avr ii r0174 new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    AvrII
    Description:
    AvrII 500 units
    Catalog Number:
    r0174l
    Price:
    285
    Size:
    500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs avr ii r0174 new england biolabs
    AvrII
    AvrII 500 units
    https://www.bioz.com/result/avr ii r0174 new england biolabs/product/New England Biolabs
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    avr ii r0174 new england biolabs - by Bioz Stars, 2020-01
    90/100 stars

    Related Products / Commonly Used Together

    in-fusion hd cloning kit
    bss hii
    vls
    vhs
    peu8.2 vh

    Images

    Related Articles

    Clone Assay:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: The fragment was cloned into the pCR2.1-TOPO vector by using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) and then sequenced by using primers M13 rev and M13 fwd ( ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: .. The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. ..

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. Transformants were screened on YPD plates (containing 2% agar and 100 μg/mL Zeocin) to isolate Zeocin-resistant clones.

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: .. To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation. .. This blunt ended fragment was then self-ligated using Quick ligase enzyme (New England Biolabs) to produce pBF2.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f). .. Non-transfected S2 cells (RIKEN BioResource Center, Tsukuba, Japan) were maintained at 27 °C in ExpressFive SFM (Life Technologies Japan, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS, Life Technologies Japan) and 1 × antibiotic antimycotic solution (Sigma-Aldrich Japan, Tokyo, Japan) (hereafter the medium were referred as FBS-supplemented medium).

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: An Eco RI-restricted MHV-68 genomic fragment (genomic coordinates 30798 to 38212) was cloned into pUC8. .. The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: TVTM inserts with cohesive ends were cloned into the CEE+ (ecotropic)-delta hinge envelope (Env) construct , designated CEEC, which was modified from CEE+ by substitution of an amphotropic proline-rich hinge region containing three unique restriction sites ( Avr II, Pst I, and Stu I) and an Ngo MI restriction site ( ). .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C.

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: The upstream primer contains a Kozak consensus sequence (underlined) to ensure proper initiation of translation when cloned. .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3.

    Amplification:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus Application of emm -PCR on the genomic DNA of S. anginosus strain SV52 produced a 1.1-kb amplicon, subsequently identified as a fragment of a m arker o f S. a nginosus and S. c onstellatus (moac ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: .. To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation. .. This blunt ended fragment was then self-ligated using Quick ligase enzyme (New England Biolabs) to produce pBF2.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: The amplicon was subcloned to pCoPGE digested by Avr II and Not I, pCoVKE digested by Avr II and Not I, and pCoPGKE digested by Avr II and Not I, and then pMAK85 (Fig. c), pMAK86 (Fig. d), and pMAK219 (Fig. e) were generated, respectively. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: Amplification of lccI and lccIa by using Pwo DNA polymerase was accomplished with the following protocol: (i) 94°C for 2 min (once) and 94°C for 15 s, (ii) 50°C for 30 s, (iii) 72°C for 2 min (10 cycles) and 94°C for 15 s, (iv) 50°C for 30 s, (v) 72°C for 3 min (20 cycles) and 72°C for 7 min (once). .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3.

    Binding Assay:

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. In the resulting escort constructs, a TVTM peptide flanked by glycine linkers replaced the entire receptor binding region of the MoMLV ecotropic Env surface (SU) protein, between the Bst EII site at the amino terminus and the Avr II site located proximal to the transmembrane (TM) domain.

    Synthesized:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant. .. The variant was assembled into digested pDONR221- NPAS3 transcript variant 1 using the Gibson Assembly Cloning Kit (NEB), and recombined into the pcI-HA destination vector.

    TA Cloning:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: The fragment was cloned into the pCR2.1-TOPO vector by using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) and then sequenced by using primers M13 rev and M13 fwd ( ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Construct:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: .. To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation. .. This blunt ended fragment was then self-ligated using Quick ligase enzyme (New England Biolabs) to produce pBF2.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. In the resulting escort constructs, a TVTM peptide flanked by glycine linkers replaced the entire receptor binding region of the MoMLV ecotropic Env surface (SU) protein, between the Bst EII site at the amino terminus and the Avr II site located proximal to the transmembrane (TM) domain.

    Electrophoresis:

    Article Title: Clonal Diversity of Chilean Isolates of Enterohemorrhagic Escherichia coli from Patients with Hemolytic-Uremic Syndrome, Asymptomatic Subjects, Animal Reservoirs, and Food Products
    Article Snippet: Genomic DNA for contour-clamped homogeneous electric field electrophoresis was prepared as previously described , with minor modifications. .. A 2-mm slice of an agarose plug in which EHEC genomic DNA was embedded was digested for 4 h with 20 U of Xba I (Gibco BRL) and 20 U of Sfi I (New England BioLabs) for all strains and with 20 U of Avr II (New England BioLabs) for some strains.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Incubation:

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. .. Briefly, BHK21 cells were infected with recombinant vaccinia virus, vTF7-3 expressing T7 RNA polymerase, at a multiplicity of infection of 10 and incubated for 1 h in serum-free DMEM containing 100 U of penicillin–streptomycin.

    Activity Assay:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase. ..

    Infection:

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. .. Briefly, BHK21 cells were infected with recombinant vaccinia virus, vTF7-3 expressing T7 RNA polymerase, at a multiplicity of infection of 10 and incubated for 1 h in serum-free DMEM containing 100 U of penicillin–streptomycin.

    Expressing:

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. .. Briefly, BHK21 cells were infected with recombinant vaccinia virus, vTF7-3 expressing T7 RNA polymerase, at a multiplicity of infection of 10 and incubated for 1 h in serum-free DMEM containing 100 U of penicillin–streptomycin.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: An expression unit for human F7 driven by PMT and poly A signal (pA) was taken from MAK80 by a PCR using two primers: MAK80F-LIC; 5′-GGTAATACGG CCTAGG CTGCAAGGCGATTAAGTTGGGTAACGCCAG (The underlined part; Avr II recognition site) and MAK80R-LIC; 5′-GCGCGCCTT GCGGCCGC CGCAGCGAGTCAGTGAGCGAGGAAG (The underlined part; Not I recognition site). .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: Cointegrant resolution was selected by growth in chloramphenicol-5% sucrose at 30°C; under these conditions, the induced expression of SacB is lethal to E. coli . .. The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: Paragraph title: Construction of vectors for expression of lccI and lccIa by P. pastoris. ... Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3.

    Modification:

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This modified genomic fragment was then excised with Eco RI, blunted with T4 DNA polymerase, and subcloned into Sma I-cut pST76K-SR.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: TVTM inserts with cohesive ends were cloned into the CEE+ (ecotropic)-delta hinge envelope (Env) construct , designated CEEC, which was modified from CEE+ by substitution of an amphotropic proline-rich hinge region containing three unique restriction sites ( Avr II, Pst I, and Stu I) and an Ngo MI restriction site ( ). .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C.

    Transformation Assay:

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: .. Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. Transformants were screened on YPD plates (containing 2% agar and 100 μg/mL Zeocin) to isolate Zeocin-resistant clones.

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. After ligation, the various constructs of plasmid DNA were transformed into XL1 Blue strain of Escherichia coli and grown on Luria-Bertani agar plates under ampicillin selection.

    Electroporation:

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: .. Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. Transformants were screened on YPD plates (containing 2% agar and 100 μg/mL Zeocin) to isolate Zeocin-resistant clones.

    Inverse PCR:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Paragraph title: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus ... Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Southern Blot:

    Article Title: Clonal Diversity of Chilean Isolates of Enterohemorrhagic Escherichia coli from Patients with Hemolytic-Uremic Syndrome, Asymptomatic Subjects, Animal Reservoirs, and Food Products
    Article Snippet: A 2-mm slice of an agarose plug in which EHEC genomic DNA was embedded was digested for 4 h with 20 U of Xba I (Gibco BRL) and 20 U of Sfi I (New England BioLabs) for all strains and with 20 U of Avr II (New England BioLabs) for some strains. .. Southern blot hybridizations from Sfi I-digested chromosomal DNAs of O157 isolates resolved by PFGE were performed as described by Sambrook et al. ( ) by using a biotinylated CVD434 probe containing the central region of the eae gene.

    Article Title: Large family cohorts of lymphoblastoid cells provide a new cellular model for investigating facioscapulohumeral muscular dystrophy
    Article Snippet: Genomic Southern blotting to identify subjects possessing 4q35 deletions was performed as described [ ], and following personal communication with Dr. Yukiko Hayashi. .. Briefly, 7.5 µg of LCL genomic DNA was digested overnight with either Eco RI or both Eco RI and Avr II (New England Bioloabs), electrophoresed through a 0.3% agarose TAE gel for 36 h at 12 mAmps, denatured, and transferred to a nylon membrane.

    Ligation:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: XI sites, allowing for directional assembly into a full-length replicon cDNA by in vitro ligation ( Serial deletions within the TGEV structural gene region were generated from the unique Pfl MI site at the very 3′ end of the GFP gene and extended for various distances toward the 3′ end of the genome (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: .. The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. ..

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: .. To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation. .. This blunt ended fragment was then self-ligated using Quick ligase enzyme (New England Biolabs) to produce pBF2.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. In the resulting escort constructs, a TVTM peptide flanked by glycine linkers replaced the entire receptor binding region of the MoMLV ecotropic Env surface (SU) protein, between the Bst EII site at the amino terminus and the Avr II site located proximal to the transmembrane (TM) domain.

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3. .. Ligase (1.0 μl of T4 DNA ligase from Boehringer Mannheim) and 2 μl of 10× ligation buffer (supplied with enzyme, consisting of 660 mM Tris-HCl [pH 7.5], 50 mM MgCl2 , 10 mM dithioerythritol, and 10 mM ATP) were added to the ligation mixture.

    Introduce:

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: The gB gene was PCR-amplified from the pCMV-int-BL-gB clone (a gift from D Spector, University of California, San Diego) by using VentR polymerase (New England Biolabs, Ipswich, MA), the upstream primer 5’GAT CGC CCT AGG AAA ATG TCA AGA AGA AAC GAA AGA GG3’, and the downstream primer 5’G CC TAG G TC AGT ACT CGA AAT CGG AGT C3’ to introduce Avr II endonuclease restriction sites (underlined) at both ends of the target fragment to allow cloning into the full-length VSV plasmid pVSVXN2. .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV.

    Generated:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase. ..

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: The amplicon was subcloned to pCoPGE digested by Avr II and Not I, pCoVKE digested by Avr II and Not I, and pCoPGKE digested by Avr II and Not I, and then pMAK85 (Fig. c), pMAK86 (Fig. d), and pMAK219 (Fig. e) were generated, respectively. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant. .. The variant was assembled into digested pDONR221- NPAS3 transcript variant 1 using the Gibson Assembly Cloning Kit (NEB), and recombined into the pcI-HA destination vector.

    DNA Sequencing:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Clones were identified by DNA sequencing using an ABI model 377 automated sequencer, and the resulting construct, TGEV pFiGFP2( Pfl MI), was subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Polymerase Chain Reaction:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus Application of emm -PCR on the genomic DNA of S. anginosus strain SV52 produced a 1.1-kb amplicon, subsequently identified as a fragment of a m arker o f S. a nginosus and S. c onstellatus (moac ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: .. The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. ..

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: .. To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation. .. This blunt ended fragment was then self-ligated using Quick ligase enzyme (New England Biolabs) to produce pBF2.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: For an overlapped and extension PCR, an additional fragment was taken from pMAK80 by a PCR using the following primers: MAK80F-LIC and MAK132OLR; 5′-GGCCTGGGAGACCATATTGAGATCGGATCCCCCCTTTAG. .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3. .. Ligase (1.0 μl of T4 DNA ligase from Boehringer Mannheim) and 2 μl of 10× ligation buffer (supplied with enzyme, consisting of 660 mM Tris-HCl [pH 7.5], 50 mM MgCl2 , 10 mM dithioerythritol, and 10 mM ATP) were added to the ligation mixture.

    Recombinant:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: Paragraph title: Recombinant DNA manipulations of TGEV F subclone. ... TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: Paragraph title: Plasmid construction and recovery of recombinant virus. ... The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV.

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: .. Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. Transformants were screened on YPD plates (containing 2% agar and 100 μg/mL Zeocin) to isolate Zeocin-resistant clones.

    Pulsed-Field Gel:

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Molecular Cloning:

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: Paragraph title: Molecular cloning of MoMLV-based escort proteins displaying TVTMs. ... The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C.

    Mutagenesis:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: Paragraph title: Viral mutagenesis. ... The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs).

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant.

    Isolation:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: The mammalian codon-optimized version of the GFP gene was isolated from the noncytopathic Sindbis virus vector pSINrep19/GFP (kindly provided by Charlie Rice, Columbia University) and was inserted with a 5′ 20-nt N gene IS using the Cla I/ Pfl MI cloning site by standard recombinant DNA techniques (Fig. ) ( ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Purification:

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. In the resulting escort constructs, a TVTM peptide flanked by glycine linkers replaced the entire receptor binding region of the MoMLV ecotropic Env surface (SU) protein, between the Bst EII site at the amino terminus and the Avr II site located proximal to the transmembrane (TM) domain.

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3. .. Ligase (1.0 μl of T4 DNA ligase from Boehringer Mannheim) and 2 μl of 10× ligation buffer (supplied with enzyme, consisting of 660 mM Tris-HCl [pH 7.5], 50 mM MgCl2 , 10 mM dithioerythritol, and 10 mM ATP) were added to the ligation mixture.

    Sequencing:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Paragraph title: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus ... Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: The SV40 LgT sequence was PCR-amplified from the pSP189 SV40 shuttle vector ( ) by using 5′-ATATCCTAGGCTTTTGCAAAAAGCTCGATTCTGGTAAATATAAAATTTTTAAGTGTATAATGTGTT AAACTAC-3′ as a forward primer, 5′-ATATGTCGACCAGACATGATAAGATACATTGATGAGTTTGGACA-3′ as a reverse primer, and Pfu Turbo Cx Hotstart DNA polymerase (Stratagene, La Jolla, CA) according to the manufacturer’s recommendation. .. The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain.

    Article Title: Successful synthesis of active human coagulation factor VII by co-expression of mammalian gamma-glutamyl carboxylase and modification of vit.K cycle in Drosophila Schneider S2 cells
    Article Snippet: In order to replace BiP secretion signal in pMAK86 to native F7 signal, a fragment containing F7 signal sequence was taken from the cDNA clone (MGC:163340, IMAGE:40146499) by PCR using the following primers: MAK132F; 5′- ATG GTCTCCCAGGCCCTCAGGC (The underlined part; the initial codon), and MAK132R; 5′-GGCACCGACAGG AGCGCT TGG (The underlined part; Afe I recognition site). .. These amplicons were subcloned to pMAK86 digested by Avr II and Afe I (NEB Japan) using In-Fusion® HD Cloning Kit (TAKARA BIO) (pMAK132, Fig. f).

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: It is important to note that the upstream primer used to insert lccI into pPIC9K contains only a restriction site for Eco RI since the Kozak consensus sequence is present in the α-secretion signal. lccIa was not inserted into pPIC9K. .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3.

    Blocking Assay:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant. .. The variant was assembled into digested pDONR221- NPAS3 transcript variant 1 using the Gibson Assembly Cloning Kit (NEB), and recombined into the pcI-HA destination vector.

    Activated Clotting Time Assay:

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: The gB gene was PCR-amplified from the pCMV-int-BL-gB clone (a gift from D Spector, University of California, San Diego) by using VentR polymerase (New England Biolabs, Ipswich, MA), the upstream primer 5’GAT CGC CCT AGG AAA ATG TCA AGA AGA AAC GAA AGA GG3’, and the downstream primer 5’G CC TAG G TC AGT ACT CGA AAT CGG AGT C3’ to introduce Avr II endonuclease restriction sites (underlined) at both ends of the target fragment to allow cloning into the full-length VSV plasmid pVSVXN2. .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV.

    Plasmid Preparation:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: The fragment was cloned into the pCR2.1-TOPO vector by using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) and then sequenced by using primers M13 rev and M13 fwd ( ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: The mammalian codon-optimized version of the GFP gene was isolated from the noncytopathic Sindbis virus vector pSINrep19/GFP (kindly provided by Charlie Rice, Columbia University) and was inserted with a 5′ 20-nt N gene IS using the Cla I/ Pfl MI cloning site by standard recombinant DNA techniques (Fig. ) ( ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Article Title: Identification, Selection, and Enrichment of Cardiomyocyte Precursors
    Article Snippet: .. Construction of Lentivectors with Cardiomyocyte-Specific Promoters The neoR cDNA was excised from the pDsRed-Monomer-C1 vector (Clontech, Mountain View, CA, USA) with Avr II (all restriction enzymes were purchased from NEB, Ipswich, MA, USA, and Fermentas, Hanover, MD, USA), treated with Klenow polymerase (NEB), and inserted into the Sma I site of pIRES2-EGFP (Clontech). .. This final vector was named pNeoR-IRES2-EGFP.

    Article Title: A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair
    Article Snippet: .. The PCR product and the pGL4.50 plasmid (Promega, Fitchburg, WI) were each double-digested by using Avr II and Sal I-HF, ligated by using Quick Ligation kit (New England BioLabs) according to the manufacturer’s recommendations, and cloned by using a standard procedure to transform E. coli DH5α strain. .. This generated a modified pGL4.50 plasmid (pGL(LgT-SV40ori)) in which the hygromycin-resistance gene under the control of an SV40 origin/promoter was replaced by the LgT gene.

    Article Title: Intranasal Immunization with Recombinant Vesicular Stomatitis Virus Expressing Murine Cytomegalovirus Glycoprotein B Induces Humoral and Cellular Immunity
    Article Snippet: .. The gB gene PCR product and full-length VSV plasmid were cleaved with Avr II and Nhe I (New England Biolabs, Ipswich, MA), respectively, before ligation of the gB gene into the Nhe I cloning site located between the genes encoding the G and L proteins of VSV. ..

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: .. Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. Transformants were screened on YPD plates (containing 2% agar and 100 μg/mL Zeocin) to isolate Zeocin-resistant clones.

    Article Title: A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1
    Article Snippet: Paragraph title: Plasmid constructions ... To generate pEY25 the ϕBT1 int gene was deleted and the ϕC31 int gene was placed under the control of the tcp830 promoter. pMS98 was constructed by PCR amplification of SV1 g27/attP locus using primers MS409 (5′ GCTTCATATGAAACGAGACCTACCAAG) and MS410 (5′CGTTAGATCTTCGCGCTCCGATGTGGTC) and In-Fusion® cloning into pEY25 cut with NdeI and BglII to replace the ϕC31 int gene. pBF1 was constructed in the same way but using primers PBF1for (5′ AAGGAGATATACATATGAAACGAGACCTACCAAGC- 3′) and PBF1rev (5′ CCATGAGCCAAGATCTTCGCGCTCCGATGTGGTCC- 3′). pBF3 was constructed as follows to remove unnecessary elements of pBF1: pBF1 was first cut with Avr II, and Acc 65I, and the ends filled in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs) to generate blunt ends for ligation.

    Article Title: The Highly Virulent 2006 Norwegian EHEC O103:H25 Outbreak Strain Is Related to the 2011 German O104:H4 Outbreak Strain
    Article Snippet: .. Pulsed-Field Gel Electrophoresis (PFGE) and plasmid isolation The E. coli isolates associated with the outbreak were analyzed by PFGE as described previously using the restriction enzymes Xba I and Avr II (New England BioLabs). .. DNA for detection of colicin E2 encoding plasmids were isolated by Qiagen plasmid purification kit (Qiagen, Hilden, Germany), and separated by electrophoresis in 2% agarose gels.

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant.

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: .. The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. In the resulting escort constructs, a TVTM peptide flanked by glycine linkers replaced the entire receptor binding region of the MoMLV ecotropic Env surface (SU) protein, between the Bst EII site at the amino terminus and the Avr II site located proximal to the transmembrane (TM) domain.

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3. .. Ligase (1.0 μl of T4 DNA ligase from Boehringer Mannheim) and 2 μl of 10× ligation buffer (supplied with enzyme, consisting of 660 mM Tris-HCl [pH 7.5], 50 mM MgCl2 , 10 mM dithioerythritol, and 10 mM ATP) were added to the ligation mixture.

    Negative Control:

    Article Title: Optimal Production and Biochemical Properties of a Lipase from Candida albicans
    Article Snippet: Screening Recombinant P. pastoris with High Yield of CaLIP10 The plasmid pGAPZαA-lip10 and pGAPZαA-lip10 -dm were linearized with Avr II (NEB, USA) and transformed into P. pastoris X33 by electroporation using Gene Pulser (Bio-Rad) apparatus. .. P. pastoris transformed with pGAPZαA was used as a negative control.

    Selection:

    Article Title: Incorporation of Tumor Vasculature Targeting Motifs into Moloney Murine Leukemia Virus Env Escort Proteins Enhances Retrovirus Binding and Transduction of Human Endothelial Cells
    Article Snippet: The MoMLV-based Env construct was cut with Bst EII and Avr II, and the linearized env plasmid was verified by restriction analysis on agarose gels and purified by the Gene Clean method (Bio 101, Vista, Calif.) prior to ligation with the respective TVTM insert and T4 DNA ligase (New England Biolabs, Beverly, Mass.) for either 3 h at room temperature (RT) or overnight at 4°C. .. After ligation, the various constructs of plasmid DNA were transformed into XL1 Blue strain of Escherichia coli and grown on Luria-Bertani agar plates under ampicillin selection.

    Agarose Gel Electrophoresis:

    Article Title: Clonal Diversity of Chilean Isolates of Enterohemorrhagic Escherichia coli from Patients with Hemolytic-Uremic Syndrome, Asymptomatic Subjects, Animal Reservoirs, and Food Products
    Article Snippet: A 2-mm slice of an agarose plug in which EHEC genomic DNA was embedded was digested for 4 h with 20 U of Xba I (Gibco BRL) and 20 U of Sfi I (New England BioLabs) for all strains and with 20 U of Avr II (New England BioLabs) for some strains. .. Restriction fragments of DNA were separated on a 1.5% agarose gel by PFGE with a CHEF-DR III apparatus (Bio-Rad Laboratories).

    Article Title: Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
    Article Snippet: The products of PCR were purified from an 0.8% agarose gel and hydrolyzed with Eco RI and Avr II. .. Ligation of gene and vector was achieved by mixing purified PCR products with pPIC3.5K or pPIC9K vectors previously digested with Eco RI and Avr II (New England Biolabs) in a molar ratio of 1:3.

    In Vitro:

    Article Title: Heterologous Gene Expression from Transmissible Gastroenteritis Virus Replicon Particles
    Article Snippet: XI sites, allowing for directional assembly into a full-length replicon cDNA by in vitro ligation ( Serial deletions within the TGEV structural gene region were generated from the unique Pfl MI site at the very 3′ end of the GFP gene and extended for various distances toward the 3′ end of the genome (Fig. ). .. TGEV pFiGFP2( Pfl MI) was digested with Pfl MI and Avr II or Eco NI, treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions) (New England BioLabs), and religated using T4 DNA ligase.

    Produced:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus Application of emm -PCR on the genomic DNA of S. anginosus strain SV52 produced a 1.1-kb amplicon, subsequently identified as a fragment of a m arker o f S. a nginosus and S. c onstellatus (moac ). .. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    BAC Assay:

    Article Title: Murine Gammaherpesvirus 68 Lacking Thymidine Kinase Shows Severe Attenuation of Lytic Cycle Replication In Vivo but Still Establishes Latency
    Article Snippet: The central portion (33293 to 34300) of the TK open reading frame (ORF) (32879 to 34813) was excised by digestion with Avr II and Pme I, blunting with T4 DNA polymerase (New England Biolabs, Hitchin, United Kingdom), and religation with T4 DNA ligase (New England Biolabs). .. This plasmid was transformed into E. coli DH10B containing the WT MHV-68 BAC.

    Marker:

    Article Title: Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India
    Article Snippet: Paragraph title: Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus ... Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: Ase I, Avr II, Bam HI, Bgl II, Bsa I, Bse YI, Eco RI, Hind III, Nde I, Nsi I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I (New England Biolabs, Ipswich, MA, USA).

    Article Title: Clonal Diversity of Chilean Isolates of Enterohemorrhagic Escherichia coli from Patients with Hemolytic-Uremic Syndrome, Asymptomatic Subjects, Animal Reservoirs, and Food Products
    Article Snippet: A 2-mm slice of an agarose plug in which EHEC genomic DNA was embedded was digested for 4 h with 20 U of Xba I (Gibco BRL) and 20 U of Sfi I (New England BioLabs) for all strains and with 20 U of Avr II (New England BioLabs) for some strains. .. A lambda ladder (New England BioLabs) was used as a molecular size marker.

    Variant Assay:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: .. The c.910G > A (p.Val304Ile) variant was generated using a synthesized 504 bp gene block (IDT DNA) between the Avr II and Xho I (both NEB) sites in the NPAS3 clone, containing the indicated variant. .. The variant was assembled into digested pDONR221- NPAS3 transcript variant 1 using the Gibson Assembly Cloning Kit (NEB), and recombined into the pcI-HA destination vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs avr ii
    Avr Ii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/avr ii/product/New England Biolabs
    Average 90 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    avr ii - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results