Structured Review

Cell Signaling Technology Inc anti sp1
Schematic model of BMX regulates VEGFR2 transcription by interaction with <t>Sp1.</t> The SH2/SH3 domain of BMX confers its nuclear localization in ECs. Nuclear BMX in an active form interacts with (and possibly phosphorylates) Sp1 to facilitate the recruitment of Sp1 to the VEGFR2 promoter and its transcription in ECs
Anti Sp1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti sp1/product/Cell Signaling Technology Inc
Average 99 stars, based on 22 article reviews
Price from $9.99 to $1999.99
anti sp1 - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression"

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/jcmm.14663

Schematic model of BMX regulates VEGFR2 transcription by interaction with Sp1. The SH2/SH3 domain of BMX confers its nuclear localization in ECs. Nuclear BMX in an active form interacts with (and possibly phosphorylates) Sp1 to facilitate the recruitment of Sp1 to the VEGFR2 promoter and its transcription in ECs
Figure Legend Snippet: Schematic model of BMX regulates VEGFR2 transcription by interaction with Sp1. The SH2/SH3 domain of BMX confers its nuclear localization in ECs. Nuclear BMX in an active form interacts with (and possibly phosphorylates) Sp1 to facilitate the recruitment of Sp1 to the VEGFR2 promoter and its transcription in ECs

Techniques Used:

Active BMX interacts with Sp1 in the nucleus and facilitates Sp1 binding to the Vegfr2 promoter. A, Schematic diagram for the Sp1 binding sites located on the Vegfr2 promoter. −123 to −46 are positions related to the transcription start site (TSS; +1). B, BMX promotes Sp1 binding to the Vegfr2 promoter. HDLECs were transfected with human BMX siRNA or control siRNA (20 nmol/L) for 48 h. ChIP assay was then performed with Sp1 antibody. An Sp1 binding region of the Vegfr2 promoter was used as a primer for quantitative PCR. C, HUVECs were cotransfected with a Vegfr2 reporter (−123 to +1), Renilla luciferase plasmid and either vector control (Vector), BMX‐WT or kinase‐dead K445R‐BMX alone or together with Sp1 for 48 h. The dual‐luciferase assay was then performed. The firefly luciferase readout was normalized to that of Renilla luciferase. The data are means ± SEM from three independent experiments. **, P
Figure Legend Snippet: Active BMX interacts with Sp1 in the nucleus and facilitates Sp1 binding to the Vegfr2 promoter. A, Schematic diagram for the Sp1 binding sites located on the Vegfr2 promoter. −123 to −46 are positions related to the transcription start site (TSS; +1). B, BMX promotes Sp1 binding to the Vegfr2 promoter. HDLECs were transfected with human BMX siRNA or control siRNA (20 nmol/L) for 48 h. ChIP assay was then performed with Sp1 antibody. An Sp1 binding region of the Vegfr2 promoter was used as a primer for quantitative PCR. C, HUVECs were cotransfected with a Vegfr2 reporter (−123 to +1), Renilla luciferase plasmid and either vector control (Vector), BMX‐WT or kinase‐dead K445R‐BMX alone or together with Sp1 for 48 h. The dual‐luciferase assay was then performed. The firefly luciferase readout was normalized to that of Renilla luciferase. The data are means ± SEM from three independent experiments. **, P

Techniques Used: Binding Assay, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Luciferase, Plasmid Preparation

2) Product Images from "Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway"

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway

Journal: Viruses

doi: 10.3390/v11121141

Rep protein enhances the binding activities of p50 and Sp1 with the il10 promoter at the later phase of PCV2 infection. ( A – D ) PAMs were infected with 5 MOI PCV1, PCV2, PCV2-Rep1, and PCV1-Rep2, and the binding activities of p50 and Sp1 were detected at 12 h, 24 h, and 48 h using the ChIP assay ( A , B ); the relevant statistical results of ( A , B ) are shown in line graphs ( C , D ). The data of ( A , B ) are representative of three independent experiments. The data of ( C , D ) are the means ± SD of three independent experiments. ** p
Figure Legend Snippet: Rep protein enhances the binding activities of p50 and Sp1 with the il10 promoter at the later phase of PCV2 infection. ( A – D ) PAMs were infected with 5 MOI PCV1, PCV2, PCV2-Rep1, and PCV1-Rep2, and the binding activities of p50 and Sp1 were detected at 12 h, 24 h, and 48 h using the ChIP assay ( A , B ); the relevant statistical results of ( A , B ) are shown in line graphs ( C , D ). The data of ( A , B ) are representative of three independent experiments. The data of ( C , D ) are the means ± SD of three independent experiments. ** p

Techniques Used: Binding Assay, Infection, Chromatin Immunoprecipitation

PCV2 Rep activates p38-MAPK signaling to promote NF-κB p50 and Sp1 binding to the il10 promoter. ( A – C ) PAMs were infected with 100 MOI rAd-Rep1 (Rep1), rAd-Rep2 (Rep2), rAd-Blank (Blank), or Mock infection, and the binding levels of transcriptional factor NF-κB p50, Sp1, and AP1 to the il10 promoter were detected by the ChIP assay. ( D , E ) PAMs were transfected with the specific siRNAs of p50, p38-MAPK, or NC, and then infected with rAd-Rep2. The binding activities of p50 and Sp1 to the il10 promoter were detected by the ChIP assay. The data are the means ± SD of three independent experiments. * p
Figure Legend Snippet: PCV2 Rep activates p38-MAPK signaling to promote NF-κB p50 and Sp1 binding to the il10 promoter. ( A – C ) PAMs were infected with 100 MOI rAd-Rep1 (Rep1), rAd-Rep2 (Rep2), rAd-Blank (Blank), or Mock infection, and the binding levels of transcriptional factor NF-κB p50, Sp1, and AP1 to the il10 promoter were detected by the ChIP assay. ( D , E ) PAMs were transfected with the specific siRNAs of p50, p38-MAPK, or NC, and then infected with rAd-Rep2. The binding activities of p50 and Sp1 to the il10 promoter were detected by the ChIP assay. The data are the means ± SD of three independent experiments. * p

Techniques Used: Binding Assay, Infection, Chromatin Immunoprecipitation, Transfection

Rep protein interacts with thymine DNA glycosylase (TDG) to enhance the binding activities of Sp1 and NF-κB p50 with the il10 promoter at the later phase of PCV2 infection. ( A ) These specific siRNAs of c-Myc, ZNF265, TDG, and VG5Q were transfected to cells for 48 h, and the efficiency of each gene silencing was detected by western blotting. ( B ) The specific siRNAs of c-Myc, ZNF265, TDG, and VG5Q siRNAs (siRNA #1 of c-Myc, siRNA #2 of ZNF265, siRNA #3 of TDG, and siRNA #2 of VG5Q) were transfected to PAMs, then rAd-Blank or rAd-Rep2 infected the cells (1 × 10 6 cells) for 48 h. The secretion of IL-10 was measured by ELISA in different siRNA-transfected-PAMs. ( C ) The secretion of IL-10 was detected in the TDG siRNA-transfected-PAMs in 0–24 h, 24–48 h, and 48–72 h after PCV2 inoculation by ELISA. The columns indicate IL-10 production in each 24 h in the culture supernatants. ( D ) The levels of IL-10 mRNA were detected in TDG siRNA-transfected-PAMs by Q-PCR with the same incubation time points as C. ( E , F ) TDG siRNA-transfected-PAMs were incubated with 5 MOI PCV2, the binding activities of NF-κB p50 and Sp1 to the il10 promoter were detected at 48 h by the ChIP assay. The data of ( A ) are representative of three independent experiments. The data of ( B – D ) are means ± SEM of three independent experiments. The data of ( E , F ) are the means ± SD of three independent experiments. * p
Figure Legend Snippet: Rep protein interacts with thymine DNA glycosylase (TDG) to enhance the binding activities of Sp1 and NF-κB p50 with the il10 promoter at the later phase of PCV2 infection. ( A ) These specific siRNAs of c-Myc, ZNF265, TDG, and VG5Q were transfected to cells for 48 h, and the efficiency of each gene silencing was detected by western blotting. ( B ) The specific siRNAs of c-Myc, ZNF265, TDG, and VG5Q siRNAs (siRNA #1 of c-Myc, siRNA #2 of ZNF265, siRNA #3 of TDG, and siRNA #2 of VG5Q) were transfected to PAMs, then rAd-Blank or rAd-Rep2 infected the cells (1 × 10 6 cells) for 48 h. The secretion of IL-10 was measured by ELISA in different siRNA-transfected-PAMs. ( C ) The secretion of IL-10 was detected in the TDG siRNA-transfected-PAMs in 0–24 h, 24–48 h, and 48–72 h after PCV2 inoculation by ELISA. The columns indicate IL-10 production in each 24 h in the culture supernatants. ( D ) The levels of IL-10 mRNA were detected in TDG siRNA-transfected-PAMs by Q-PCR with the same incubation time points as C. ( E , F ) TDG siRNA-transfected-PAMs were incubated with 5 MOI PCV2, the binding activities of NF-κB p50 and Sp1 to the il10 promoter were detected at 48 h by the ChIP assay. The data of ( A ) are representative of three independent experiments. The data of ( B – D ) are means ± SEM of three independent experiments. The data of ( E , F ) are the means ± SD of three independent experiments. * p

Techniques Used: Binding Assay, Infection, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction, Incubation, Chromatin Immunoprecipitation

Related Articles

Negative Control:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation. .. 2.4 Cell transfection of siRNA and DNA A small interfering (si) RNA for human BMX (RefSeq Number NM_001721) with the sequences 5′ GUCCCACAUUUCAGCAACUTT 3′ (sense) and 5′ AGUUGCUGAAAUGUGGGACTT 3′ (antisense), as well as a negative control siRNA with the sequences 5′ UUCUCCGAACGUGUCACGUTT 3′ (sense) and 5′ ACGUGACACGUUCGGAGAATT 3′ (antisense), were purchased from Sangon Biotech and were transfected into cells (20 nmol/L) by Oligofectamine following the manufacturer's protocols (Invitrogen).

Amplification:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: The primers were 5′ GTCCAGTTGTGTGGGGAAAT 3′ (sense) and 5′ GAGCTGGAGCCGAAACTCTA 3′ (antisense), which amplified a 169‐bp region of the human Vegfr2 promoter containing Sp1 binding sites. .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation.

Radio Immunoprecipitation:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: Western Blotting The total protein of the cells was isolated in Radio-Immunoprecipitation Assay (RIPA) Buffer with Phenylmethanesulfonyl fluoride (PMSF), according to the manufacturer’s instructions (Thermo, Rockford, IL, USA). .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Positive Control:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation. .. 2.4 Cell transfection of siRNA and DNA A small interfering (si) RNA for human BMX (RefSeq Number NM_001721) with the sequences 5′ GUCCCACAUUUCAGCAACUTT 3′ (sense) and 5′ AGUUGCUGAAAUGUGGGACTT 3′ (antisense), as well as a negative control siRNA with the sequences 5′ UUCUCCGAACGUGUCACGUTT 3′ (sense) and 5′ ACGUGACACGUUCGGAGAATT 3′ (antisense), were purchased from Sangon Biotech and were transfected into cells (20 nmol/L) by Oligofectamine following the manufacturer's protocols (Invitrogen).

Isolation:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: Western Blotting The total protein of the cells was isolated in Radio-Immunoprecipitation Assay (RIPA) Buffer with Phenylmethanesulfonyl fluoride (PMSF), according to the manufacturer’s instructions (Thermo, Rockford, IL, USA). .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Blocking Assay:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: After blocking with 5% non-fat milk in Tris-Buffered Saline with Tween 20 (TBST) buffer for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight. .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Real-time Polymerase Chain Reaction:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: The amount of Vegfr2 gene immunoprecipitated was quantified by real‐time PCR. .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation.

Immunoprecipitation:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation. .. 2.4 Cell transfection of siRNA and DNA A small interfering (si) RNA for human BMX (RefSeq Number NM_001721) with the sequences 5′ GUCCCACAUUUCAGCAACUTT 3′ (sense) and 5′ AGUUGCUGAAAUGUGGGACTT 3′ (antisense), as well as a negative control siRNA with the sequences 5′ UUCUCCGAACGUGUCACGUTT 3′ (sense) and 5′ ACGUGACACGUUCGGAGAATT 3′ (antisense), were purchased from Sangon Biotech and were transfected into cells (20 nmol/L) by Oligofectamine following the manufacturer's protocols (Invitrogen).

Incubation:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: After blocking with 5% non-fat milk in Tris-Buffered Saline with Tween 20 (TBST) buffer for 1 h, the membranes were incubated with the following primary antibodies at 4 °C overnight. .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Polyacrylamide Gel Electrophoresis:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: Equivalent protein subjected to Sodium dodecyl sulfate -polyacrylamide gel electrophoresis (SDS-PAGE) analysis and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore Corp, Billerica, MA, USA). .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Western Blot:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: Paragraph title: 2.4. Western Blotting ... Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Binding Assay:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: The primers were 5′ GTCCAGTTGTGTGGGGAAAT 3′ (sense) and 5′ GAGCTGGAGCCGAAACTCTA 3′ (antisense), which amplified a 169‐bp region of the human Vegfr2 promoter containing Sp1 binding sites. .. The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation.

Chromatin Immunoprecipitation:

Article Title: Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression, et al. Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression
Article Snippet: Paragraph title: Chromatin immunoprecipitation assay ... The antibodies included anti‐Sp1 (#9389; Cell Signaling Technology), a positive control (Anti‐RNA Polymerase II) and a negative control (normal IgG) that were employed for each immunoprecipitation.

SDS Page:

Article Title: Porcine Circovirus Type 2 Rep Enhances IL-10 Production in Macrophages via Activation of p38-MAPK Pathway
Article Snippet: Equivalent protein subjected to Sodium dodecyl sulfate -polyacrylamide gel electrophoresis (SDS-PAGE) analysis and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore Corp, Billerica, MA, USA). .. Primary antibodies included: anti-phospho-Akt (9271; CST, Danvers, MA, USA), anti-Akt (9272; CST), anti-phospho-p38-MAPK (4511; CST), anti-p38-MAPK (8690; CST), anti-phospho-ERK, anti-ERK (4695; CST), anti-p50 (12540; CST), anti-Sp1 (9389; CST), anti-c-jun (9165; CST), anti-VG5Q (abs102222; absin, Shanghai, China), anti-TDG (ab154192; abcam, Cambridge, MA, USA), anti-ZNF265 (abs130552; absin), anti-c-Myc (13987; CST), and anti-β-actin (A00702; Genscript, Nanjing, China).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Cell Signaling Technology Inc antibodies against sp1
    p16 modulates the expression of different <t>Sp1</t> targets. A and C , total RNA was prepared from the indicated cells, and quantitative RT-PCR was performed using specific primers for the indicated genes. B , EMSA was performed using nuclear extracts from the
    Antibodies Against Sp1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibodies against sp1/product/Cell Signaling Technology Inc
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    antibodies against sp1 - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    p16 modulates the expression of different Sp1 targets. A and C , total RNA was prepared from the indicated cells, and quantitative RT-PCR was performed using specific primers for the indicated genes. B , EMSA was performed using nuclear extracts from the

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: p16 modulates the expression of different Sp1 targets. A and C , total RNA was prepared from the indicated cells, and quantitative RT-PCR was performed using specific primers for the indicated genes. B , EMSA was performed using nuclear extracts from the

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Expressing, Quantitative RT-PCR

    p16 positively regulates the expression of miR-141 and miR-146b-5p through the Sp1 transcription factor. A , nucleotide sequences of the miR-141 and miR-146b-5p promoters, −39 to +9 nucleotides and −93 to −26 nucleotides, respectively,

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: p16 positively regulates the expression of miR-141 and miR-146b-5p through the Sp1 transcription factor. A , nucleotide sequences of the miR-141 and miR-146b-5p promoters, −39 to +9 nucleotides and −93 to −26 nucleotides, respectively,

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Expressing

    p16, Sp1, and CDK4 proteins form a heterocomplex that binds the miR-141 and miR-146b-5p promoters. A , whole cell extracts were prepared from HFSN1 cells and immunoprecipitated ( IP ) with anti-p16, anti-Sp1, or anti-CDK4 antibodies (mouse IgG was used as

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: p16, Sp1, and CDK4 proteins form a heterocomplex that binds the miR-141 and miR-146b-5p promoters. A , whole cell extracts were prepared from HFSN1 cells and immunoprecipitated ( IP ) with anti-p16, anti-Sp1, or anti-CDK4 antibodies (mouse IgG was used as

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Immunoprecipitation

    p16 interacts with Sp1 through the fourth ankyrin repeat. A , p16-negative U2OS cells were transfected with the indicated constructs, and then whole cell extracts were prepared and used for immunoprecipitation ( IP ) with anti-p16 antibody (mouse IgG was

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: p16 interacts with Sp1 through the fourth ankyrin repeat. A , p16-negative U2OS cells were transfected with the indicated constructs, and then whole cell extracts were prepared and used for immunoprecipitation ( IP ) with anti-p16 antibody (mouse IgG was

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Transfection, Construct, Immunoprecipitation

    Sp1 binds the miR-141 and miR-146b-5p promoters and activates their transcription in a p16-dependent manner. A , ChIP assay. Chromatin was purified from HFSN1C and HFSN1p16sh, and then immunoprecipitated ( IP ) using anti-Sp1 antibody. miR-141 and miR-146b-5p

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: Sp1 binds the miR-141 and miR-146b-5p promoters and activates their transcription in a p16-dependent manner. A , ChIP assay. Chromatin was purified from HFSN1C and HFSN1p16sh, and then immunoprecipitated ( IP ) using anti-Sp1 antibody. miR-141 and miR-146b-5p

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Chromatin Immunoprecipitation, Purification, Immunoprecipitation

    p16-CDK4-Sp1-dependent up-regulation of miR-141 and miR-146b-5p and their role in apoptosis following UV damage. A , cells were either mock-treated or challenged with UV light (10 Jm −2 ) and then re-incubated for the indicated periods of time. Total

    Journal: The Journal of Biological Chemistry

    Article Title: The Cyclin-dependent Kinase Inhibitor p16INK4a Physically Interacts with Transcription Factor Sp1 and Cyclin-dependent Kinase 4 to Transactivate MicroRNA-141 and MicroRNA-146b-5p Spontaneously and in Response to Ultraviolet Light-induced DNA Damage *

    doi: 10.1074/jbc.M113.512640

    Figure Lengend Snippet: p16-CDK4-Sp1-dependent up-regulation of miR-141 and miR-146b-5p and their role in apoptosis following UV damage. A , cells were either mock-treated or challenged with UV light (10 Jm −2 ) and then re-incubated for the indicated periods of time. Total

    Article Snippet: ChIP experiments were performed using antibodies against Sp1 (Cell Signaling Technology), p16 (BD Biosciences), and CDK4 (C-22).

    Techniques: Incubation

    The role of Sp1 in mediating the effect of nicotine on PPARβ/δ expression

    Journal: Cancer research

    Article Title: Nicotine stimulates PPAR?/? expression in human lung carcinoma cells through activation of PI3-K/mTOR and suppression of AP-2?

    doi: 10.1158/0008-5472.CAN-09-1001

    Figure Lengend Snippet: The role of Sp1 in mediating the effect of nicotine on PPARβ/δ expression

    Article Snippet: Blots were incubated with primary antibodies against PPARβ/δ, α7 nAChR, AP-2α, AP-2β, AP-2γ or Sp1 (1:1000) overnight at 4°C, washed, and incubated with secondary anti-rabbit IgG conjugated to horseradish peroxidase (1:2,000 dilution, Cell Signaling) for 1 h at room temperature.

    Techniques: Expressing

    SP1 was a directly targeted gene of miR-149 in vitro . (A) Bioinformatics software assessed that SP1 mRNA contained a miR-149 seed match at position 3809–3815 of the SP1 3′-UTR. (B) miR-149 significantly inhibited the SP1 Wt but not the

    Journal: Oncology Letters

    Article Title: MicroRNA-149 targets specificity protein 1 to suppress human tongue squamous cell carcinoma cell proliferation and motility

    doi: 10.3892/ol.2016.5527

    Figure Lengend Snippet: SP1 was a directly targeted gene of miR-149 in vitro . (A) Bioinformatics software assessed that SP1 mRNA contained a miR-149 seed match at position 3809–3815 of the SP1 3′-UTR. (B) miR-149 significantly inhibited the SP1 Wt but not the

    Article Snippet: The membranes were blocked with 5% skimmed milk at room temperature for 2 h and incubated with rabbit anti-human SP1 antibody (dilution, 1: 1,000; cat. no., 5931; Cell Signaling Technology, Inc., Danvers, MA, USA) according to the protocol of the manufacturer at 4°C overnight.

    Techniques: In Vitro, Software

    ChIP analysis of the effect of IMC-76 and IMC-48 given either singly (A and B) or in sequential order (IMC-76 followed by IMC-48) (C) on promoter occupancy of Sp1 and hnRNP LL. For single drug treatments (A and B), two concentrations (0.5 and 2 μM) of IMC-76 or IMC-48 with DMSO as a control were incubated with MCF-7 and BJAB cells, respectively, for 24 h. For sequential treatments (C), antagonism between IMC-76 and IMC-48 was shown through restoration of Sp1 and hnRNP LL promoter occupancy levels following administration of IMC-48 after prior knockdown with IMC-76 in MCF-7 cells. MCF-7 cells were treated with DMSO or 2 μM of IMC-76 for 24 h. In a similar way, other MCF-7 cells were treated first with 2 μM of IMC-76 and then with 2 or 4 μM of IMC-48 for a further 24 h. IP was performed with antibodies to Sp1 and hnRNP LL and IgG as a negative control and acetyl-histone H3 (AcH3) as a positive control. The P values (*** P

    Journal: Journal of the American Chemical Society

    Article Title: The Transcriptional Complex Between the BCL2 i-Motif and hnRNP LL Is a Molecular Switch for Control of Gene Expression That Can Be Modulated by Small Molecules

    doi: 10.1021/ja4109352

    Figure Lengend Snippet: ChIP analysis of the effect of IMC-76 and IMC-48 given either singly (A and B) or in sequential order (IMC-76 followed by IMC-48) (C) on promoter occupancy of Sp1 and hnRNP LL. For single drug treatments (A and B), two concentrations (0.5 and 2 μM) of IMC-76 or IMC-48 with DMSO as a control were incubated with MCF-7 and BJAB cells, respectively, for 24 h. For sequential treatments (C), antagonism between IMC-76 and IMC-48 was shown through restoration of Sp1 and hnRNP LL promoter occupancy levels following administration of IMC-48 after prior knockdown with IMC-76 in MCF-7 cells. MCF-7 cells were treated with DMSO or 2 μM of IMC-76 for 24 h. In a similar way, other MCF-7 cells were treated first with 2 μM of IMC-76 and then with 2 or 4 μM of IMC-48 for a further 24 h. IP was performed with antibodies to Sp1 and hnRNP LL and IgG as a negative control and acetyl-histone H3 (AcH3) as a positive control. The P values (*** P

    Article Snippet: Overnight IP with 4 μg of IgG (Cell Signaling, #2729S), acetyl-histone H3 (Millipore, #06-599), Sp1 (Cell Signaling, #5931S), or hnRNP LL (Cell Signaling, #4783S) antibodies at 4 °C was followed by addition of protein G-coupled Dynabeads for 90 min 4 °C.

    Techniques: Chromatin Immunoprecipitation, Incubation, Negative Control, Positive Control