronectin or poly-L-lysin (a substratum for integrin-independent cell adhesion), was measured using a luciferase reporter assay (n = 2 with 5 replicates each). (E) TNF-induced NF-κB promoter activity of PC3 cells or WT MEFs, incubated with a membrane-permeable ITGA1-tail peptide (α1-TAT) or a scrambled peptide (ScrTAT), was measured using a luciferase reporter assay (n = 2 with 6–9 replicates, and n = 3 with 3–5 replicates, respectively). All numerical data are mean ± s.e.m. ***: p

    Article Snippet: For construction of the GFP- and GST-SHARPIN fragments, the corresponding DNA fragments were amplified from siRNA1-insensitive GFP-Sharpin using specific primers that introduce XhoI and XbaI (GFP-SHARPIN) or EcoRI and BamHI sites (GST-SHARPIN), followed by cloning into pEGFPC1 (Clontech) and pGEX4T-1 vectors, respectively.

    Techniques: Binding Assay, Pull Down Assay, Immunoprecipitation, Negative Control, Activity Assay, Luciferase, Reporter Assay, Incubation

    Fine mapping of the integrin binding site in SHARPIN. (A) Interaction of different GST-SHARPIN (WT and all point mutants) with full-length ITGAL-ITGB2 was determined using Far-Western assays. GST-SHARPIN 1-180 was used as negative control. (B) HEK293 cancer cells, overexpressing WT or mutant GFP-SHARPIN in combination with ITGA5–mCherry, subjected to FRET analysis by FLIM. Fluorescence lifetimes, mapping spatial FRET in cells, are depicted using a pseudo-color scale (blue, normal lifetime; red, FRET (reduced lifetime)). Scale bars: 10 μm. (C) Quantification of FRET efficiency for all mutants (n ≥ 12 cells). All numerical data are mean ± s.e.m. ***: p

    Journal: PLoS ONE

    Article Title: Mutually Exclusive Roles of SHARPIN in Integrin Inactivation and NF-κB Signaling

    doi: 10.1371/journal.pone.0143423

    Figure Lengend Snippet: Fine mapping of the integrin binding site in SHARPIN. (A) Interaction of different GST-SHARPIN (WT and all point mutants) with full-length ITGAL-ITGB2 was determined using Far-Western assays. GST-SHARPIN 1-180 was used as negative control. (B) HEK293 cancer cells, overexpressing WT or mutant GFP-SHARPIN in combination with ITGA5–mCherry, subjected to FRET analysis by FLIM. Fluorescence lifetimes, mapping spatial FRET in cells, are depicted using a pseudo-color scale (blue, normal lifetime; red, FRET (reduced lifetime)). Scale bars: 10 μm. (C) Quantification of FRET efficiency for all mutants (n ≥ 12 cells). All numerical data are mean ± s.e.m. ***: p

    Article Snippet: For construction of the GFP- and GST-SHARPIN fragments, the corresponding DNA fragments were amplified from siRNA1-insensitive GFP-Sharpin using specific primers that introduce XhoI and XbaI (GFP-SHARPIN) or EcoRI and BamHI sites (GST-SHARPIN), followed by cloning into pEGFPC1 (Clontech) and pGEX4T-1 vectors, respectively.

    Techniques: Binding Assay, Western Blot, Negative Control, Mutagenesis, Fluorescence

    Fine mapping of the RNF31 binding site in SHARPIN. (A) Western blot analysis of SHARPIN and β-tubulin levels in control- or SHARPIN-silenced PC3 cells. (B) TNF-induced NF-κB promoter activity of SHARPIN- or control-silenced PC3 cells was measured using a luciferase reporter assay. (n = 3 with 5 replicates each). (C) TNF-induced NF-κB promoter activity of SHARPIN-silenced PC3 cells, expressing GFP alone, WT or mutant GFP-SHARPIN (n = 6–15 measurements from 2–3 experiments). (D,E) Interaction between RNF31 and WT or mutant GST-SHARPIN was determined using an ELISA-based binding assay (n = 3) (D) or Far-Western analysis (E). All numerical data are mean ± s.e.m. ***: p

    Journal: PLoS ONE

    Article Title: Mutually Exclusive Roles of SHARPIN in Integrin Inactivation and NF-κB Signaling

    doi: 10.1371/journal.pone.0143423

    Figure Lengend Snippet: Fine mapping of the RNF31 binding site in SHARPIN. (A) Western blot analysis of SHARPIN and β-tubulin levels in control- or SHARPIN-silenced PC3 cells. (B) TNF-induced NF-κB promoter activity of SHARPIN- or control-silenced PC3 cells was measured using a luciferase reporter assay. (n = 3 with 5 replicates each). (C) TNF-induced NF-κB promoter activity of SHARPIN-silenced PC3 cells, expressing GFP alone, WT or mutant GFP-SHARPIN (n = 6–15 measurements from 2–3 experiments). (D,E) Interaction between RNF31 and WT or mutant GST-SHARPIN was determined using an ELISA-based binding assay (n = 3) (D) or Far-Western analysis (E). All numerical data are mean ± s.e.m. ***: p

    Article Snippet: For construction of the GFP- and GST-SHARPIN fragments, the corresponding DNA fragments were amplified from siRNA1-insensitive GFP-Sharpin using specific primers that introduce XhoI and XbaI (GFP-SHARPIN) or EcoRI and BamHI sites (GST-SHARPIN), followed by cloning into pEGFPC1 (Clontech) and pGEX4T-1 vectors, respectively.

    Techniques: Binding Assay, Western Blot, Activity Assay, Luciferase, Reporter Assay, Expressing, Mutagenesis, Enzyme-linked Immunosorbent Assay

    Production of the TK domain of the IRR of P. fucata polyclonal antibody. ( a ) pET28a plasmid was digested with two restriction enzymes (BamHI and XhoI) to check the successful cloning of the TK-encoding domain into a bacterial expression system. Lane 1, pET28a-TK digested by BamHI and XhoI; lane M, DNA Marker. ( b ) 15% SDS-PAGE analysis of recombinant TK after IPTG induction. Lane 1, total protein from uninduced E. coli harboring pET28a-TK; lane 2, total protein from induced E. coli harboring pET28a-TK (28 °C, 4 h after 0.5 mM IPTG induction); lane 3: the insoluble fraction after ultrasonication precipitation; lane 4, the soluble fraction after ultrasonication. ( c ) Purification of recombinant TK. Lane 1, the supernatant of the ultrasonication precipitate after solubilization in 8 M urea (used for TK purification); lane 2, the flow through; lane 3, the elution of NTAU-10, Lane 4: the elution of NTAU-50, Lane 5: the elution of NTAU-200. ( d ) Quantitative analysis of recombinant TK. Lane 1, BSA standard (1 μg); lane 2, BSA standard (2 μg); lane 3, BSA standard (4 μg); lane 4, BSA standard (8 μg); lane 5, recombinant TK (2 μl); lane 6, recombinant TK (4 μl). ( e ) Evaluation of the anti-TK polyclonal antibody by western blotting. Lane M, protein marker; lanes 1 and 2, purified recombinant TK analyzed by western blotting with 1:5,000 and 1:20,000 dilutions, respectively, of the purified antibody.

    Journal: Scientific Reports

    Article Title: PfIRR Interacts with HrIGF-I and Activates the MAP-kinase and PI3-kinase Signaling Pathways to Regulate Glycogen Metabolism in Pinctada fucata

    doi: 10.1038/srep22063

    Figure Lengend Snippet: Production of the TK domain of the IRR of P. fucata polyclonal antibody. ( a ) pET28a plasmid was digested with two restriction enzymes (BamHI and XhoI) to check the successful cloning of the TK-encoding domain into a bacterial expression system. Lane 1, pET28a-TK digested by BamHI and XhoI; lane M, DNA Marker. ( b ) 15% SDS-PAGE analysis of recombinant TK after IPTG induction. Lane 1, total protein from uninduced E. coli harboring pET28a-TK; lane 2, total protein from induced E. coli harboring pET28a-TK (28 °C, 4 h after 0.5 mM IPTG induction); lane 3: the insoluble fraction after ultrasonication precipitation; lane 4, the soluble fraction after ultrasonication. ( c ) Purification of recombinant TK. Lane 1, the supernatant of the ultrasonication precipitate after solubilization in 8 M urea (used for TK purification); lane 2, the flow through; lane 3, the elution of NTAU-10, Lane 4: the elution of NTAU-50, Lane 5: the elution of NTAU-200. ( d ) Quantitative analysis of recombinant TK. Lane 1, BSA standard (1 μg); lane 2, BSA standard (2 μg); lane 3, BSA standard (4 μg); lane 4, BSA standard (8 μg); lane 5, recombinant TK (2 μl); lane 6, recombinant TK (4 μl). ( e ) Evaluation of the anti-TK polyclonal antibody by western blotting. Lane M, protein marker; lanes 1 and 2, purified recombinant TK analyzed by western blotting with 1:5,000 and 1:20,000 dilutions, respectively, of the purified antibody.

    Article Snippet: An 837-bp cDNA fragment encoding the TK domain of IRR (GenBank accession number: JX121113) was amplified and cloned into the BamHI/XhoI sites of the pET28a expression vector (TAKARA, Japan), and histidine-tagged TK was expressed in E. coli and purified with a Ni2+ -NTA column.

    Techniques: Plasmid Preparation, Clone Assay, Expressing, Marker, SDS Page, Recombinant, Purification, Flow Cytometry, Western Blot

    Construction and identification of human and mouse proIAPP C . elegans vectors. A. Schematic representation of human-proIAPP and mouse-proIAPP tissue-specific vector constructs. cDNA of human and mouse proIAPP with human and mouse signal peptide, respectively, were cloned into the BamH1 restriction site of the pSX95.77YFP C . elegans vector to generate human and mouse pSX95.77YFP-proIAPP transgenes. Resulting constructs were digested with Sal1, blunt-ended and ligated into Gateway Cassette C.1 upstream of human and mouse coding sequences to create vectors pNG1 and pNG2. Destination vectors pNG1 and pNG2 were LR recombined with pLR22, pLR25 and pLR35 entry clones to generate human proIAPP plasmids: pPR3, pPR4 and pPR5 and mouse proIAPP plasmids: pPR8, pPR9 and pPR10. B. h-proIAPP sequence of construct pSX95.77YFP-prohIAPP with human signal peptide. Preproh-IAPP (1–89) peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. C. m-proIAPP sequence present in construct pSX95.77YFP-promIAPP with mouse signal peptide. Preprom-IAPP peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. Restriction sites used in the generation of these plasmids are underlined. No stop codon was included after each proIAPP sequence.

    Journal: PLoS ONE

    Article Title: Hsp72 (HSPA1A) Prevents Human Islet Amyloid Polypeptide Aggregation and Toxicity: A New Approach for Type 2 Diabetes Treatment

    doi: 10.1371/journal.pone.0149409

    Figure Lengend Snippet: Construction and identification of human and mouse proIAPP C . elegans vectors. A. Schematic representation of human-proIAPP and mouse-proIAPP tissue-specific vector constructs. cDNA of human and mouse proIAPP with human and mouse signal peptide, respectively, were cloned into the BamH1 restriction site of the pSX95.77YFP C . elegans vector to generate human and mouse pSX95.77YFP-proIAPP transgenes. Resulting constructs were digested with Sal1, blunt-ended and ligated into Gateway Cassette C.1 upstream of human and mouse coding sequences to create vectors pNG1 and pNG2. Destination vectors pNG1 and pNG2 were LR recombined with pLR22, pLR25 and pLR35 entry clones to generate human proIAPP plasmids: pPR3, pPR4 and pPR5 and mouse proIAPP plasmids: pPR8, pPR9 and pPR10. B. h-proIAPP sequence of construct pSX95.77YFP-prohIAPP with human signal peptide. Preproh-IAPP (1–89) peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. C. m-proIAPP sequence present in construct pSX95.77YFP-promIAPP with mouse signal peptide. Preprom-IAPP peptide amino acid sequence is shown in black italics. Signal peptide sequence is shown in red. Restriction sites used in the generation of these plasmids are underlined. No stop codon was included after each proIAPP sequence.

    Article Snippet: Constructs Human and mouse preproIAPP cDNA clones (Origene, Rockville, MD) were subcloned into BamH1 sites of expression vector pSX95.77YFP using the In-FusionTM PCR cloning system (Clontech, Mountain View, Ca).

    Techniques: Plasmid Preparation, Construct, Clone Assay, Sequencing