bamhi restriction enzymes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    BamHI
    Description:
    5'  G ↓G  A  T  C  C   3' 3'  C  C  T  A  G ↑G   5' Thermo Scientific BamHI restriction enzyme recognizes G^GATCC sites and cuts best at 37°C in its own unique buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes. Note: Also available as a FastDigest enzyme for rapid DNA digestion.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: For methylation sensitivity, refer to product specifications.
    Catalog Number:
    ER0051
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Size:
    4 000 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Restriction Enzymes
    Score:
    85
    Buy from Supplier
    Name:
    BamHI, HC
    Description:
    5'  G ↓G  A  T  C  C   3' 3'  C  C  T  A  G ↑G   5' Thermo Scientific BamHI restriction enzyme recognizes G^GATCC sites and cuts best at 37°C in its own unique buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: For methylation sensitivity, refer to product specifications.
    Catalog Number:
    ER0053
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Size:
    20 000 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher bamhi restriction enzymes
    Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with <t>BamHI</t> ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, <t>Waltham,</t> MA, USA).
    5'  G ↓G  A  T  C  C   3' 3'  C  C  T  A  G ↑G   5' Thermo Scientific BamHI restriction enzyme recognizes G^GATCC sites and cuts best at 37°C in its own unique buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: For methylation sensitivity, refer to product specifications.
    https://www.bioz.com/result/bamhi restriction enzymes/product/Thermo Fisher
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bamhi restriction enzymes - by Bioz Stars, 2019-12
    95/100 stars

    Images

    1) Product Images from "Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance"

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance

    Journal: Jundishapur Journal of Microbiology

    doi: 10.5812/jjm.29384

    Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).
    Figure Legend Snippet: Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).

    Techniques Used: Plasmid Preparation

    Related Articles

    Clone Assay:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: However, as there was only one potential target site identified by the CoDA platform in the β-lactamase gene of the pTZ57R plasmid (Val 258-Ala 266), the ZFN target site ( ) was cloned in the pTZ57R (Thermo Scientific, Waltham, MA, USA) into the EcoRI and BamHI restriction sites. .. The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: In order to perform complementation experiments, the hns2 gene (open reading frame [ORF] EC042_2834) of E. coli 042 strain was cloned into the pLG338-30 vector. .. The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific).

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: Paragraph title: Cloning, expression, and purification ... The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation.

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Therefore, master plasmid Kgp-CepA was first obtained through PCR/restriction digestion methods. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The correct placement and orientation of DNA segments in resulting plasmid Kgp-CepA were confirmed by sequencing.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: Paragraph title: Cloning and expression of EqCXCL16 in Escherichia coli . ... The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Paragraph title: 2.2 Cloning, and analysis of jagged1 promoter sequence ... Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI).

    Luciferase:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Digestion products were cleaned using Quickclean 5M PCR purification kit (Genscript, USA).

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: Paragraph title: Reporter vectors and luciferase assays ... A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: PCR products were electrophoretically separated on 1.25% agarose gels and the appropriate sized band cut out and purified using the PerfectPrep Gel Cleanup kit (Eppendorf, Westbury, NY). .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Filtration:

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. Protein expression and purification of Fld1 was carried out in a similar fashion as previously described for the Fld‐like protein NrdI.

    Recovery:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    DNA Ligation:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Synthesized:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: To this end, the ZFN target site was synthesized as two oligos (Bioneer Co., Korea); such that their hybridization created the double-stranded DNA target site, with EcoRI and BamHI overhangs at the two ends. .. The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: The mutagenic oligonucleotide primers were synthesized by Sigma-Proligo (Singapore) (Table ). .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Article Title: Structure-based design of small peptide inhibitors of protein kinase CK2 subunit interaction
    Article Snippet: Cyclic peptides, biotinylated cyclic peptides and alanine-mutated cyclic peptides were synthesized by Eurogentec. .. EcoRI and BamHI restriction enzymes were from Invitrogen, and SacI and AgeI were from New England Biolabs.

    Construct:

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Paragraph title: Expression constructs ... ADAM12-myc -His was made by excision of ADAM12 cDNA from the pEGFP-N1 vector using XhoI and BamHI restriction enzymes and ligation into the corresponding pcDNA3.1/myc -His© B vector (Invitrogen).

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The correct placement and orientation of DNA segments in resulting plasmid Kgp-CepA were confirmed by sequencing.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. All ligation reactions were transformed into E. coli DH5α (Invitrogen), amplified and purified by MaxiPrep (Qiagen, Valencia, CA).

    Incubation:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Digestion products were cleaned using Quickclean 5M PCR purification kit (Genscript, USA).

    Amplification:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: Rat gria2 5’ region and promoter ( for physical map) were amplified from 5ng of rat genomic DNA by a PCR reaction using the following primers: Promoter region Forward - TTT GGA TCC GAA GCT AAA GTT CAc agt ttt ggg ag ; Reverse - TTT CCA TGG AAT TAG ATC CTC TGC ATT GTG AG ; Probe region (sense) Forward - TTT CTG CAG TTC AAG AGC AAT CCA CAG G ; Reverse - TTT GGA TCC CTA TGA TGC AAG CAT AAT TCC ; Probe region (antisense) Forward - TTT GGA TCC TTC AAG AGC AAT CCA CAG G ; Reverse - TTT CTG CAG CTA TGA TGC AAG CAT AAT TCC according to the following cycle: 5min at 95°C followed by 40 cycles of 35 sec at 95°C, 35 sec at 56°C and 70sec/40sec (respectively) at 72°C. .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C.

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: The kpgABC genes were PCR amplified from KP64 genomic DNA using primers kpgABC-HindIII-F (5′-TCAAAGCTTATGATTTATAAAGGCAACGACAAA-3′) and kpgABC-BamHI-R (5′ TAAGGATCCCTACTTCGTCCATTCTTTATGCA-3′). .. The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol. .. All other antibiotics were tested using the Vitek-2 antibiotic susceptibility testing platform (bioMérieux).

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation.

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Therefore, master plasmid Kgp-CepA was first obtained through PCR/restriction digestion methods. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The correct placement and orientation of DNA segments in resulting plasmid Kgp-CepA were confirmed by sequencing.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Expressing:

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. The ligation mixture was transformed into E. coli XL10‐Gold Ultracompetent cells (Stratagene), from which enough plasmids were prepped to enable successful transformation of E. coli BL21 Gold (DE3) Competent cells (Novagen).

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Paragraph title: Expression constructs ... ADAM12-myc -His was made by excision of ADAM12 cDNA from the pEGFP-N1 vector using XhoI and BamHI restriction enzymes and ligation into the corresponding pcDNA3.1/myc -His© B vector (Invitrogen).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: The recombinant expression vector pscEXP-GST was used as the mutagenesis template for creating single and C-terminal double mutants. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Transformation Assay:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Incubation was conducted over-night at 22°C.

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: The kpgABC genes were PCR amplified from KP64 genomic DNA using primers kpgABC-HindIII-F (5′-TCAAAGCTTATGATTTATAAAGGCAACGACAAA-3′) and kpgABC-BamHI-R (5′ TAAGGATCCCTACTTCGTCCATTCTTTATGCA-3′). .. The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol. .. All other antibiotics were tested using the Vitek-2 antibiotic susceptibility testing platform (bioMérieux).

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific). .. Ligation was performed in pLG338-30 digested with the same restriction enzymes and treated with alkaline phosphatase.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. Recombinant plasmid p15-16A (aa 17 to 247) was isolated from ampicillin-resistant clones using a ZR plasmid miniprep kit (Zymo Research, Irvine, CA).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions. .. The purified fragments were then ligated using T4 DNA ligase according to manufacturer's recommendations (Invitrogen).

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Over Expression:

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: Paragraph title: kpgABC overexpression. ... The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol.

    Kinase Assay:

    Article Title: Structure-based design of small peptide inhibitors of protein kinase CK2 subunit interaction
    Article Snippet: The peptide substrate (RRREDEESDDEE) for CK2 kinase assay was obtained from NeoMPS. .. EcoRI and BamHI restriction enzymes were from Invitrogen, and SacI and AgeI were from New England Biolabs.

    Hybridization:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: To this end, the ZFN target site was synthesized as two oligos (Bioneer Co., Korea); such that their hybridization created the double-stranded DNA target site, with EcoRI and BamHI overhangs at the two ends. .. The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    High Performance Liquid Chromatography:

    Article Title: Structure-based design of small peptide inhibitors of protein kinase CK2 subunit interaction
    Article Snippet: The purity of this peptide (89%) was determined by HPLC on a Nucleosil C18 column using a linear triethanolamine phosphate/acetonitrile gradient. .. EcoRI and BamHI restriction enzymes were from Invitrogen, and SacI and AgeI were from New England Biolabs.

    Transfection:

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Ligation:

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. The ligation mixture was transformed into E. coli XL10‐Gold Ultracompetent cells (Stratagene), from which enough plasmids were prepped to enable successful transformation of E. coli BL21 Gold (DE3) Competent cells (Novagen).

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Mammalian expression constructs for full-length membrane-bound human ADAM12 (ADAM12-L), human ADAM12 fused at its C-terminus to green fluorescent protein (ADAM12-GFP) and catalytically inactive (CI) ADAM12-GFP (E351Q mutation) were previously described , . .. ADAM12-myc -His was made by excision of ADAM12 cDNA from the pEGFP-N1 vector using XhoI and BamHI restriction enzymes and ligation into the corresponding pcDNA3.1/myc -His© B vector (Invitrogen). .. The leucine to phenylalanine (p.L972F ) mutation in ADAM12, ADAM12-myc and ADAM12-GFP were made by Mutagenex, Innovative Mutagenesis and Directed Evolution ( www.mutagenex.com ).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Double mutations consisting of either V275I or C281Y with the single C-terminal mutations were created by restriction digestion, followed by ligation. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Generated:

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Strains incorporating point mutations of Kgp-NPD residue Lys129 (K129A, K129E, and K129R) were generated from P. gingivalis strain W83. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid.

    DNA Sequencing:

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The wild-type plasmid construct of Kgp-NPD (Kgp-CepA) was subsequently used to produce K129A, K129E, and K129R mutations by the SLIM method ( ).

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Sequencing:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). .. The ligation reaction was carried out between the synthetic ZFN target site and the linearized plasmid using T4 DNA ligase (Thermo Scientific, Waltham, MA, USA), and then the ligation product was transformed into a chemically competent Escherichia coli strain TOP10 cells.

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Digestion products were cleaned using Quickclean 5M PCR purification kit (Genscript, USA).

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific). .. The resulting plasmid (pLG338-30hns2 ) was transformed into E. coli DH5α cells and selected in the presence of carbenicillin.

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The sequence encoding the entire EqCXCL16 without the first 16 amino acid residues from the signal sequences was amplified from cDNA made from mRNA extracted from equine monocytes using a Smart cDNA synthesis kit (Clontech Laboratories Inc., Mountain View, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Paragraph title: 2.2 Cloning, and analysis of jagged1 promoter sequence ... Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI).

    Recombinant:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: Paragraph title: 3.1. Preparation of Recombinant pTZ57R ... The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Double mutations consisting of either V275I or C281Y with the single C-terminal mutations were created by restriction digestion, followed by ligation. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions. .. The digested samples were separated by agarose gel electrophoresis.

    Mutagenesis:

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Mammalian expression constructs for full-length membrane-bound human ADAM12 (ADAM12-L), human ADAM12 fused at its C-terminus to green fluorescent protein (ADAM12-GFP) and catalytically inactive (CI) ADAM12-GFP (E351Q mutation) were previously described , . .. ADAM12-myc -His was made by excision of ADAM12 cDNA from the pEGFP-N1 vector using XhoI and BamHI restriction enzymes and ligation into the corresponding pcDNA3.1/myc -His© B vector (Invitrogen).

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Paragraph title: Generation of P. gingivalis Mutant Strains ... Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid.

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Paragraph title: Generation of mutant ScDAOCSs via site-directed mutagenesis. ... Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Isolation:

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: Genomic DNA was isolated from B. cereus ATCC 14579 using the DNEasy kit (Qiagen). .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Genomic DNA was isolated from HUVEC by standard protocol. .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI).

    Subcloning:

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Size-exclusion Chromatography:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: Rat gria2 5’ region and promoter ( for physical map) were amplified from 5ng of rat genomic DNA by a PCR reaction using the following primers: Promoter region Forward - TTT GGA TCC GAA GCT AAA GTT CAc agt ttt ggg ag ; Reverse - TTT CCA TGG AAT TAG ATC CTC TGC ATT GTG AG ; Probe region (sense) Forward - TTT CTG CAG TTC AAG AGC AAT CCA CAG G ; Reverse - TTT GGA TCC CTA TGA TGC AAG CAT AAT TCC ; Probe region (antisense) Forward - TTT GGA TCC TTC AAG AGC AAT CCA CAG G ; Reverse - TTT CTG CAG CTA TGA TGC AAG CAT AAT TCC according to the following cycle: 5min at 95°C followed by 40 cycles of 35 sec at 95°C, 35 sec at 56°C and 70sec/40sec (respectively) at 72°C. .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C.

    Purification:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). .. The recombinant clones were selected by colony polymerase chain reaction (PCR) using a ZFN target site forward primer (5′ - GATCCAGTTATCTACACGACGGGGAGTCAGGCG - 3′) and M13 reverse sequencing primer (5′- CAGGAAACAGCTATGA - 3′) (Bioneer Co., Korea).

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C.

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: Primers hns2 pLG338 ECORI fw 5 (fw stands for forward) and hns2 pLG338 BAMHI rev 3 (rev stands for reverse) (see for sequences) were used to PCR amplify the hns2 gene using Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific). .. The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific). .. Ligation was performed in pLG338-30 digested with the same restriction enzymes and treated with alkaline phosphatase.

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: Paragraph title: Cloning, expression, and purification ... The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: PCR products were electrophoretically separated on 1.25% agarose gels and the appropriate sized band cut out and purified using the PerfectPrep Gel Cleanup kit (Eppendorf, Westbury, NY). .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Polymerase Chain Reaction:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). .. The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Digestion products were cleaned using Quickclean 5M PCR purification kit (Genscript, USA).

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs. .. For luciferase assays, 6 × 105 U937 cells/well were seeded into 12-well plates.

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: The kpgABC genes were PCR amplified from KP64 genomic DNA using primers kpgABC-HindIII-F (5′-TCAAAGCTTATGATTTATAAAGGCAACGACAAA-3′) and kpgABC-BamHI-R (5′ TAAGGATCCCTACTTCGTCCATTCTTTATGCA-3′). .. The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol.

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: Primers hns2 pLG338 ECORI fw 5 (fw stands for forward) and hns2 pLG338 BAMHI rev 3 (rev stands for reverse) (see for sequences) were used to PCR amplify the hns2 gene using Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific). .. The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific). .. Ligation was performed in pLG338-30 digested with the same restriction enzymes and treated with alkaline phosphatase.

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. The ligation mixture was transformed into E. coli XL10‐Gold Ultracompetent cells (Stratagene), from which enough plasmids were prepped to enable successful transformation of E. coli BL21 Gold (DE3) Competent cells (Novagen).

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Therefore, master plasmid Kgp-CepA was first obtained through PCR/restriction digestion methods. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The correct placement and orientation of DNA segments in resulting plasmid Kgp-CepA were confirmed by sequencing.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The cDNA amplification was carried out according to a standard laboratory PCR protocol using forward primer cx16-15F (5′-GCG CTCGAG GCGTTGCTGACTCTGCAAGG-3′) and reverse primer cx16-15R (5′-GC GGATCC GCACTGCCACTGTAACTGAT-3′) (IDT, Coralville, IA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: PCR products were electrophoretically separated on 1.25% agarose gels and the appropriate sized band cut out and purified using the PerfectPrep Gel Cleanup kit (Eppendorf, Westbury, NY). .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Binding Assay:

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI).

    Lysis:

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. Protein expression and purification of Fld1 was carried out in a similar fashion as previously described for the Fld‐like protein NrdI.

    IA:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The cDNA amplification was carried out according to a standard laboratory PCR protocol using forward primer cx16-15F (5′-GCG CTCGAG GCGTTGCTGACTCTGCAAGG-3′) and reverse primer cx16-15R (5′-GC GGATCC GCACTGCCACTGTAACTGAT-3′) (IDT, Coralville, IA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: Rat gria2 5’ region and promoter ( for physical map) were amplified from 5ng of rat genomic DNA by a PCR reaction using the following primers: Promoter region Forward - TTT GGA TCC GAA GCT AAA GTT CAc agt ttt ggg ag ; Reverse - TTT CCA TGG AAT TAG ATC CTC TGC ATT GTG AG ; Probe region (sense) Forward - TTT CTG CAG TTC AAG AGC AAT CCA CAG G ; Reverse - TTT GGA TCC CTA TGA TGC AAG CAT AAT TCC ; Probe region (antisense) Forward - TTT GGA TCC TTC AAG AGC AAT CCA CAG G ; Reverse - TTT CTG CAG CTA TGA TGC AAG CAT AAT TCC according to the following cycle: 5min at 95°C followed by 40 cycles of 35 sec at 95°C, 35 sec at 56°C and 70sec/40sec (respectively) at 72°C. .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C.

    Plasmid Preparation:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: A mixture of two oligos was heat-denatured to single-stranded DNA and then cooled to allow the strands to renaturate. .. The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). .. The ligation reaction was carried out between the synthetic ZFN target site and the linearized plasmid using T4 DNA ligase (Thermo Scientific, Waltham, MA, USA), and then the ligation product was transformed into a chemically competent Escherichia coli strain TOP10 cells.

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: The PCR product was purified using Quickclean 5M PCR purification kit (Genscript, USA). .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C. .. Digestion products were cleaned using Quickclean 5M PCR purification kit (Genscript, USA).

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3
    Article Snippet: The resulting PCR product was ligated to the EcoRV digested vector, yielding pMS4A3(-3213/+11)/pGluc. .. A series of 5′ deletion constructs (-1992/-1, -1441/-1, -1118/-1, -668/-1, -268/-1 and -3213/-279) was generated by PCR amplification using the cloned promoter fragment MS4A3(-3213/+11) as a template, followed by subcloning using EcoRI and BamHI restriction enzymes (Fermentas Inc., Hanover, MD, USA). pMS4A3(-3213/+11)/tk/pGluc, pMS4A3(-268/-1)/tk/pGluc, and pMS4A3(-3213/-279)/tk/pGluc were generated by subcloning the HSV tk promoter into the BamHI, or the KpnI and BamHI, sites of the respective pGluc basic based constructs.

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: The kpgABC genes were PCR amplified from KP64 genomic DNA using primers kpgABC-HindIII-F (5′-TCAAAGCTTATGATTTATAAAGGCAACGACAAA-3′) and kpgABC-BamHI-R (5′ TAAGGATCCCTACTTCGTCCATTCTTTATGCA-3′). .. The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol. .. All other antibiotics were tested using the Vitek-2 antibiotic susceptibility testing platform (bioMérieux).

    Article Title: Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the Enteroaggregative Escherichia coli Strain 042
    Article Snippet: Paragraph title: Plasmid construction. ... The PCR fragment was purified using GeneJET PCR purification kit (Thermo Scientific) and digested with EcoRI and BamHI restriction enzymes (Thermo Scientific).

    Article Title: High‐resolution crystal structures reveal a mixture of conformers of the Gly61‐Asp62 peptide bond in an oxidized flavodoxin from Bacillus cereus
    Article Snippet: The gene sequence encoding the Bc1376 Fld (Fld1) was then amplified by PCR, using gene‐specific forward (GGAATTCCATATGAGTAAGTTAGTAATGATTTTTGC) and reverse (GCCGGATCCTTAAGAAAGGTGTTTTACAAATTCAGC) primers. .. The PCR product and the pET22b (+) expression vector (Novagen) were cut with FastDigest NdeI and BamHI restriction enzymes (Fermentas) and mixed for ligation. .. The ligation mixture was transformed into E. coli XL10‐Gold Ultracompetent cells (Stratagene), from which enough plasmids were prepped to enable successful transformation of E. coli BL21 Gold (DE3) Competent cells (Novagen).

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Mammalian expression constructs for full-length membrane-bound human ADAM12 (ADAM12-L), human ADAM12 fused at its C-terminus to green fluorescent protein (ADAM12-GFP) and catalytically inactive (CI) ADAM12-GFP (E351Q mutation) were previously described , . .. ADAM12-myc -His was made by excision of ADAM12 cDNA from the pEGFP-N1 vector using XhoI and BamHI restriction enzymes and ligation into the corresponding pcDNA3.1/myc -His© B vector (Invitrogen). .. The leucine to phenylalanine (p.L972F ) mutation in ADAM12, ADAM12-myc and ADAM12-GFP were made by Mutagenex, Innovative Mutagenesis and Directed Evolution ( www.mutagenex.com ).

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Therefore, master plasmid Kgp-CepA was first obtained through PCR/restriction digestion methods. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. The correct placement and orientation of DNA segments in resulting plasmid Kgp-CepA were confirmed by sequencing.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: The recombinant expression vector pscEXP-GST was used as the mutagenesis template for creating single and C-terminal double mutants. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: PCR products were electrophoretically separated on 1.25% agarose gels and the appropriate sized band cut out and purified using the PerfectPrep Gel Cleanup kit (Eppendorf, Westbury, NY). .. Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. The putative NFκB binding site in the jagged-1 promoter was mutated from (mutated bases underlined) GGG AGTCCC to TCT AGTCCC, and the AP-1 site was mutated from T G TT TCA to T A TT AAC (lower strand sequence) using the QuickChange XL Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX).

    Article Title: Structure-based design of small peptide inhibitors of protein kinase CK2 subunit interaction
    Article Snippet: The pEYFPc1 vector was purchased from Clontech Laboratories. .. EcoRI and BamHI restriction enzymes were from Invitrogen, and SacI and AgeI were from New England Biolabs.

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Software:

    Article Title: TNF induction of jagged-1 in endothelial cells is NFκB-dependent
    Article Snippet: Purified PCR products were digested with KpnI and BamHI restriction enzymes (Invitrogen) and ligated into KpnI and BglII-digested pGL3enhancer Luciferase Reporter vector (Promega, Madison, WI). .. All ligation reactions were transformed into E. coli DH5α (Invitrogen), amplified and purified by MaxiPrep (Qiagen, Valencia, CA).

    Positron Emission Tomography:

    Article Title: Functional Expression of Recombinant Human Stefin A in Mammalian and Bacterial Cells
    Article Snippet: This is the first known report of the functional expression of recombinant human stefin A in mammalian cells. .. NcoI and BamHI restriction enzymes, Lipofectin, and Opti-MEMI were purchased from GIBCO-BRL (Grand Island, NY); primers for PCR from Operon (Alameda, CA); primers for DNA sequencing from Integrated DNA Technologies, Inc. (Coralville, IA); Sequenase version 2.0 DNA sequencing kit from United States Biochemistry Corp. (Cleveland, OH); [α-35 S]-dATP from DuPont NEN (Boston, MA); the E. coli pET expression system, plasmid pET-16b, from Novagen (Madison, WI); the Wizard DNA Clean-up system from Promega (Madison, WI). .. Plasmid pBR384 was a gift from Dr. Dunne Fong (Rutgers University, Piscataway, NJ).

    Agarose Gel Electrophoresis:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). .. To confirm the recombinant pTZ57R plasmid, the positive clones selected by colony PCR were subjected to plasmid extraction; the PCR reaction was also performed on the purified plasmid DNA with the same condition.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    CTG Assay:

    Article Title: DNA Methylation Mediates Persistent Epileptiform Activity In Vitro and In Vivo
    Article Snippet: Rat gria2 5’ region and promoter ( for physical map) were amplified from 5ng of rat genomic DNA by a PCR reaction using the following primers: Promoter region Forward - TTT GGA TCC GAA GCT AAA GTT CAc agt ttt ggg ag ; Reverse - TTT CCA TGG AAT TAG ATC CTC TGC ATT GTG AG ; Probe region (sense) Forward - TTT CTG CAG TTC AAG AGC AAT CCA CAG G ; Reverse - TTT GGA TCC CTA TGA TGC AAG CAT AAT TCC ; Probe region (antisense) Forward - TTT GGA TCC TTC AAG AGC AAT CCA CAG G ; Reverse - TTT CTG CAG CTA TGA TGC AAG CAT AAT TCC according to the following cycle: 5min at 95°C followed by 40 cycles of 35 sec at 95°C, 35 sec at 56°C and 70sec/40sec (respectively) at 72°C. .. PCR product containing the 5’ region and pCpGL-Basic plasmid (promoterless Luciferase reporter plasmid lacking any CpGs in its sequence), generously donated by Dr. Rehi’s lab, University hospital, Regensburg, Germany [ ]; were digested with PstI and BamHI restriction enzymes (Fermentas International, Canada) in 2xTango buffer, by incubation for 4 hours at 37°C.

    Marker:

    Article Title: IS5 Element Integration, a Novel Mechanism for Rapid In Vivo Emergence of Tigecycline Nonsusceptibility in Klebsiella pneumoniae
    Article Snippet: The kpgABC genes were PCR amplified from KP64 genomic DNA using primers kpgABC-HindIII-F (5′-TCAAAGCTTATGATTTATAAAGGCAACGACAAA-3′) and kpgABC-BamHI-R (5′ TAAGGATCCCTACTTCGTCCATTCTTTATGCA-3′). .. The resulting amplicon and pMQ300 plasmid ( ) were digested using HindIII and BamHI restriction enzymes (Thermo Fisher, Pittsburgh, PA) and ligated to create pMQ300- kpgABC with a selectable hph resistance marker. pMQ300- kpgABC was transformed into E. coli AG100 and AG100A Δ acrAB strains and selected on tryptic soy agar (TSA) plates containing 100 μg/ml hygromycin B. Colonies containing pMQ300- kpgABC were tested for tigecycline and colistin susceptibilities using Etest strips (bioMérieux, Durham, NC) in triplicate per the manufacturer's protocol. .. All other antibiotics were tested using the Vitek-2 antibiotic susceptibility testing platform (bioMérieux).

    Gel Extraction:

    Article Title: Relevant Double Mutations in Bioengineered Streptomyces clavuligerus Deacetoxycephalosporin C Synthase Result in Higher Binding Specificities Which Improve Penicillin Bioconversion
    Article Snippet: Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions. .. Recombinant vectors carrying V275I, C281Y, and the C-terminal single mutations (N304X, I305M, R306L, and R307L) were digested using the PfoI and BamHI restriction enzymes (Fermentas) according to manufacturer's instructions.

    Homologous Recombination:

    Article Title: Structural insights unravel the zymogenic mechanism of the virulence factor gingipain K from Porphyromonas gingivalis, a causative agent of gum disease from the human oral microbiome
    Article Snippet: Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid. .. Briefly, a 0.8-kb region upstream of the kgp gene, the CepA ampicillin resistance, the 2.8-kb fragment of the kgp gene, and the CepA ampicillin resistance cassette were amplified by PCR using Phusion polymerase (Thermo Fisher) and appropriate primers ( ); digested with SphI, HindIII, BglI, and BamHI restriction enzymes (Thermo Fisher); and cloned into the pUC19 plasmid.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Thermo Fisher restriction enzymes bamh i
    FAR/FADO gene copy number determination in the selected TDR transformant. a Hybridization probe used for the Southern blot analysis; FADO fatty aldehyde deformylating oxygenase; TrpC_T terminator region of TrpC ; Tef1_P promoter region of Tef1 ; FAR fatty acyl-ACP/CoA reductase; <t>BamHI,</t> NdeI, PstI restriction enzyme cut sites. b Southern blot analysis. Lane 1 contains 1 kb <t>DNA</t> ladder (size in base pairs); lanes 2–4 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the TDR transformant; lanes 5–7 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the parent strain
    Restriction Enzymes Bamh I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes bamh i/product/Thermo Fisher
    Average 83 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes bamh i - by Bioz Stars, 2019-12
    83/100 stars
      Buy from Supplier

    95
    Thermo Fisher bamhi restriction enzymes
    Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with <t>BamHI</t> ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, <t>Waltham,</t> MA, USA).
    Bamhi Restriction Enzymes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi restriction enzymes/product/Thermo Fisher
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bamhi restriction enzymes - by Bioz Stars, 2019-12
    95/100 stars
      Buy from Supplier

    Image Search Results


    FAR/FADO gene copy number determination in the selected TDR transformant. a Hybridization probe used for the Southern blot analysis; FADO fatty aldehyde deformylating oxygenase; TrpC_T terminator region of TrpC ; Tef1_P promoter region of Tef1 ; FAR fatty acyl-ACP/CoA reductase; BamHI, NdeI, PstI restriction enzyme cut sites. b Southern blot analysis. Lane 1 contains 1 kb DNA ladder (size in base pairs); lanes 2–4 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the TDR transformant; lanes 5–7 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the parent strain

    Journal: AMB Express

    Article Title: Alkane biosynthesis by Aspergillus carbonarius ITEM 5010 through heterologous expression of Synechococcus elongatus acyl-ACP/CoA reductase and aldehyde deformylating oxygenase genes

    doi: 10.1186/s13568-016-0321-x

    Figure Lengend Snippet: FAR/FADO gene copy number determination in the selected TDR transformant. a Hybridization probe used for the Southern blot analysis; FADO fatty aldehyde deformylating oxygenase; TrpC_T terminator region of TrpC ; Tef1_P promoter region of Tef1 ; FAR fatty acyl-ACP/CoA reductase; BamHI, NdeI, PstI restriction enzyme cut sites. b Southern blot analysis. Lane 1 contains 1 kb DNA ladder (size in base pairs); lanes 2–4 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the TDR transformant; lanes 5–7 shows the hybridization of the probe to the BamHI, PstI and NdeI digested gDNA of the parent strain

    Article Snippet: Genomic DNA of the transformants was extracted as described above and digested with restriction enzymes BamHI, PstI, and NdeI (all purchased from Thermo Scientific, Rockford, IL, USA).

    Techniques: Hybridization, Southern Blot

    Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).

    Journal: Jundishapur Journal of Microbiology

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance

    doi: 10.5812/jjm.29384

    Figure Lengend Snippet: Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).

    Article Snippet: The pTZ57R plasmid was extracted using a GeneJET™ Plasmid Miniprep Kit (Thermo Scientific, Waltham, MA, USA) and was digested using EcoRI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA).

    Techniques: Plasmid Preparation