Structured Review

Promega avian myeloblastosis virus
Avian Myeloblastosis Virus, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/avian myeloblastosis virus/product/Promega
Average 99 stars, based on 21 article reviews
Price from $9.99 to $1999.99
avian myeloblastosis virus - by Bioz Stars, 2020-08
99/100 stars

Images

Related Articles

Reverse Transcription Polymerase Chain Reaction:

Article Title: The Cell Adhesion Molecule M-Cadherin Is Not Essential for Muscle Development and Regeneration
Article Snippet: .. Each cDNA for RT-PCR analysis was synthesized from 2 μg of total RNA (avian myeloblastosis virus reverse transcriptase; Promega) in a 25-μl reaction volume; 2.5 μl of the 1:4 diluted cDNA was then used as the template for PCR in a 25-μl reaction volume, including 25 pmol of each primer, 1× Taq buffer, 200 nM deoxynucleoside triphosphates, and 1.25 U of Taq polymerase (Takara Biomedicals). .. PCR products were analyzed on 2% agarose gels.

Polymerase Chain Reaction:

Article Title: The Cell Adhesion Molecule M-Cadherin Is Not Essential for Muscle Development and Regeneration
Article Snippet: .. Each cDNA for RT-PCR analysis was synthesized from 2 μg of total RNA (avian myeloblastosis virus reverse transcriptase; Promega) in a 25-μl reaction volume; 2.5 μl of the 1:4 diluted cDNA was then used as the template for PCR in a 25-μl reaction volume, including 25 pmol of each primer, 1× Taq buffer, 200 nM deoxynucleoside triphosphates, and 1.25 U of Taq polymerase (Takara Biomedicals). .. PCR products were analyzed on 2% agarose gels.

Generated:

Article Title: The Arginine Clusters of the Carboxy-Terminal Domain of the Core Protein of Hepatitis B Virus Make Pleiotropic Contributions to Genome Replication ▿
Article Snippet: .. For simultaneous detection of RNA and DNA by primer extension (as shown in Fig. and ) a cDNA of pgRNA was generated using AMV reverse transcriptase (Promega) and an unlabeled primer. .. Subsequently, the sample was incubated 2 h at 37°C with RNase A, precipitated with ethanol, and rehydrated.

Purification:

Article Title: MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase
Article Snippet: .. Primer extension was carried out on 5 µg of total yeast RNA with 100 000 c.p.m. purified (QIAquick Nucleotide Removal Kit; Qiagen) end-labelled oligonucleotides o21S1 (CGTATTTAACCCAACTCACGTAACA) or o21S2 (ATGGACTTATTCAGATACTTTTGCT) in buffer for AMV reverse transcriptase supplied by the manufacturer (Promega). ..

Synthesized:

Article Title: The Cell Adhesion Molecule M-Cadherin Is Not Essential for Muscle Development and Regeneration
Article Snippet: .. Each cDNA for RT-PCR analysis was synthesized from 2 μg of total RNA (avian myeloblastosis virus reverse transcriptase; Promega) in a 25-μl reaction volume; 2.5 μl of the 1:4 diluted cDNA was then used as the template for PCR in a 25-μl reaction volume, including 25 pmol of each primer, 1× Taq buffer, 200 nM deoxynucleoside triphosphates, and 1.25 U of Taq polymerase (Takara Biomedicals). .. PCR products were analyzed on 2% agarose gels.

Article Title: Identification of the Hair Cell Soma-1 Antigen, HCS-1, as Otoferlin
Article Snippet: .. Randomly primed first-strand cDNA was synthesized from 1 μg of total RNA using AMV reverse transcriptase (Promega, Southampton, UK) and the reaction diluted to 100 μl final volume. .. Otoferlin and GAPDH PCR products were amplified from 2 μl aliquots of the reverse transcriptase (RT) reactions using Bioline Taq polymerase (Bioline, UK) and primers GgOtofF3 and GgOtofR2 (see above) and GAPDHF1 (GCTGAGTATGTTGTGGAGTC) and GAPDHR1 (TCAGCAGCAGCCTTCACTAC).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega amv rt
    Controlling the extent of pausing by <t>AMV-RT</t> at a 7-EAA site. (A) Sequences of strands employed in primer extension assay, with N indicating the site of the variable nucleotide. (B) Primer extension results for reactions containing 10 μM <t>dNTPs</t> at 42 °C for 45 min. Lanes are labeled as follows for N: −, labeled primer only, no extension; A, adenosine; 7, 7-EAA; B, biotin triazole; and B + S, biotin triazole + monomeric streptavidin. (C) Primer extension results for reactions containing 1 μM dNTPs at 37 °C for 5 min; lanes are labeled the same as in panel B, and the arrow indicates a pause site. (D) Quantification of inhibition of primer extension under the conditions used in panel C; the average for at least three independent primer extension reactions ± standard deviation is plotted.
    Amv Rt, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 702 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amv rt/product/Promega
    Average 99 stars, based on 702 article reviews
    Price from $9.99 to $1999.99
    amv rt - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Controlling the extent of pausing by AMV-RT at a 7-EAA site. (A) Sequences of strands employed in primer extension assay, with N indicating the site of the variable nucleotide. (B) Primer extension results for reactions containing 10 μM dNTPs at 42 °C for 45 min. Lanes are labeled as follows for N: −, labeled primer only, no extension; A, adenosine; 7, 7-EAA; B, biotin triazole; and B + S, biotin triazole + monomeric streptavidin. (C) Primer extension results for reactions containing 1 μM dNTPs at 37 °C for 5 min; lanes are labeled the same as in panel B, and the arrow indicates a pause site. (D) Quantification of inhibition of primer extension under the conditions used in panel C; the average for at least three independent primer extension reactions ± standard deviation is plotted.

    Journal: ACS Chemical Biology

    Article Title: Click Modification of RNA at Adenosine: Structure and Reactivity of 7-Ethynyl- and 7-Triazolyl-8-aza-7-deazaadenosine in RNA

    doi: 10.1021/cb500270x

    Figure Lengend Snippet: Controlling the extent of pausing by AMV-RT at a 7-EAA site. (A) Sequences of strands employed in primer extension assay, with N indicating the site of the variable nucleotide. (B) Primer extension results for reactions containing 10 μM dNTPs at 42 °C for 45 min. Lanes are labeled as follows for N: −, labeled primer only, no extension; A, adenosine; 7, 7-EAA; B, biotin triazole; and B + S, biotin triazole + monomeric streptavidin. (C) Primer extension results for reactions containing 1 μM dNTPs at 37 °C for 5 min; lanes are labeled the same as in panel B, and the arrow indicates a pause site. (D) Quantification of inhibition of primer extension under the conditions used in panel C; the average for at least three independent primer extension reactions ± standard deviation is plotted.

    Article Snippet: Samples were then mixed with AMV-RT and dNTP mix so that the final concentrations were as follows: 20 nM RNA, ∼80 nM 32 P-labeled GluR B pre-mRNA 18 nt primer, 10 μM dNTPs, 1× Promega AMV-RT buffer, and 5 units of AMV-RT for the standard extension conditions protocol and 20 nM RNA, ∼80 nM 32 P-labeled GluR B pre-mRNA 18 nt primer, 1 μM dNTPs, 1× Promega AMV-RT buffer, and 5 units of AMV-RT for the low [dNTP] conditions protocol.

    Techniques: Primer Extension Assay, Labeling, Inhibition, Standard Deviation

    Utilization of dGDP as substrate by the AMV RT and T4 DNA polymerase Sequences of the DNA/RNA or DNA/DNA hybrid substrates are shown above the gels. The templates of the substrates specify incorporation for a dA and a dG residue. The enzymes were assayed with 0.165 μM 32 P‐dATP (asterisk) and either dGMP, dGDP, or dGTP at 100 μM.

    Journal: The EMBO Journal

    Article Title: A single nucleotide incorporation step limits human telomerase repeat addition activity

    doi: 10.15252/embj.201797953

    Figure Lengend Snippet: Utilization of dGDP as substrate by the AMV RT and T4 DNA polymerase Sequences of the DNA/RNA or DNA/DNA hybrid substrates are shown above the gels. The templates of the substrates specify incorporation for a dA and a dG residue. The enzymes were assayed with 0.165 μM 32 P‐dATP (asterisk) and either dGMP, dGDP, or dGTP at 100 μM.

    Article Snippet: One microliter of RRL reconstituted telomerase enzyme, 1 unit of AMV RT (Promega), 0.5 units of Taq DNA pol III (NEB), 1 unit of T4 DNA pol (Fermentas), or 0.5 units of Klenow fragment of DNA pol I (Invitrogen) were assayed in 10 μl reactions containing 1× telomerase reaction buffer, 40 μM of denoted pre‐annealed DNA/RNA or DNA/DNA hybrid substrates, 100 μM dGTP, dGDP, or dGMP, and 0.165 μM α‐32 P‐dATP.

    Techniques:

    Encapsidation of pgRNA. Primer extension using oligo 1948− extended with avian myeloblastosis virus (AMV) reverse transcriptase (RT) was used to measure the level of 5′ ends of encapsidated and reference RNAs. (A and B) Representative gels used to measure the encapsidation efficiency of total and encapsidated pgRNA, respectively. In each gel, the positions of the pgRNA and reference RNA (ref. RNA) are indicated. A sequencing ladder is provided for reference. (C) Histogram of the efficiency of encapsidation of the 5′ end of pgRNA, with standard deviations of normalized values represented by error bars. (D) Formula used to calculate encapsidation. An asterisk (*) indicates a significant difference from the WT reference ( P

    Journal: Journal of Virology

    Article Title: The Arginine Clusters of the Carboxy-Terminal Domain of the Core Protein of Hepatitis B Virus Make Pleiotropic Contributions to Genome Replication ▿

    doi: 10.1128/JVI.01957-10

    Figure Lengend Snippet: Encapsidation of pgRNA. Primer extension using oligo 1948− extended with avian myeloblastosis virus (AMV) reverse transcriptase (RT) was used to measure the level of 5′ ends of encapsidated and reference RNAs. (A and B) Representative gels used to measure the encapsidation efficiency of total and encapsidated pgRNA, respectively. In each gel, the positions of the pgRNA and reference RNA (ref. RNA) are indicated. A sequencing ladder is provided for reference. (C) Histogram of the efficiency of encapsidation of the 5′ end of pgRNA, with standard deviations of normalized values represented by error bars. (D) Formula used to calculate encapsidation. An asterisk (*) indicates a significant difference from the WT reference ( P

    Article Snippet: For simultaneous detection of RNA and DNA by primer extension (as shown in Fig. and ) a cDNA of pgRNA was generated using AMV reverse transcriptase (Promega) and an unlabeled primer.

    Techniques: Sequencing

    Primer extension analysis of human brain RNA. Oligonucleotides GSP-6, PEXT1 and PEXT2 flanking the 5′ termini of the human LGA cDNA clone were 32 P end-labeled with [γ- 32 P]ATP and T4 polynucleotide kinase. Poly(A) + mRNA of human brain (approx. 0.5–1 µg) was mixed with the radioactive oligonucleotides and reverse-transcribed with avian myeloblastosis virus reverse transcriptase; the products from primer extension reactions were separated by electrophoresis on an 8% (w/v) denaturing polyacrylamide gel. Lanes are labeled with the name of the specific primer used in each case. The size of the single-stranded cDNA products (in bases) was estimated approximately by comparison with ФX174 HinfI DNA markers shown at the left in lane M. C+ lane: product amplified with a positive control of kanamycin. C- lanes: negative controls using PEXT2 with mRNA omitted. The black arrow indicates the specific GA products of approx. 140 bases obtained by reverse transcription with primer PEXT2. Top panel: scheme showing the approximate position of the three primers with regard to the TSS (+1) and the two first ATG codons of human LGA transcript.

    Journal: PLoS ONE

    Article Title: Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    doi: 10.1371/journal.pone.0038380

    Figure Lengend Snippet: Primer extension analysis of human brain RNA. Oligonucleotides GSP-6, PEXT1 and PEXT2 flanking the 5′ termini of the human LGA cDNA clone were 32 P end-labeled with [γ- 32 P]ATP and T4 polynucleotide kinase. Poly(A) + mRNA of human brain (approx. 0.5–1 µg) was mixed with the radioactive oligonucleotides and reverse-transcribed with avian myeloblastosis virus reverse transcriptase; the products from primer extension reactions were separated by electrophoresis on an 8% (w/v) denaturing polyacrylamide gel. Lanes are labeled with the name of the specific primer used in each case. The size of the single-stranded cDNA products (in bases) was estimated approximately by comparison with ФX174 HinfI DNA markers shown at the left in lane M. C+ lane: product amplified with a positive control of kanamycin. C- lanes: negative controls using PEXT2 with mRNA omitted. The black arrow indicates the specific GA products of approx. 140 bases obtained by reverse transcription with primer PEXT2. Top panel: scheme showing the approximate position of the three primers with regard to the TSS (+1) and the two first ATG codons of human LGA transcript.

    Article Snippet: 0.5–1 µg) was mixed with the radioactive oligonucleotides and reverse transcribed with avian myeloblastosis virus reverse transcriptase, with the use of the protocol provided by the manufacturer (Primer Extension Analysis kit; Promega).

    Techniques: Labeling, Electrophoresis, Amplification, Positive Control