anti sox2  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Anti SOX2 antibody
    Description:
    Transcription factor SOX 2 SOX 2 is a member of the SRY related HMG box SOX family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate Mutations in this gene have been associated with bilateral anophthalmia a severe form of structural eye malformation When SOX 2 is expressed in self renewing progenitor cells it acts to inhibit neuronal differentiation Conversely active repression of SOX 2 induces neural differentiation
    Catalog Number:
    s9072
    Price:
    None
    Applications:
    Rabbit polyclonal anti-SOX2 antibody is used to tag solute sex-determining region Y-box 2 transcription factor for detection and quantitation by immunocytochemical and immunohistochemical (IHC) techniques, such as immunoblotting (~37 kDa) and flow cytometry. It is used as a probe to determine the presence and roles of sex-determining region Y-box 2 transcription factor in progenitor cell self renewal and differentiation.
    Buy from Supplier


    Structured Review

    Millipore anti sox2
    Tamoxifen induces <t>SOX2</t> to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.
    Transcription factor SOX 2 SOX 2 is a member of the SRY related HMG box SOX family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate Mutations in this gene have been associated with bilateral anophthalmia a severe form of structural eye malformation When SOX 2 is expressed in self renewing progenitor cells it acts to inhibit neuronal differentiation Conversely active repression of SOX 2 induces neural differentiation
    https://www.bioz.com/result/anti sox2/product/Millipore
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    anti sox2 - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "TARBP2-Enhanced Resistance during Tamoxifen Treatment in Breast Cancer"

    Article Title: TARBP2-Enhanced Resistance during Tamoxifen Treatment in Breast Cancer

    Journal: Cancers

    doi: 10.3390/cancers11020210

    Tamoxifen induces SOX2 to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.
    Figure Legend Snippet: Tamoxifen induces SOX2 to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

    Techniques Used: Expressing, Isolation, Polymerase Chain Reaction, Quantitative RT-PCR, Positive Control, Western Blot, Transfection, shRNA, MTT Assay, Blocking Assay

    Both SOX2 and TARBP2 expression are elevated in hormone therapy-resistant tumor cells. ( A ) The correlation of SOX2 expression with the overall survival of ER-positive breast cancer patients was analyzed and downloaded using Kaplan-Meier Plotter ( http://kmplot.com/ ). ( B , C ) Association of SOX2 expression and hormone therapy resistance in breast cancer tissues. Representative serial sections of Figure 1 B showed images of SOX2 IHC in primary tumors and tumors in lymph nodes in cases of cancer recurrence ( B ). Scale Bar: 100 uM. Statistics of SOX2 protein expression levels in primary tumors and metastatic tumor cells in cases of cancer recurrence ( C ). ( D ) Resistance mechanism for tamoxifen–induced TARBP2-SOX2 in breast cancer.
    Figure Legend Snippet: Both SOX2 and TARBP2 expression are elevated in hormone therapy-resistant tumor cells. ( A ) The correlation of SOX2 expression with the overall survival of ER-positive breast cancer patients was analyzed and downloaded using Kaplan-Meier Plotter ( http://kmplot.com/ ). ( B , C ) Association of SOX2 expression and hormone therapy resistance in breast cancer tissues. Representative serial sections of Figure 1 B showed images of SOX2 IHC in primary tumors and tumors in lymph nodes in cases of cancer recurrence ( B ). Scale Bar: 100 uM. Statistics of SOX2 protein expression levels in primary tumors and metastatic tumor cells in cases of cancer recurrence ( C ). ( D ) Resistance mechanism for tamoxifen–induced TARBP2-SOX2 in breast cancer.

    Techniques Used: Expressing, Immunohistochemistry

    2) Product Images from "BMP signaling is necessary for patterning the sensory and non-sensory regions of the developing mammalian cochlea"

    Article Title: BMP signaling is necessary for patterning the sensory and non-sensory regions of the developing mammalian cochlea

    Journal: The Journal of neuroscience : the official journal of the Society for Neuroscience

    doi: 10.1523/JNEUROSCI.3547-10.2010

    The gross morphology of the inner ear in BMP receptor mutants A : Whole-mount in situ hybridization of the E12.5 inner ear, showing the expression of Fgf10 , Sox2 and Bmp4 . ac: anterior crista, lc: lateral crista, pc: posterior crista, ed: endolymphatic duct, u: utricle, s: saccule and c: cochlea. B : Paint-fills of the E13.5 inner ears of control and Alk3 -CKO; Alk6 +/− mutants. The paint often fails to fill the middle of the semicircular canals Alk3 -CKO; Alk6 +/− (arrowheads). The cochlear duct is severely shortened and widened in the Alk3 -CKO; Alk6 +/− mutants (asterisk). C: Vestibular sensory hair cell development revealed by Myosin VI staining (green) appears grossly normal in Alk3 -CKO; Alk6 +/− mutants at E15.5. Nuclear staining by DAPI is indicated in magenta. Scale bars: 100 μm.
    Figure Legend Snippet: The gross morphology of the inner ear in BMP receptor mutants A : Whole-mount in situ hybridization of the E12.5 inner ear, showing the expression of Fgf10 , Sox2 and Bmp4 . ac: anterior crista, lc: lateral crista, pc: posterior crista, ed: endolymphatic duct, u: utricle, s: saccule and c: cochlea. B : Paint-fills of the E13.5 inner ears of control and Alk3 -CKO; Alk6 +/− mutants. The paint often fails to fill the middle of the semicircular canals Alk3 -CKO; Alk6 +/− (arrowheads). The cochlear duct is severely shortened and widened in the Alk3 -CKO; Alk6 +/− mutants (asterisk). C: Vestibular sensory hair cell development revealed by Myosin VI staining (green) appears grossly normal in Alk3 -CKO; Alk6 +/− mutants at E15.5. Nuclear staining by DAPI is indicated in magenta. Scale bars: 100 μm.

    Techniques Used: In Situ Hybridization, Expressing, Staining

    Dynamic expression of molecular markers during mouse cochlear prosensory formation A–G : Sections from E11.5 to E13.5 cochlear duct showing expression of SOX2 ( A ), JAG1 ( B ), P27 KIP1 (green in B at E13.5), Fgf10 ( C ), Lfng ( D ), Bmp4 ( E ), Phospho-SMAD1/5/8 ( F ) and Id2 ( G ). The approximate region of the prosensory domain at E13.5 is marked by brackets. H: Schematic drawing summarizing the changes in expression of molecular markers that regionalize the E13.5 cochlear epithelium. The arrow in E indicates the region of Bmp4 expression. Note that the epithelium of the Bmp4 + domain at E13.5 is significantly thinner than other domains as indicated by the bars in E. Scale bars: 100 μm.
    Figure Legend Snippet: Dynamic expression of molecular markers during mouse cochlear prosensory formation A–G : Sections from E11.5 to E13.5 cochlear duct showing expression of SOX2 ( A ), JAG1 ( B ), P27 KIP1 (green in B at E13.5), Fgf10 ( C ), Lfng ( D ), Bmp4 ( E ), Phospho-SMAD1/5/8 ( F ) and Id2 ( G ). The approximate region of the prosensory domain at E13.5 is marked by brackets. H: Schematic drawing summarizing the changes in expression of molecular markers that regionalize the E13.5 cochlear epithelium. The arrow in E indicates the region of Bmp4 expression. Note that the epithelium of the Bmp4 + domain at E13.5 is significantly thinner than other domains as indicated by the bars in E. Scale bars: 100 μm.

    Techniques Used: Expressing

    Markers of Kölliker’s organ expand at the expense of the prosensory domain and the outer sulcus in Alk3 -CKO; Alk6 +/− compound mutants A–D : Sections of the cochlear duct (mid-turn) at E13.5. Left: Control littermate, Right: Alk3 -CKO; Alk6 +/− compound mutant. Markers of Kölliker’s organ such as Fgf10 ( A ), JAG1 ( B ) and Lfng ( C ) are expressed throughout the dorsal cochlear duct of compound mutants, whereas Bmp4 ( D ), a marker of outer sulcus is absent. The approximate location of the prosensory domain is marked by brackets E : A schematic drawing representing the phenotype of the Alk3 -CKO; Alk6 +/− compound mutant. In the Alk3 -CKO; Alk6 +/− compound mutant, Kölliker’s organ domain (red) expands at the expense of the prosensory domain (green) and the outer sulcus domain (blue). F, G : Sections of the cochlear duct (mid-turn) at E15.5. ( F ) The arrow indicates apoptotic cells marked by activated CASPASE3 (green). Nuclei are labeled with DAPI (blue). ( G ) P27 KIP1 (green) and SOX2 (magenta) staining, showing an absence of the p27 kip1+ domain in the compound mutants. Scale bars: 100 μm.
    Figure Legend Snippet: Markers of Kölliker’s organ expand at the expense of the prosensory domain and the outer sulcus in Alk3 -CKO; Alk6 +/− compound mutants A–D : Sections of the cochlear duct (mid-turn) at E13.5. Left: Control littermate, Right: Alk3 -CKO; Alk6 +/− compound mutant. Markers of Kölliker’s organ such as Fgf10 ( A ), JAG1 ( B ) and Lfng ( C ) are expressed throughout the dorsal cochlear duct of compound mutants, whereas Bmp4 ( D ), a marker of outer sulcus is absent. The approximate location of the prosensory domain is marked by brackets E : A schematic drawing representing the phenotype of the Alk3 -CKO; Alk6 +/− compound mutant. In the Alk3 -CKO; Alk6 +/− compound mutant, Kölliker’s organ domain (red) expands at the expense of the prosensory domain (green) and the outer sulcus domain (blue). F, G : Sections of the cochlear duct (mid-turn) at E15.5. ( F ) The arrow indicates apoptotic cells marked by activated CASPASE3 (green). Nuclei are labeled with DAPI (blue). ( G ) P27 KIP1 (green) and SOX2 (magenta) staining, showing an absence of the p27 kip1+ domain in the compound mutants. Scale bars: 100 μm.

    Techniques Used: Mutagenesis, Marker, Labeling, Staining

    3) Product Images from "Targeted silencing of the oncogenic transcription factor SOX2 in breast cancer"

    Article Title: Targeted silencing of the oncogenic transcription factor SOX2 in breast cancer

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks360

    Induction of ZF-598 SKD reduces SOX2 expression and tumor cell proliferation in vivo . ( A ) SOX2 (red) and ZF-598SKD (α-HA, green) detection by immunofluorescence (IF) analyses of representative sections from ZF-598SKD un-induced (–Dox) and induced (+Dox) animals. ( B ) Ki67 expression (red) analyzed by IF in the same samples. Nuclei were labelled with Hoechst (blue). Images were taken at 40×.
    Figure Legend Snippet: Induction of ZF-598 SKD reduces SOX2 expression and tumor cell proliferation in vivo . ( A ) SOX2 (red) and ZF-598SKD (α-HA, green) detection by immunofluorescence (IF) analyses of representative sections from ZF-598SKD un-induced (–Dox) and induced (+Dox) animals. ( B ) Ki67 expression (red) analyzed by IF in the same samples. Nuclei were labelled with Hoechst (blue). Images were taken at 40×.

    Techniques Used: Expressing, In Vivo, Immunofluorescence

    A SOX2 -specific ATF inhibits the growth of pre-existing s.c xenografts of MCF7 cells. ( A ) Time course plot of tumor volume monitored by caliper measurements. Animals ( N = 6) were either maintained in a Dox-free diet (-Dox) or induced with Dox diet (arrow) at day 21 post-injection. ( B ) Picture of representative tumors collected at day 28 post-induction from induced empty vector, un-induced ZF-598SKD, and induced ZF-598SKD animals. ( C ) Tumor volume measurements at day 21 post-induction from empty vector and ZF-598SKD groups ( N = 6 animals per group). Differences between groups were assessed by a Wilconxon rank sum test. ( D ) Quantification of SOX2 mRNA expression by qRT-PCR in tumor samples from a representative tumor xenograft. Bar graphs represent the mean and SD of three tumor samples. Differences in gene expression were calculated with a Student’s t -test, * P = 0.01 (E) Hematoxylin-Eosin staining of representative ZF-598SKD –Dox and +Dox tumor sections. Un-induced (–Dox) animals revealed highly compact tumors. Induced (+Dox) ZF-598SKD sections comprised discrete islands of tumor cells, separated by intervening stroma. Pictures were taken at 10× and a detail of a 40× magnification is shown.
    Figure Legend Snippet: A SOX2 -specific ATF inhibits the growth of pre-existing s.c xenografts of MCF7 cells. ( A ) Time course plot of tumor volume monitored by caliper measurements. Animals ( N = 6) were either maintained in a Dox-free diet (-Dox) or induced with Dox diet (arrow) at day 21 post-injection. ( B ) Picture of representative tumors collected at day 28 post-induction from induced empty vector, un-induced ZF-598SKD, and induced ZF-598SKD animals. ( C ) Tumor volume measurements at day 21 post-induction from empty vector and ZF-598SKD groups ( N = 6 animals per group). Differences between groups were assessed by a Wilconxon rank sum test. ( D ) Quantification of SOX2 mRNA expression by qRT-PCR in tumor samples from a representative tumor xenograft. Bar graphs represent the mean and SD of three tumor samples. Differences in gene expression were calculated with a Student’s t -test, * P = 0.01 (E) Hematoxylin-Eosin staining of representative ZF-598SKD –Dox and +Dox tumor sections. Un-induced (–Dox) animals revealed highly compact tumors. Induced (+Dox) ZF-598SKD sections comprised discrete islands of tumor cells, separated by intervening stroma. Pictures were taken at 10× and a detail of a 40× magnification is shown.

    Techniques Used: Injection, Plasmid Preparation, Expressing, Quantitative RT-PCR, Staining

    Repression of SOX2 decreases cell viability and anchorage-independent growth. ( A ) Cell viability analysis of MDA-MB-435s cells transduced with either empty vector, ZF-598SKD or ZF-552SKD. Mock-transfected cells (Mock) were used to assess background. Cell viability over time was monitored over a period of 96 h after the initial seeding of the infected cells. Cell viability was monitored using a CellTiter Glo Assay ( 19 ). ( B ) Cell viability assays in MCF7 cell cells. Empty vector, ZF-552SKD- or ZF-598SKD-transduced cells were induced with Doxycyclin every 48 h. Un-induced (–Dox) cells were used as controls. The y -axis indicates fold increase in ATP release relative to time point 0 measured by luminescence. Statistical significance was analyzed using two-way ANOVA. The P -values for both, ZF-552SKD and ZF-598SKD +Dox samples versus the same samples in –Dox conditions were P
    Figure Legend Snippet: Repression of SOX2 decreases cell viability and anchorage-independent growth. ( A ) Cell viability analysis of MDA-MB-435s cells transduced with either empty vector, ZF-598SKD or ZF-552SKD. Mock-transfected cells (Mock) were used to assess background. Cell viability over time was monitored over a period of 96 h after the initial seeding of the infected cells. Cell viability was monitored using a CellTiter Glo Assay ( 19 ). ( B ) Cell viability assays in MCF7 cell cells. Empty vector, ZF-552SKD- or ZF-598SKD-transduced cells were induced with Doxycyclin every 48 h. Un-induced (–Dox) cells were used as controls. The y -axis indicates fold increase in ATP release relative to time point 0 measured by luminescence. Statistical significance was analyzed using two-way ANOVA. The P -values for both, ZF-552SKD and ZF-598SKD +Dox samples versus the same samples in –Dox conditions were P

    Techniques Used: Multiple Displacement Amplification, Transduction, Plasmid Preparation, Transfection, Infection, Glo Assay

    ATFs down-regulate SOX2 expression in MDA-MB-435s and MCF7 breast cancer cells. ( A ) Quantification of SOX2 mRNA expression by qRT-PCR in MDA-MB-435s cells. PMX-IRES-GFP (empty vector), ZF proteins –552SKD, –598SKD, –619SKD, –4203SKD, or a pool of 10 7 ZF domains [Library-SKD ( 48 )] were retrovirally delivered in the cells and total mRNA was extracted. Mock-treated cells (Mock) are also indicated as control. Real-time quantification of gene expression was normalized to empty vector control samples. As positive controls for knock-down, cells were transfected with an anti- SOX2 siRNA. A non-specific siRNA targeting another TF ( PATZ1 ) was used as a negative control for siRNA transfection. Error bars represent the standard deviation of three independent experiments. Statistical significance was analyzed using t -test (*** P
    Figure Legend Snippet: ATFs down-regulate SOX2 expression in MDA-MB-435s and MCF7 breast cancer cells. ( A ) Quantification of SOX2 mRNA expression by qRT-PCR in MDA-MB-435s cells. PMX-IRES-GFP (empty vector), ZF proteins –552SKD, –598SKD, –619SKD, –4203SKD, or a pool of 10 7 ZF domains [Library-SKD ( 48 )] were retrovirally delivered in the cells and total mRNA was extracted. Mock-treated cells (Mock) are also indicated as control. Real-time quantification of gene expression was normalized to empty vector control samples. As positive controls for knock-down, cells were transfected with an anti- SOX2 siRNA. A non-specific siRNA targeting another TF ( PATZ1 ) was used as a negative control for siRNA transfection. Error bars represent the standard deviation of three independent experiments. Statistical significance was analyzed using t -test (*** P

    Techniques Used: Expressing, Multiple Displacement Amplification, Quantitative RT-PCR, Plasmid Preparation, Transfection, Negative Control, Standard Deviation

    6ZF domains linked to transcriptional activators enhance SOX2 mRNA expression in MDA-MB-435s cells. Cells were retrovirally transduced with either ZF-552, ZF-598 or ZF-4203 (retroviral constructs expressing the specific DNA-binding domains but lacking the SKD effector domain or with the same ZFs linked to the VP64 transactivator domain (ZF-552VP64, ZF-598VP64, ZF-4203VP64). Library-VP64 sample refers to a pool of ∼10 6 different 6ZF domains ( 48 ). Quantification of SOX2 mRNA cells was analyzed by qRT-PCR and normalized to empty vector control. (* P
    Figure Legend Snippet: 6ZF domains linked to transcriptional activators enhance SOX2 mRNA expression in MDA-MB-435s cells. Cells were retrovirally transduced with either ZF-552, ZF-598 or ZF-4203 (retroviral constructs expressing the specific DNA-binding domains but lacking the SKD effector domain or with the same ZFs linked to the VP64 transactivator domain (ZF-552VP64, ZF-598VP64, ZF-4203VP64). Library-VP64 sample refers to a pool of ∼10 6 different 6ZF domains ( 48 ). Quantification of SOX2 mRNA cells was analyzed by qRT-PCR and normalized to empty vector control. (* P

    Techniques Used: Expressing, Multiple Displacement Amplification, Transduction, Construct, Binding Assay, Quantitative RT-PCR, Plasmid Preparation

    ATFs bind their targeted site in the endogenous SOX2 promoter. ( A ) Schematic illustration of the chromatin Immunoprecipitation (ChIP) assay. ( B ) ZF-598SKD (upper panel) and ZF-552SKD (lower panel) are binding their target sites, as assessed by ChIP using an anti-HA antibody. Genomic DNA bound by the corresponding ATF was amplified using SOX2 -specific primers. An anti RNA-polymerase II (RNA-Pol II) antibody and no antibody (No AB) samples were used in the same assay, as positive and negative controls, respectively. A quantification of the ChIP assay by densitometry analyses of the bands from the same gels is outlined below. ( C ) A schematic illustration of the proposed repressive mechanism induced by ZF silencers in the SOX2 promoter. Upon recruitment of the co-repressor KAP1 (KRAB-associated protein 1) and NuRD (nucleosome remodeling and deacetylase) by SKD in the targeted site, a repressive complex including HDACs (histone deacetylases), SETDB1 (histone methyltransferase), and HP1 (heterochromatin protein 1) is assembled. This repressive complex catalyzes the formation of condensed chromatin by de-acetylation of histones, demethylation of H3K4me3, and incorporation of H3K9me3.
    Figure Legend Snippet: ATFs bind their targeted site in the endogenous SOX2 promoter. ( A ) Schematic illustration of the chromatin Immunoprecipitation (ChIP) assay. ( B ) ZF-598SKD (upper panel) and ZF-552SKD (lower panel) are binding their target sites, as assessed by ChIP using an anti-HA antibody. Genomic DNA bound by the corresponding ATF was amplified using SOX2 -specific primers. An anti RNA-polymerase II (RNA-Pol II) antibody and no antibody (No AB) samples were used in the same assay, as positive and negative controls, respectively. A quantification of the ChIP assay by densitometry analyses of the bands from the same gels is outlined below. ( C ) A schematic illustration of the proposed repressive mechanism induced by ZF silencers in the SOX2 promoter. Upon recruitment of the co-repressor KAP1 (KRAB-associated protein 1) and NuRD (nucleosome remodeling and deacetylase) by SKD in the targeted site, a repressive complex including HDACs (histone deacetylases), SETDB1 (histone methyltransferase), and HP1 (heterochromatin protein 1) is assembled. This repressive complex catalyzes the formation of condensed chromatin by de-acetylation of histones, demethylation of H3K4me3, and incorporation of H3K9me3.

    Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Amplification, Histone Deacetylase Assay

    Design of ATFs to down-regulate SOX2 expression. ( A ) Schematic representation of a 6 ZF ATF bound to DNA with the orientation of the domains depicted. ( B ) Schematic illustration of the SOX2 promoter outlining the ZF-552SKD, ZF-598SKD, ZF-619SKD and ZF-4203SKD targeted sequences and their location relative to the transcription start site (TSS). Highlighted are the core promoter (red), regulatory region 1 (green), and regulatory region 2 (blue). Arrows show the orientation of the 18-bp binding site in the promoter (from 5′ to 3′). ( C ) Alpha-helical ZF amino acid sequences chosen to construct the ATFs. Residues at position –1, +3 and +6 making specific contacts with the recognition triplets are indicated in color (red refers to position –1, blue to position +3 and green to +6 of the ZF recognition helix). ( D ) Quantification of SOX2 expression in 12 breast cancer cell lines by western blot.
    Figure Legend Snippet: Design of ATFs to down-regulate SOX2 expression. ( A ) Schematic representation of a 6 ZF ATF bound to DNA with the orientation of the domains depicted. ( B ) Schematic illustration of the SOX2 promoter outlining the ZF-552SKD, ZF-598SKD, ZF-619SKD and ZF-4203SKD targeted sequences and their location relative to the transcription start site (TSS). Highlighted are the core promoter (red), regulatory region 1 (green), and regulatory region 2 (blue). Arrows show the orientation of the 18-bp binding site in the promoter (from 5′ to 3′). ( C ) Alpha-helical ZF amino acid sequences chosen to construct the ATFs. Residues at position –1, +3 and +6 making specific contacts with the recognition triplets are indicated in color (red refers to position –1, blue to position +3 and green to +6 of the ZF recognition helix). ( D ) Quantification of SOX2 expression in 12 breast cancer cell lines by western blot.

    Techniques Used: Expressing, Binding Assay, Construct, Western Blot

    4) Product Images from "The Specification of Cortical Subcerebral Projection Neurons Depends on the Direct Repression of TBR1 by CTIP1/BCL11a"

    Article Title: The Specification of Cortical Subcerebral Projection Neurons Depends on the Direct Repression of TBR1 by CTIP1/BCL11a

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.0169-15.2015

    CTIP1 is expressed in postmitotic neurons in the embryonic cerebral cortex. A , B , Coronal sections of an E15.5 brain showing the expression pattern of CTIP1 in the cerebral cortex. CTIP1 expression is contrasted with the patterns of SOX2 ( A ) and TBR2 ( B ), which are expressed in the ventricular zone (VZ) and subventricular zone (SVZ), respectively. C , Magnification of the area within the rectangle shown in A. CTIP1 is excluded from the VZ/SVZ and is observed throughout the intermediate zone (IZ) and the cortical plate (CP). D – E″ , Magnified views of the areas enclosed by the squares in C . Observe the null expression of CTIP1 in progenitor cells expressing SOX2. F – F″ , Coronal section of an E17.5 cortex showing the expression of CTIP1 compared with the expression of doublecortin (DCX) and Ki67. G , H‴ , Magnified views of the areas enclosed by the squares in F″ . CTIP1 is coexpressed throughout the CP with DCX and it is excluded from proliferating cells marked by Ki67. Arrowheads point representative cells near the proliferative regions expressing CTIP1 and DCX but not Ki67. Scale bars: B , 500 μm; C , F , 100 μm; E″ , H‴ , 25 μm.
    Figure Legend Snippet: CTIP1 is expressed in postmitotic neurons in the embryonic cerebral cortex. A , B , Coronal sections of an E15.5 brain showing the expression pattern of CTIP1 in the cerebral cortex. CTIP1 expression is contrasted with the patterns of SOX2 ( A ) and TBR2 ( B ), which are expressed in the ventricular zone (VZ) and subventricular zone (SVZ), respectively. C , Magnification of the area within the rectangle shown in A. CTIP1 is excluded from the VZ/SVZ and is observed throughout the intermediate zone (IZ) and the cortical plate (CP). D – E″ , Magnified views of the areas enclosed by the squares in C . Observe the null expression of CTIP1 in progenitor cells expressing SOX2. F – F″ , Coronal section of an E17.5 cortex showing the expression of CTIP1 compared with the expression of doublecortin (DCX) and Ki67. G , H‴ , Magnified views of the areas enclosed by the squares in F″ . CTIP1 is coexpressed throughout the CP with DCX and it is excluded from proliferating cells marked by Ki67. Arrowheads point representative cells near the proliferative regions expressing CTIP1 and DCX but not Ki67. Scale bars: B , 500 μm; C , F , 100 μm; E″ , H‴ , 25 μm.

    Techniques Used: Expressing

    5) Product Images from "Dlg5 maintains apical aPKC and regulates progenitor differentiation during lung morphogenesis"

    Article Title: Dlg5 maintains apical aPKC and regulates progenitor differentiation during lung morphogenesis

    Journal: Developmental biology

    doi: 10.1016/j.ydbio.2013.02.019

    Dlg5 is required for lung alveolar differentiation program (A–A′) Normal epithelial differentiation in E14.5 Dlg5 −/− lungs. Immunofluorescent stainings of lung sections from wild-type (Ctrl) and Dlg5 −/− embryos with anti-Sox2 antibodies. (B–B′) Vasculature development in Dlg5 −/− lungs. Immunofluorescent stainings of E15.5 lung sections from wild-type (Ctrl) and Dlg5 −/− embryos with anti-PECAM (endothelial cell marker) antibody. (C–E′) Immunofluorescent stainings of lung sections from E15.5 wild-type (Ctrl) and Dlg5 −/− embryos with anti-T1α and anti-pro-SPC (both expressed in epithelial lung cells at E15.5) antibodies. Boxed areas in C–C′ are shown with split channels in D–E′. Note failure of apical (luminal) localization of T1α in Dlg5 −/− cells in E′. (F) Western blot analysis of total protein extracts from E15.5 wild-type (Ctrl) and Dlg5 −/− lungs with anti-Dlg5, anti-E-cadherin (E-cad), anti-Keratin 8 (Ker 8), anti-FoxJ1, anti-Sox2, anti-Sox9 and anti-β-actin antibodies. (G–G′) Immunofluorescent stainings of lung sections from E15.5 wild-type (Ctrl) and Dlg5 −/− embryos with anti-desmin (green, Desm), anti-pro-SPC (red) antibodies. Western blotting on E15.5 total protein extracts with anti-Desmin and anti-β-actin antibodies is shown in the inset. (H) qRT-PCR analysis of indicated gene expression in E13.5 wild-type (Ctrl) and Dlg5 −/− lungs. Mean values with standard deviations are in arbitrary units with the level of wild-type lung adjusted to 1. * indicates P
    Figure Legend Snippet: Dlg5 is required for lung alveolar differentiation program (A–A′) Normal epithelial differentiation in E14.5 Dlg5 −/− lungs. Immunofluorescent stainings of lung sections from wild-type (Ctrl) and Dlg5 −/− embryos with anti-Sox2 antibodies. (B–B′) Vasculature development in Dlg5 −/− lungs. Immunofluorescent stainings of E15.5 lung sections from wild-type (Ctrl) and Dlg5 −/− embryos with anti-PECAM (endothelial cell marker) antibody. (C–E′) Immunofluorescent stainings of lung sections from E15.5 wild-type (Ctrl) and Dlg5 −/− embryos with anti-T1α and anti-pro-SPC (both expressed in epithelial lung cells at E15.5) antibodies. Boxed areas in C–C′ are shown with split channels in D–E′. Note failure of apical (luminal) localization of T1α in Dlg5 −/− cells in E′. (F) Western blot analysis of total protein extracts from E15.5 wild-type (Ctrl) and Dlg5 −/− lungs with anti-Dlg5, anti-E-cadherin (E-cad), anti-Keratin 8 (Ker 8), anti-FoxJ1, anti-Sox2, anti-Sox9 and anti-β-actin antibodies. (G–G′) Immunofluorescent stainings of lung sections from E15.5 wild-type (Ctrl) and Dlg5 −/− embryos with anti-desmin (green, Desm), anti-pro-SPC (red) antibodies. Western blotting on E15.5 total protein extracts with anti-Desmin and anti-β-actin antibodies is shown in the inset. (H) qRT-PCR analysis of indicated gene expression in E13.5 wild-type (Ctrl) and Dlg5 −/− lungs. Mean values with standard deviations are in arbitrary units with the level of wild-type lung adjusted to 1. * indicates P

    Techniques Used: Marker, Western Blot, Quantitative RT-PCR, Expressing

    6) Product Images from "Mitochondrial Superoxide Production Negatively Regulates Neural Progenitor Proliferation and Cerebral Cortical Development"

    Article Title: Mitochondrial Superoxide Production Negatively Regulates Neural Progenitor Proliferation and Cerebral Cortical Development

    Journal: Stem cells (Dayton, Ohio)

    doi: 10.1002/stem.1213

    Characterization of spontaneous mitochondrial SO flashes in NPCs. (A): Dissociated NPCs at day 3 in culture were immunostained with antibodies against Sox2, nestin and BrdU (after a 16 h exposure to 10 μM BrdU) (green), which are markers of proliferating
    Figure Legend Snippet: Characterization of spontaneous mitochondrial SO flashes in NPCs. (A): Dissociated NPCs at day 3 in culture were immunostained with antibodies against Sox2, nestin and BrdU (after a 16 h exposure to 10 μM BrdU) (green), which are markers of proliferating

    Techniques Used:

    7) Product Images from "Reduced Adult Hippocampal Neurogenesis and Working Memory Deficits in the Dgcr8-Deficient Mouse Model of 22q11.2 Deletion-Associated Schizophrenia Can Be Rescued by IGF2"

    Article Title: Reduced Adult Hippocampal Neurogenesis and Working Memory Deficits in the Dgcr8-Deficient Mouse Model of 22q11.2 Deletion-Associated Schizophrenia Can Be Rescued by IGF2

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.2700-12.2013

    Dgcr8 deficiency affects AHP proliferation in the adult dentate gyrus. A , Immunolocalization of neural stem and progenitor cells in the brains of 2-month-old Dgcr8 +/+ and Dgcr8 +/− mice. Brain sections were stained with anti-BrdU, anti-Ki67, anti-SOX2, anti-Nestin, anti-GFAP, and anti-DCX antibodies (green, white arrowheads). The second and fourth columns from the left show magnified views of the boxed regions. There were decreased numbers of Ki67-, SOX2-, GFAP-, Nestin-, and DCX-positive cells in the brain of Dgcr8 +/− mice compared with those in Dgcr8 +/+ mice. The nuclei were stained with DAPI (blue). Scale bar, 50 μm. B–D , Quantitative analysis of BrdU-, Ki67-, or SOX2-positive cells in the SGZ. The numbers of BrdU-, Ki67-, and SOX2-positive cells (10 sections per animal) were significantly smaller in the Dgcr8 +/− mouse hippocampal dentate gyrus (* p
    Figure Legend Snippet: Dgcr8 deficiency affects AHP proliferation in the adult dentate gyrus. A , Immunolocalization of neural stem and progenitor cells in the brains of 2-month-old Dgcr8 +/+ and Dgcr8 +/− mice. Brain sections were stained with anti-BrdU, anti-Ki67, anti-SOX2, anti-Nestin, anti-GFAP, and anti-DCX antibodies (green, white arrowheads). The second and fourth columns from the left show magnified views of the boxed regions. There were decreased numbers of Ki67-, SOX2-, GFAP-, Nestin-, and DCX-positive cells in the brain of Dgcr8 +/− mice compared with those in Dgcr8 +/+ mice. The nuclei were stained with DAPI (blue). Scale bar, 50 μm. B–D , Quantitative analysis of BrdU-, Ki67-, or SOX2-positive cells in the SGZ. The numbers of BrdU-, Ki67-, and SOX2-positive cells (10 sections per animal) were significantly smaller in the Dgcr8 +/− mouse hippocampal dentate gyrus (* p

    Techniques Used: Mouse Assay, Staining

    Dgcr8 deficiency does not affect NSC proliferation in the adult SVZ. A , Immunolocalization of neural stem and progenitor cells in the ventrolateral SVZ of 2-month-old Dgcr8 +/+ and Dgcr8 +/− mice. Brain sections were stained with anti-BrdU, anti-Nestin, and anti-GFAP antibodies (green). The nuclei were stained with DAPI (blue). Scale bar, 100 μm. B , Quantitative analysis of the number of BrdU-positive cells in the ventrolateral SVZ. For quantitation, BrdU-positive cells were counted over five unbiased images of ventrolateral SVZ at 20× magnification per animal in five animals for each genotype. C , Neurosphere cultures derived from the adult SVZ of Dgcr8 +/− or Dgcr8 +/+ mice. Top row, Bright-field images of adult SVZ neurospheres grown in the presence of bFGF and EGF. Note that the sphere size was not affected by Dgcr8 deficiency. Bottom row, Immunofluorescent microscopy image showing the expression of SOX2 (green) in the neurosphere. The nuclei were stained with DAPI (blue). Scale bar, 100 μm. D , Quantitative analysis of the number and size of neurospheres derived from the adult SVZ of Dgcr8 +/− or Dgcr8 +/+ mice ( n = 3 each). Note that the number and size of neurosphere were not affected by Dgcr8 deficiency.
    Figure Legend Snippet: Dgcr8 deficiency does not affect NSC proliferation in the adult SVZ. A , Immunolocalization of neural stem and progenitor cells in the ventrolateral SVZ of 2-month-old Dgcr8 +/+ and Dgcr8 +/− mice. Brain sections were stained with anti-BrdU, anti-Nestin, and anti-GFAP antibodies (green). The nuclei were stained with DAPI (blue). Scale bar, 100 μm. B , Quantitative analysis of the number of BrdU-positive cells in the ventrolateral SVZ. For quantitation, BrdU-positive cells were counted over five unbiased images of ventrolateral SVZ at 20× magnification per animal in five animals for each genotype. C , Neurosphere cultures derived from the adult SVZ of Dgcr8 +/− or Dgcr8 +/+ mice. Top row, Bright-field images of adult SVZ neurospheres grown in the presence of bFGF and EGF. Note that the sphere size was not affected by Dgcr8 deficiency. Bottom row, Immunofluorescent microscopy image showing the expression of SOX2 (green) in the neurosphere. The nuclei were stained with DAPI (blue). Scale bar, 100 μm. D , Quantitative analysis of the number and size of neurospheres derived from the adult SVZ of Dgcr8 +/− or Dgcr8 +/+ mice ( n = 3 each). Note that the number and size of neurosphere were not affected by Dgcr8 deficiency.

    Techniques Used: Mouse Assay, Staining, Quantitation Assay, Derivative Assay, Microscopy, Expressing

    8) Product Images from "The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice"

    Article Title: The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice

    Journal: Scientific Reports

    doi: 10.1038/srep32463

    Pluripotent stem cell features of ciPSCs and differentiation in vivo . ( A ) RT-PCR analysis of the expression of undifferentiated pluripotent marker genes in ciPSCs. ( B ) Immunostaining of iPS cells for cell surface markers, including SSEA-4, TRA-1-60, and SOX2, scale bar, 20 μm. ( C ) Teratomas that formed eight weeks after injection of iPSCs contained tissues from all three types of germ layers (endoderm, mesoderm, and ectoderm). Scale bars, 100 μm. ( D ) Morphologies of the HSCs of cell lines co-cultured with OP9 stromal cells. ( E ) Flow cytometry analysis results confirm HSC formation in vitro .
    Figure Legend Snippet: Pluripotent stem cell features of ciPSCs and differentiation in vivo . ( A ) RT-PCR analysis of the expression of undifferentiated pluripotent marker genes in ciPSCs. ( B ) Immunostaining of iPS cells for cell surface markers, including SSEA-4, TRA-1-60, and SOX2, scale bar, 20 μm. ( C ) Teratomas that formed eight weeks after injection of iPSCs contained tissues from all three types of germ layers (endoderm, mesoderm, and ectoderm). Scale bars, 100 μm. ( D ) Morphologies of the HSCs of cell lines co-cultured with OP9 stromal cells. ( E ) Flow cytometry analysis results confirm HSC formation in vitro .

    Techniques Used: In Vivo, Reverse Transcription Polymerase Chain Reaction, Expressing, Marker, Immunostaining, Injection, Cell Culture, Flow Cytometry, Cytometry, In Vitro

    9) Product Images from "Conversion of Partially Reprogrammed Cells to Fully Pluripotent Stem Cells Is Associated with Further Activation of Stem Cell Maintenance- and Gamete Generation-Related Genes"

    Article Title: Conversion of Partially Reprogrammed Cells to Fully Pluripotent Stem Cells Is Associated with Further Activation of Stem Cell Maintenance- and Gamete Generation-Related Genes

    Journal: Stem Cells and Development

    doi: 10.1089/scd.2014.0020

    Generation of induced pluripotent stem (iPS) cells using pCX-OSK (Oct4, Sox2, and Klf4) and pCX-cMyc. (A) Schematic representation of iPS cell generation using pCX-OSK and pCX-cMyc. (B) Detection of genomic integration of exogenous Klf4 and c-Myc by PCR.
    Figure Legend Snippet: Generation of induced pluripotent stem (iPS) cells using pCX-OSK (Oct4, Sox2, and Klf4) and pCX-cMyc. (A) Schematic representation of iPS cell generation using pCX-OSK and pCX-cMyc. (B) Detection of genomic integration of exogenous Klf4 and c-Myc by PCR.

    Techniques Used: Polymerase Chain Reaction

    10) Product Images from "Abnormal differentiation of Sandhoff disease model mouse-derived multipotent stem cells toward a neural lineage"

    Article Title: Abnormal differentiation of Sandhoff disease model mouse-derived multipotent stem cells toward a neural lineage

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0178978

    Characterization of NSCs derived from the fetal brain of the mouse SD model. (A−D) Characterization of neurospheres isolated from cerebral cortices of Hexb +/− and Hexb −/− mice at embryonic day 12.5. For each sample, 20 images of different fields (1.3 × 1.8 mm) were photographed, and the areas (A, C) and numbers (B, D) of primary (A, B) and secondary (C, D) neurospheres cultured for 4 days were measured. (E−H) Expression pattern of primary neurospheres isolated from cerebral cortices at embryonic day 12.5 of Hexb +/− and Hexb −/− mice. (E) Primary neurospheres were collected on poly-L-ornithine/fibronectin-coated glass slides by cytospin centrifugation, fixed, and immunostained for nestin (green), Sox2 (red), βIII tubulin (green), and GFAP (red). Blue represents DAPI staining. The scale bar indicates 100 μm. (F−H) Primary neurospheres were dissociated mechanically to single-cell suspensions. Cells were plated onto poly-L-ornithine/fibronectin-coated glass coverslips. One hour after plating, cells were fixed and immunostained for nestin, βIII tubulin, and GFAP with DAPI nuclear staining. For each sample, 20 fluorescence images of different fields (1.3 × 1.8 mm) were obtained. The percentages of positive cells (% of total DAPI count) were then determined using ImageJ (National Institutes of Health, Bethesda, MD). The percentages of NSCs (F), neurons (G), and astrocytes (H) were measured. Values represent the mean ± S.E. of five independent experiments. n.s.: Not significantly different ( P > 0.05), * P
    Figure Legend Snippet: Characterization of NSCs derived from the fetal brain of the mouse SD model. (A−D) Characterization of neurospheres isolated from cerebral cortices of Hexb +/− and Hexb −/− mice at embryonic day 12.5. For each sample, 20 images of different fields (1.3 × 1.8 mm) were photographed, and the areas (A, C) and numbers (B, D) of primary (A, B) and secondary (C, D) neurospheres cultured for 4 days were measured. (E−H) Expression pattern of primary neurospheres isolated from cerebral cortices at embryonic day 12.5 of Hexb +/− and Hexb −/− mice. (E) Primary neurospheres were collected on poly-L-ornithine/fibronectin-coated glass slides by cytospin centrifugation, fixed, and immunostained for nestin (green), Sox2 (red), βIII tubulin (green), and GFAP (red). Blue represents DAPI staining. The scale bar indicates 100 μm. (F−H) Primary neurospheres were dissociated mechanically to single-cell suspensions. Cells were plated onto poly-L-ornithine/fibronectin-coated glass coverslips. One hour after plating, cells were fixed and immunostained for nestin, βIII tubulin, and GFAP with DAPI nuclear staining. For each sample, 20 fluorescence images of different fields (1.3 × 1.8 mm) were obtained. The percentages of positive cells (% of total DAPI count) were then determined using ImageJ (National Institutes of Health, Bethesda, MD). The percentages of NSCs (F), neurons (G), and astrocytes (H) were measured. Values represent the mean ± S.E. of five independent experiments. n.s.: Not significantly different ( P > 0.05), * P

    Techniques Used: Derivative Assay, Isolation, Mouse Assay, Cell Culture, Expressing, Centrifugation, Staining, Fluorescence

    Immunocytochemical characterization of SDIA-induced colonies. (A and B) SDIA-induced WT-iPSC and SD-iPSC (with or without miglustat) colonies were fixed, and immunostained for nestin (green), Sox2 (red), βIII tubulin (green), and GFAP (red). Blue represents DAPI staining. The scale bar indicates 100 μm. (C−E) SDIA-induced colonies were dissociated mechanically to single-cell suspensions. The cells were plated onto poly-L-ornithine/fibronectin-coated glass coverslips. One hour after plating, the cells were fixed and immunostained for nestin, βIII tubulin, and GFAP with DAPI nuclear staining. For each sample, 20 fluorescence images of different fields (1.3 × 1.8 mm) were obtained. The percentages (% of total DAPI count) of NSCs (C), neurons (D), and astrocytes (E) were evaluated. (F) One hour after plating, proliferating NSCs were determined by using the Click-iT EdU Alexa Fluor 488 Imaging kit (green) ( S3 Fig ). EdU/nestin double-positive cells were counted using the IN Cell Analyzer 2200. Values represent the mean ± S.E. of five independent experiments. Not significantly different ( P > 0.05), * P
    Figure Legend Snippet: Immunocytochemical characterization of SDIA-induced colonies. (A and B) SDIA-induced WT-iPSC and SD-iPSC (with or without miglustat) colonies were fixed, and immunostained for nestin (green), Sox2 (red), βIII tubulin (green), and GFAP (red). Blue represents DAPI staining. The scale bar indicates 100 μm. (C−E) SDIA-induced colonies were dissociated mechanically to single-cell suspensions. The cells were plated onto poly-L-ornithine/fibronectin-coated glass coverslips. One hour after plating, the cells were fixed and immunostained for nestin, βIII tubulin, and GFAP with DAPI nuclear staining. For each sample, 20 fluorescence images of different fields (1.3 × 1.8 mm) were obtained. The percentages (% of total DAPI count) of NSCs (C), neurons (D), and astrocytes (E) were evaluated. (F) One hour after plating, proliferating NSCs were determined by using the Click-iT EdU Alexa Fluor 488 Imaging kit (green) ( S3 Fig ). EdU/nestin double-positive cells were counted using the IN Cell Analyzer 2200. Values represent the mean ± S.E. of five independent experiments. Not significantly different ( P > 0.05), * P

    Techniques Used: Staining, Fluorescence, Imaging

    11) Product Images from "Borna Disease Virus Phosphoprotein Impairs the Developmental Program Controlling Neurogenesis and Reduces Human GABAergic Neurogenesis"

    Article Title: Borna Disease Virus Phosphoprotein Impairs the Developmental Program Controlling Neurogenesis and Reduces Human GABAergic Neurogenesis

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1004859

    Expression of bdv-p or bdv-x gene does not alter hNPCs at the undifferentiated stage. RNAs from bdv-p- and bdv-x -expressing hNPCs and their matched NT controls were analyzed by RT-qPCR for expression of (A) Nestin and (B) Sox2. Proliferation of bdv-p and bdv-x -expressing hNPCs was analyzed by BrdU labeling (C) and by a mitochondrial dehydrogenase activity-based assay (D and E) in the presence of growth factors and by enumeration of DAPI-positive cells (F and G) in the absence of growth factors. Results in A and B are representative of two independent experiments performed in triplicate. Results in C represent the mean of two independent experiments performed in quintuplicate. Results in D and E are representative of 2 independent experiments performed in quintuplicate. Results in F and G are from 1 experiment performed in triplicate. Statistical analyses were performed using the Mann-Whitney test. ns , non-significant (p > 0.5).
    Figure Legend Snippet: Expression of bdv-p or bdv-x gene does not alter hNPCs at the undifferentiated stage. RNAs from bdv-p- and bdv-x -expressing hNPCs and their matched NT controls were analyzed by RT-qPCR for expression of (A) Nestin and (B) Sox2. Proliferation of bdv-p and bdv-x -expressing hNPCs was analyzed by BrdU labeling (C) and by a mitochondrial dehydrogenase activity-based assay (D and E) in the presence of growth factors and by enumeration of DAPI-positive cells (F and G) in the absence of growth factors. Results in A and B are representative of two independent experiments performed in triplicate. Results in C represent the mean of two independent experiments performed in quintuplicate. Results in D and E are representative of 2 independent experiments performed in quintuplicate. Results in F and G are from 1 experiment performed in triplicate. Statistical analyses were performed using the Mann-Whitney test. ns , non-significant (p > 0.5).

    Techniques Used: Expressing, Quantitative RT-PCR, Labeling, Activity Assay, MANN-WHITNEY

    bdv-p expression does not alter neuronal specification but induces a reduction in the GABAergic subpopulation. Transduced hNPCs expressing bdv-p and their matched NT controls were induced to differentiate for 0, 7, 10, 14, 21 and 28 days and immunostained with antibodies directed against markers of different stages of differentiation. (A) immunostaining of hNPCs differentiated for 28 days with an anti-Sox2 antibody (green). Nuclei were counterstained with DAPI (blue). Scale bar, 20 μm. Time-course analyses showing the percentage of (B) Sox2-positive cells and (C) HuC/D-positive cells. (D) Immunostaining of hNPCs differentiated for 14 days with antibodies against HuC/D and GABA. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. (E) Time-course analysis showing the percentage of huC/D- and GABA-positive cells in the total neuronal population. Results are representative of 2 (B) and 3 (C and E) independent experiments performed in triplicate. Statistical analyses were performed using the Mann-Whitney test. ***, p
    Figure Legend Snippet: bdv-p expression does not alter neuronal specification but induces a reduction in the GABAergic subpopulation. Transduced hNPCs expressing bdv-p and their matched NT controls were induced to differentiate for 0, 7, 10, 14, 21 and 28 days and immunostained with antibodies directed against markers of different stages of differentiation. (A) immunostaining of hNPCs differentiated for 28 days with an anti-Sox2 antibody (green). Nuclei were counterstained with DAPI (blue). Scale bar, 20 μm. Time-course analyses showing the percentage of (B) Sox2-positive cells and (C) HuC/D-positive cells. (D) Immunostaining of hNPCs differentiated for 14 days with antibodies against HuC/D and GABA. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. (E) Time-course analysis showing the percentage of huC/D- and GABA-positive cells in the total neuronal population. Results are representative of 2 (B) and 3 (C and E) independent experiments performed in triplicate. Statistical analyses were performed using the Mann-Whitney test. ***, p

    Techniques Used: Expressing, Immunostaining, Staining, MANN-WHITNEY

    12) Product Images from "A Novel Mouse Model of Diffuse Intrinsic Pontine Glioma Initiated in Pax3-Expressing Cells"

    Article Title: A Novel Mouse Model of Diffuse Intrinsic Pontine Glioma Initiated in Pax3-Expressing Cells

    Journal: Neoplasia (New York, N.Y.)

    doi: 10.1016/j.neo.2015.12.002

    Pax3-expressing cells in the neonatal mouse pons. Coimmunofluorescence of wild-type P3 mouse dorsal pons (A–D) and ventral pons (E–H) for Pax3 and Sox2 (A and E), Ki67 (B and F), Olig2 (C and G), and Nkx2.2 (D and H). DAPI counterstain is shown to indicate total nuclei. 20 × magnification, scale bar is 50 μm.
    Figure Legend Snippet: Pax3-expressing cells in the neonatal mouse pons. Coimmunofluorescence of wild-type P3 mouse dorsal pons (A–D) and ventral pons (E–H) for Pax3 and Sox2 (A and E), Ki67 (B and F), Olig2 (C and G), and Nkx2.2 (D and H). DAPI counterstain is shown to indicate total nuclei. 20 × magnification, scale bar is 50 μm.

    Techniques Used: Expressing

    Pax3-expressing progenitor cells in the neonatal mouse brainstem. (A) Coimmunofluorescence for Pax3 and Nestin-CFP (using a GFP antibody) was conducted in P3 sections of Nestin-CFPnuc brainstem, and the percentage of Pax3 + cells in each of the indicated brainstem regions that were also Nestin + was calculated as described in the Materials and Methods and in [24] . (B–D) Coimmunofluorescence of wild-type P3 mouse brainstem for Pax3 and Sox2 (B and C) or Ki67 (D and E). DAPI counterstain is shown in (B’–E’) to indicate total nuclei. 20 × magnification (B and D), scale bar is 50 μm; 40 × magnification (C and E), scale bar is 25 μm. White arrows point to examples of double-positive cells.
    Figure Legend Snippet: Pax3-expressing progenitor cells in the neonatal mouse brainstem. (A) Coimmunofluorescence for Pax3 and Nestin-CFP (using a GFP antibody) was conducted in P3 sections of Nestin-CFPnuc brainstem, and the percentage of Pax3 + cells in each of the indicated brainstem regions that were also Nestin + was calculated as described in the Materials and Methods and in [24] . (B–D) Coimmunofluorescence of wild-type P3 mouse brainstem for Pax3 and Sox2 (B and C) or Ki67 (D and E). DAPI counterstain is shown in (B’–E’) to indicate total nuclei. 20 × magnification (B and D), scale bar is 50 μm; 40 × magnification (C and E), scale bar is 25 μm. White arrows point to examples of double-positive cells.

    Techniques Used: Expressing

    13) Product Images from "RER1 enhances carcinogenesis and stemness of pancreatic cancer under hypoxic environment"

    Article Title: RER1 enhances carcinogenesis and stemness of pancreatic cancer under hypoxic environment

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-018-0986-x

    RER1 promotes PC malignance through regulation of EMT and CSC pathway. ( a - c ) RER1 overexpression or knockdown PANC-1 and MIA PaCa-2 cells were subjected to Western blot and qRT-PCR analyses of E-cadherin, N-cadherin, vimentin, snail, claudin-1 and actin. ( d - f ) RER1 overexpression or knockdown PANC-1 and MIA PaCa-2 cells were subjected to Western blot and qRT-PCR analyses of Sox2, Bmi1, Lin28, Nanog and actin. One representative of at least three independent experiments with similar results is shown. *P
    Figure Legend Snippet: RER1 promotes PC malignance through regulation of EMT and CSC pathway. ( a - c ) RER1 overexpression or knockdown PANC-1 and MIA PaCa-2 cells were subjected to Western blot and qRT-PCR analyses of E-cadherin, N-cadherin, vimentin, snail, claudin-1 and actin. ( d - f ) RER1 overexpression or knockdown PANC-1 and MIA PaCa-2 cells were subjected to Western blot and qRT-PCR analyses of Sox2, Bmi1, Lin28, Nanog and actin. One representative of at least three independent experiments with similar results is shown. *P

    Techniques Used: Over Expression, Western Blot, Quantitative RT-PCR

    14) Product Images from "Large cell anaplastic medulloblastoma metastatic to the scalp: tumor and derived stem-like cells features"

    Article Title: Large cell anaplastic medulloblastoma metastatic to the scalp: tumor and derived stem-like cells features

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-14-262

    Molecular characteristics of MBL and derived stem like cells. (A) Heat map showing mRNA levels of the indicated genes in primary MBL (pMBL), scalp (M1) and neck (M2) metastases compared to normal cerebella (average of n = 8) as control (CTRLs). Genes are grouped depending on the molecular subgroups, which they identify (SHH, WNT, GROUP-3, GROUP-4). A green-red colour scale depicts normalized Delta Ct values (green, lower expression, red, higher expression). (B-C) Flow cytometry analysis (FACS) of CD133 in the starting population from neck metastasis (hMED bulk) (B) and after 14 days of culture (C) (isotypic control not shown). P3 shows percentage of positive cells while P4 shows percentage of negative cells. (D) Representative bright field image of neurospheres derived from neck metastasis after 14 days of culture. (E) Histograms showing mRNA levels of CD133 in MBL-neck metastasis (bulk) and in its derived SLC compared to normal cerebella as control (CTRLs). (F) Immunofluorescence staining with anti-Nestin and anti-Sox2 (green), Hoechst staining (blue) and merge of SLC. Scale bar = 5 μm for all panels. (G) Heat maps of expression levels of the indicated genes belonging to the highlighted categories in: pMBL, metastases (M1 and M2), in SLC derived from M2 and in normal adult cerebella as control (CTRLs). A green-red colour scale depicts normalized Delta Ct values (green, lower expression, red, higher expression).
    Figure Legend Snippet: Molecular characteristics of MBL and derived stem like cells. (A) Heat map showing mRNA levels of the indicated genes in primary MBL (pMBL), scalp (M1) and neck (M2) metastases compared to normal cerebella (average of n = 8) as control (CTRLs). Genes are grouped depending on the molecular subgroups, which they identify (SHH, WNT, GROUP-3, GROUP-4). A green-red colour scale depicts normalized Delta Ct values (green, lower expression, red, higher expression). (B-C) Flow cytometry analysis (FACS) of CD133 in the starting population from neck metastasis (hMED bulk) (B) and after 14 days of culture (C) (isotypic control not shown). P3 shows percentage of positive cells while P4 shows percentage of negative cells. (D) Representative bright field image of neurospheres derived from neck metastasis after 14 days of culture. (E) Histograms showing mRNA levels of CD133 in MBL-neck metastasis (bulk) and in its derived SLC compared to normal cerebella as control (CTRLs). (F) Immunofluorescence staining with anti-Nestin and anti-Sox2 (green), Hoechst staining (blue) and merge of SLC. Scale bar = 5 μm for all panels. (G) Heat maps of expression levels of the indicated genes belonging to the highlighted categories in: pMBL, metastases (M1 and M2), in SLC derived from M2 and in normal adult cerebella as control (CTRLs). A green-red colour scale depicts normalized Delta Ct values (green, lower expression, red, higher expression).

    Techniques Used: Derivative Assay, Expressing, Flow Cytometry, Cytometry, FACS, Immunofluorescence, Staining

    15) Product Images from "Prognostic significance of KLF4 expression in gastric cancer"

    Article Title: Prognostic significance of KLF4 expression in gastric cancer

    Journal: Oncology Letters

    doi: 10.3892/ol.2016.5499

    Immunohistochemical analysis of pluripotency-inducing factors in human gastric cancers. Immunohistochemistry was performed using antibodies against KLF4, Nanog, Oct4, SOX2 and c-Myc on tissue microarray slides. Representative slides are shown (circular
    Figure Legend Snippet: Immunohistochemical analysis of pluripotency-inducing factors in human gastric cancers. Immunohistochemistry was performed using antibodies against KLF4, Nanog, Oct4, SOX2 and c-Myc on tissue microarray slides. Representative slides are shown (circular

    Techniques Used: Immunohistochemistry, Microarray

    Overall survival rates of gastric cancer patients according to the expression of (A) KLF4, (B) Oct4, (C) Nanog, (D) c-Myc and (E) SOX2. Kaplan-Meier analysis revealed a significantly less favorable overall survival rate in patients with low KLF4 expression
    Figure Legend Snippet: Overall survival rates of gastric cancer patients according to the expression of (A) KLF4, (B) Oct4, (C) Nanog, (D) c-Myc and (E) SOX2. Kaplan-Meier analysis revealed a significantly less favorable overall survival rate in patients with low KLF4 expression

    Techniques Used: Expressing

    16) Product Images from "Incomplete and delayed Sox2 deletion defines residual ear neurosensory development and maintenance"

    Article Title: Incomplete and delayed Sox2 deletion defines residual ear neurosensory development and maintenance

    Journal: Scientific Reports

    doi: 10.1038/srep38253

    Delayed deletion of Sox2 results in the differentiation of some neurosensory cells in the basal cochlear turn and in the vestibular organs. ( a,b ) Sox2 + cells in the Sox2 CKO cochlea are detected only in the base at the age of E14.5 and disappear later in development. ( b ) The strong Sox2 expression domain is shifted toward the GER. Similarly, Myo7a + cells do not differentiate in the proper area of OC. Some weak Sox2 expression remains in the OC area of Sox2 CKO (dotted area). ( c,d ) Variable numbers of HCs (Myo7a + ) and supporting cells (Sox2 + ) develop in the Sox2 CKO vestibular system. ( d ) HCs in the saccule also develop in the area that lacks supporting cells (arrow). ( e–h ) Some poorly differentiated Myo7a + HCs are present in the utricle, saccule and basal turn of the cochlea of the Sox2 CKO at E17.5. ( i–m ) At E18.5, the innervation of mutant cochlea, saccule and utricle is severely reduced and shows an unusual pattern compared to controls. Fibers show mostly directional growth toward remaining HCs but also transient expansion into HC-free regions. ( n ) The quantification of Myo7a positive HCs after whole mount immunostaining shows a striking reduction of HCs in the Sox2 CKO inner ear compared to littermate controls for the utricle (U), saccule (S) and cochlea (Co). Myo7a + HCs were counted after whole mount immunostaining using LAS AF Lite draw counter to avoid counting error. The total number of HCs was determined in the entire utricle and saccule, and in the entire Sox2 CKO cochlea. The number of HCs in the control cochlea represents the total number of HCs in 1.5 mm of the base. The values represent means ± SD (N = 4–7 individuals/group). *P
    Figure Legend Snippet: Delayed deletion of Sox2 results in the differentiation of some neurosensory cells in the basal cochlear turn and in the vestibular organs. ( a,b ) Sox2 + cells in the Sox2 CKO cochlea are detected only in the base at the age of E14.5 and disappear later in development. ( b ) The strong Sox2 expression domain is shifted toward the GER. Similarly, Myo7a + cells do not differentiate in the proper area of OC. Some weak Sox2 expression remains in the OC area of Sox2 CKO (dotted area). ( c,d ) Variable numbers of HCs (Myo7a + ) and supporting cells (Sox2 + ) develop in the Sox2 CKO vestibular system. ( d ) HCs in the saccule also develop in the area that lacks supporting cells (arrow). ( e–h ) Some poorly differentiated Myo7a + HCs are present in the utricle, saccule and basal turn of the cochlea of the Sox2 CKO at E17.5. ( i–m ) At E18.5, the innervation of mutant cochlea, saccule and utricle is severely reduced and shows an unusual pattern compared to controls. Fibers show mostly directional growth toward remaining HCs but also transient expansion into HC-free regions. ( n ) The quantification of Myo7a positive HCs after whole mount immunostaining shows a striking reduction of HCs in the Sox2 CKO inner ear compared to littermate controls for the utricle (U), saccule (S) and cochlea (Co). Myo7a + HCs were counted after whole mount immunostaining using LAS AF Lite draw counter to avoid counting error. The total number of HCs was determined in the entire utricle and saccule, and in the entire Sox2 CKO cochlea. The number of HCs in the control cochlea represents the total number of HCs in 1.5 mm of the base. The values represent means ± SD (N = 4–7 individuals/group). *P

    Techniques Used: Expressing, Mutagenesis, Immunostaining

    Summary of Sox2 CKO inner ear changes. Sox2 deletion by Isl1-cre results in profound morphological changes at E14.5: all three cristae of the semicircular canal ampullae are missing, all remaining sensory organs are smaller and have a decreased size of the sensory area. Neuronal formation is eliminated in the apex of the cochlea, whereas vestibular and basal turn neurons gradually die due to limited support by the reduced sensory epithelia. Loss of innervation toward all epithelia except for the apex of the cochlea is secondary to the lack or reduced differentiation of HCs, which is either completely absent in the apex and semicircular canal cristae, or variably disabled in the base of the cochlea, utricle, and saccule. Many HCs have an unusual neurosensory phenotype. Similarly, supporting cells (SCs) have atypical features, altered expression of markers, and abnormal distribution, forming the aberrant organ of Corti. Many ectopic HCs and SCs are also found in the cochlear base. The spatial distribution of Sox2 expression is shown in green, blue color shows neurons, and red depicts HCs. AC, anterior crista; CVG, cochleovestibular ganglion; HC, horizontal crista; HCs, hair cells; PC, posterior crista; S, saccule; SCs, supporting cells; SG, spiral ganglion; U, utricle; VG, vestibular ganglion.
    Figure Legend Snippet: Summary of Sox2 CKO inner ear changes. Sox2 deletion by Isl1-cre results in profound morphological changes at E14.5: all three cristae of the semicircular canal ampullae are missing, all remaining sensory organs are smaller and have a decreased size of the sensory area. Neuronal formation is eliminated in the apex of the cochlea, whereas vestibular and basal turn neurons gradually die due to limited support by the reduced sensory epithelia. Loss of innervation toward all epithelia except for the apex of the cochlea is secondary to the lack or reduced differentiation of HCs, which is either completely absent in the apex and semicircular canal cristae, or variably disabled in the base of the cochlea, utricle, and saccule. Many HCs have an unusual neurosensory phenotype. Similarly, supporting cells (SCs) have atypical features, altered expression of markers, and abnormal distribution, forming the aberrant organ of Corti. Many ectopic HCs and SCs are also found in the cochlear base. The spatial distribution of Sox2 expression is shown in green, blue color shows neurons, and red depicts HCs. AC, anterior crista; CVG, cochleovestibular ganglion; HC, horizontal crista; HCs, hair cells; PC, posterior crista; S, saccule; SCs, supporting cells; SG, spiral ganglion; U, utricle; VG, vestibular ganglion.

    Techniques Used: Expressing

    Isl1-cre mediated Sox2 loss disrupts neuron formation and results in massive neuronal degeneration by activation of Caspase3. ( a,b ) Immunofluorescence staining of neurofilament in the Sox2 CKO shows similar formation of vestibular neurons at E11.5 compared to controls. ( a’,b’ ) At E13.5, fibers are aberrantly projecting toward the utricle (or combined utricle and anterior and horizontal canal cristae) and posterior canal cristae of the Sox2 CKO. ( a”,b”,a”’,b”’ ) Fibers to the posterior canal crista start to retract in the absence of target HCs starting at E14.5 in the mutant. ( b”’ ) Only a few radial fibers are formed near the base of the E15.5 Sox2 CKO cochlea. ( c, c’, d,d’ ) Immunofluorescence of activated Caspase3 reveals positive staining restricted mainly in the VG in the E11.5 Sox2 CKO comparable to the control littermates. ( c”,c”’,d”,d”’ ) However, Caspase3 mediated cell death is massively progressed to IVG, SVG, and SG at E15.5 compared to no caspase positive cells in the control littermates. Scale bars: 100 μm. AC, anterior canal crista; CD, cochlear duct; FN, facial nerve; HS, Hoechst nuclear stain; IGSB, intraganglionic spiral bundle; IVG, inferior vestibular ganglion; IN, intermediate nerve; HC, horizontal canal crista; PC, posterior canal crista; S, saccule; SG, spiral ganglion; SVG, superior vestibular ganglion; U, utricle; VG, vestibular ganglia.
    Figure Legend Snippet: Isl1-cre mediated Sox2 loss disrupts neuron formation and results in massive neuronal degeneration by activation of Caspase3. ( a,b ) Immunofluorescence staining of neurofilament in the Sox2 CKO shows similar formation of vestibular neurons at E11.5 compared to controls. ( a’,b’ ) At E13.5, fibers are aberrantly projecting toward the utricle (or combined utricle and anterior and horizontal canal cristae) and posterior canal cristae of the Sox2 CKO. ( a”,b”,a”’,b”’ ) Fibers to the posterior canal crista start to retract in the absence of target HCs starting at E14.5 in the mutant. ( b”’ ) Only a few radial fibers are formed near the base of the E15.5 Sox2 CKO cochlea. ( c, c’, d,d’ ) Immunofluorescence of activated Caspase3 reveals positive staining restricted mainly in the VG in the E11.5 Sox2 CKO comparable to the control littermates. ( c”,c”’,d”,d”’ ) However, Caspase3 mediated cell death is massively progressed to IVG, SVG, and SG at E15.5 compared to no caspase positive cells in the control littermates. Scale bars: 100 μm. AC, anterior canal crista; CD, cochlear duct; FN, facial nerve; HS, Hoechst nuclear stain; IGSB, intraganglionic spiral bundle; IVG, inferior vestibular ganglion; IN, intermediate nerve; HC, horizontal canal crista; PC, posterior canal crista; S, saccule; SG, spiral ganglion; SVG, superior vestibular ganglion; U, utricle; VG, vestibular ganglia.

    Techniques Used: Activation Assay, Immunofluorescence, Staining, Mutagenesis

    Loss of Sox2 affects downstream gene expression in the organ of Corti. ( a,a’, b,b’ ) Atoh1 expression is dramatically reduced in Sox2 CKO mice at E18.5. ( a”,b” ) Atoh1 ISH signal converting into a fluorescent signal shows the relative topology to the inner pillar cell marker p75. Note that the scattered HCs are found medial and lateral to p75 positive cells (white arrows; b”). However, p75 expression (arrows) is discontinuous in the base ( b”,f,f’ ) and absent in the apex compared to prominent labeling in the inner pillar cells and the spiral ganglion neurons in control animals ( e,e’ ). ( c , d ) Another supporting cell marker, Hes5 , shows no expression at all in the Sox2 CKO mice at E18.5. Scale bars: 100 μm. GER, greater epithelial ridge; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant; SL, spiral limbus.
    Figure Legend Snippet: Loss of Sox2 affects downstream gene expression in the organ of Corti. ( a,a’, b,b’ ) Atoh1 expression is dramatically reduced in Sox2 CKO mice at E18.5. ( a”,b” ) Atoh1 ISH signal converting into a fluorescent signal shows the relative topology to the inner pillar cell marker p75. Note that the scattered HCs are found medial and lateral to p75 positive cells (white arrows; b”). However, p75 expression (arrows) is discontinuous in the base ( b”,f,f’ ) and absent in the apex compared to prominent labeling in the inner pillar cells and the spiral ganglion neurons in control animals ( e,e’ ). ( c , d ) Another supporting cell marker, Hes5 , shows no expression at all in the Sox2 CKO mice at E18.5. Scale bars: 100 μm. GER, greater epithelial ridge; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant; SL, spiral limbus.

    Techniques Used: Expressing, Mouse Assay, In Situ Hybridization, Marker, Labeling, Mutagenesis

    Aberrant HCs in ectopic topology and abnormal pillar cells are formed in the Sox2 CKO. Patches of HCs in the base of the E18.5 Sox2 CKO cochlea are covered by a tectorial membrane with HCs in the topology of inner HCs displaying both large diameter ( a,a’ ) and small diameter ( a,a” ) stereocilia reminiscent of inner and outer HCs, respectively. ( b ) Vestibular HCs show normal organization of stereocilia but many display variability in stereocilia diameter in a single HC, normally associated with either type I or type II vestibular HCs. ( c-d’ ) Scattered Myo7a positive HCs are detected in the area corresponding topologically to the organ of Corti (OC); however, forming atypical organ of Corti (“OC”) in the mutant. Immunostaining of Myo7a reveals formation of HCs in the ectopic topologies, medial to OC, in the GER, as well as lateral to OC (in the area of Hensen/Claudius cells) (white arrows) in addition to the area of “OC” in the E18.5 Sox2 CKO. ( e-f” ) The combination of p75 and Myo7a immunolabeling shows an unusual configuration and distribution of p75 positive cells near the remaining Myo7a positive HCs in E18.5 Sox2 CKO compared to the single row of p75 + inner pillar cells in control littermates ( e ). Scale bars: 10 μm (a,e-f”), 1 μm (a’,a”,b), 100 μm (c-d’). GER, greater epithelial ridge; H/Cl, Hensen/Claudius cells; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant; SL, spiral limbus.
    Figure Legend Snippet: Aberrant HCs in ectopic topology and abnormal pillar cells are formed in the Sox2 CKO. Patches of HCs in the base of the E18.5 Sox2 CKO cochlea are covered by a tectorial membrane with HCs in the topology of inner HCs displaying both large diameter ( a,a’ ) and small diameter ( a,a” ) stereocilia reminiscent of inner and outer HCs, respectively. ( b ) Vestibular HCs show normal organization of stereocilia but many display variability in stereocilia diameter in a single HC, normally associated with either type I or type II vestibular HCs. ( c-d’ ) Scattered Myo7a positive HCs are detected in the area corresponding topologically to the organ of Corti (OC); however, forming atypical organ of Corti (“OC”) in the mutant. Immunostaining of Myo7a reveals formation of HCs in the ectopic topologies, medial to OC, in the GER, as well as lateral to OC (in the area of Hensen/Claudius cells) (white arrows) in addition to the area of “OC” in the E18.5 Sox2 CKO. ( e-f” ) The combination of p75 and Myo7a immunolabeling shows an unusual configuration and distribution of p75 positive cells near the remaining Myo7a positive HCs in E18.5 Sox2 CKO compared to the single row of p75 + inner pillar cells in control littermates ( e ). Scale bars: 10 μm (a,e-f”), 1 μm (a’,a”,b), 100 μm (c-d’). GER, greater epithelial ridge; H/Cl, Hensen/Claudius cells; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant; SL, spiral limbus.

    Techniques Used: Mutagenesis, Immunostaining, Immunolabeling

    Some HCs are positive for both Myo7a and tubulin. These single or groups of Myo7a positive HCs of E18.5 Sox2 CKO mice show a patchy distribution ( a , b , c ) and an unusual pattern of innervation ( a’,b’,c’ ). Note that most fibers are targeted toward Myo7a positive HCs, others are sometimes widely distributed in the topological equivalent of the organ of Corti. ( a”,b”,c” ) Some Myo7a positive cells are also positive for antibody directed against tubulin, normally a reliable neuronal marker in the ear. Scale bars: 100 μm, except b,b” that indicates 10 μm.
    Figure Legend Snippet: Some HCs are positive for both Myo7a and tubulin. These single or groups of Myo7a positive HCs of E18.5 Sox2 CKO mice show a patchy distribution ( a , b , c ) and an unusual pattern of innervation ( a’,b’,c’ ). Note that most fibers are targeted toward Myo7a positive HCs, others are sometimes widely distributed in the topological equivalent of the organ of Corti. ( a”,b”,c” ) Some Myo7a positive cells are also positive for antibody directed against tubulin, normally a reliable neuronal marker in the ear. Scale bars: 100 μm, except b,b” that indicates 10 μm.

    Techniques Used: Mouse Assay, Marker

    Altered morphology of the Sox2 CKO inner ear. ( a-b’ ) 3D-reconstruction reveals severe changes in the developing inner ear at E12.5 and E14.5. ( b,b’ ) No ampullae of semicircular canals and only rudiments of the posterior and anterior semicircular canals are present in Sox2 CKO. The utricle and saccule are smaller. ( a’,b’ ) The cochlear duct (cd) has decreased coiling and is shorter compared to controls. ( c – f ) Scanning electron microscopy shows a few individual cells and small clumps of cells with a hair cell-like phenotype in the base of the Sox2 CKO cochlea (arrows). ( d ) The rest of the organ of Corti is missing as shown by the overview of the whole cd width and by magnification of the sensory epithelium area. ( d’ ) HCs vary in size, orientation and bundle organization. ( e , f ) The cellular phenotype of differentiated HCs in the Sox2 CKO utricle is comparable to controls. aa, anterior ampulla; asc, anterior semicircular canal; cd, cochlear duct; ed, endolymphatic duct; la, lateral ampulla; lsc, lateral semicircular canal; pa, posterior ampulla; psc, posterior semicircular canal; sac, saccule; ut, utricle; OHC, outer hair cells; IHC, inner hair cells. Scale bars: 50 μm (c,d), 5 μm (c’,d’,e,f).
    Figure Legend Snippet: Altered morphology of the Sox2 CKO inner ear. ( a-b’ ) 3D-reconstruction reveals severe changes in the developing inner ear at E12.5 and E14.5. ( b,b’ ) No ampullae of semicircular canals and only rudiments of the posterior and anterior semicircular canals are present in Sox2 CKO. The utricle and saccule are smaller. ( a’,b’ ) The cochlear duct (cd) has decreased coiling and is shorter compared to controls. ( c – f ) Scanning electron microscopy shows a few individual cells and small clumps of cells with a hair cell-like phenotype in the base of the Sox2 CKO cochlea (arrows). ( d ) The rest of the organ of Corti is missing as shown by the overview of the whole cd width and by magnification of the sensory epithelium area. ( d’ ) HCs vary in size, orientation and bundle organization. ( e , f ) The cellular phenotype of differentiated HCs in the Sox2 CKO utricle is comparable to controls. aa, anterior ampulla; asc, anterior semicircular canal; cd, cochlear duct; ed, endolymphatic duct; la, lateral ampulla; lsc, lateral semicircular canal; pa, posterior ampulla; psc, posterior semicircular canal; sac, saccule; ut, utricle; OHC, outer hair cells; IHC, inner hair cells. Scale bars: 50 μm (c,d), 5 μm (c’,d’,e,f).

    Techniques Used: Electron Microscopy, Immunohistochemistry

    The cellular boundaries of the inner ear are changed in the Sox2 CKO. ( a,a’, b,b’ ) Loss of Sox2 results in aberration of Bmp4 expression. Instead of being separated by the organ of Corti from the GER, Bmp4 expression is adjacent to the GER. ( b, b’,b” ) Only the base shows rings of lateral Bmp4 expression and Myo7a positive HCs are both in the center of these rings as well as at the boundary between GER and Bmp4 domain (b”; yellow asterisks). ( a’-a” ) In controls, the Bmp 4 expression in Hensen/Claudius cells is always lateral to the organ of Corti. Scale bars: 10 μm except 100 μm in a and b. GER, greater epithelial ridge; H/Cl; Hensen/Claudius cells; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant.
    Figure Legend Snippet: The cellular boundaries of the inner ear are changed in the Sox2 CKO. ( a,a’, b,b’ ) Loss of Sox2 results in aberration of Bmp4 expression. Instead of being separated by the organ of Corti from the GER, Bmp4 expression is adjacent to the GER. ( b, b’,b” ) Only the base shows rings of lateral Bmp4 expression and Myo7a positive HCs are both in the center of these rings as well as at the boundary between GER and Bmp4 domain (b”; yellow asterisks). ( a’-a” ) In controls, the Bmp 4 expression in Hensen/Claudius cells is always lateral to the organ of Corti. Scale bars: 10 μm except 100 μm in a and b. GER, greater epithelial ridge; H/Cl; Hensen/Claudius cells; OC, organ of Corti; “OC”, atypical organ of Corti in the mutant.

    Techniques Used: Expressing, Mutagenesis

    17) Product Images from "Functional and mechanistic studies of XPC DNA-repair complex as transcriptional coactivator in embryonic stem cells"

    Article Title: Functional and mechanistic studies of XPC DNA-repair complex as transcriptional coactivator in embryonic stem cells

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1505569112

    OCT4 and SOX2 independently interact with XPC. ( A ), and of the truncations used below. OCT4- and SOX2-interaction domains as inferred by truncation experiments
    Figure Legend Snippet: OCT4 and SOX2 independently interact with XPC. ( A ), and of the truncations used below. OCT4- and SOX2-interaction domains as inferred by truncation experiments

    Techniques Used:

    SCC interacts with OCT4/SOX2 mainly via XPC. ( A–D ) Pull-down assays with XPC ( A ), RAD23B ( B ), SOX2 ( C ), and OCT4 ( D ) antibodies in 293T overexpressing different combinations of SOX2, OCT4, XPC, and RAD23B FLAG-tagged proteins, followed by immunoblotting
    Figure Legend Snippet: SCC interacts with OCT4/SOX2 mainly via XPC. ( A–D ) Pull-down assays with XPC ( A ), RAD23B ( B ), SOX2 ( C ), and OCT4 ( D ) antibodies in 293T overexpressing different combinations of SOX2, OCT4, XPC, and RAD23B FLAG-tagged proteins, followed by immunoblotting

    Techniques Used:

    RAD23B and OCT4/SOX2 extensively colocalize in mESCs. ( A ) binding sites in D3 mESCs. RAD23B peaks are split in two groups depending on their enrichment over IgG
    Figure Legend Snippet: RAD23B and OCT4/SOX2 extensively colocalize in mESCs. ( A ) binding sites in D3 mESCs. RAD23B peaks are split in two groups depending on their enrichment over IgG

    Techniques Used: Binding Assay

    RAD23B recruitment follows OCT4/SOX2 binding. ( A ) Immunoblotting of D3 mESCs at different time points after lentiviral-mediated knockdown (KD) of OCT4. KD3 and KD4 constructs were chosen for further analyses. Uninfected cells (–) control for knockdown
    Figure Legend Snippet: RAD23B recruitment follows OCT4/SOX2 binding. ( A ) Immunoblotting of D3 mESCs at different time points after lentiviral-mediated knockdown (KD) of OCT4. KD3 and KD4 constructs were chosen for further analyses. Uninfected cells (–) control for knockdown

    Techniques Used: Binding Assay, Construct

    18) Product Images from "iPSC Modeling of Presenilin1 Mutation in Alzheimer's Disease with Cerebellar Ataxia"

    Article Title: iPSC Modeling of Presenilin1 Mutation in Alzheimer's Disease with Cerebellar Ataxia

    Journal: Experimental Neurobiology

    doi: 10.5607/en.2018.27.5.350

    Generation of iPSCs from an AD patient harboring a PSEN1 (E120K) mutation, and an eldely normal subject. (A) Established iPSC lines from both control and PS1-E120K patient showing the expression of pluripotent stem cell markers, such as OCT4 (red), SOX2 (green), SSEA4 (red) and TRA-1-81 (red). (B) Reverse transcription PCR (RT-PCR) showing the expression of pluripotency markers (OCT4, SOX2, NANOG, SSEA4 AND TRA-1-81) in both iPSC lines. (C) Genomic DNA sequences showing the presence of the heterozygous E120K mutation (GAA to AAA) in the PSEN1 gene of the PS1-E120K-iPSC line. (D) Immunofluorescence analysis showing the potential of iPSC lines to form three germ layers, including ectoderm (type III β-tubulin [TUJ1], green), mesoderm (smooth muscle actin [SMA], green), and endoderm (α-fetoprotein [AFP], red). Scale bar: 100 µm. (E) Karyotype analysis of the control and PS1-E120K iPSC lines. (F) Reverse-transcription PCR analysis showing the absence of integration of the Sendai virus vectors. (G) PCR analysis showing no contamination by mycoplasma.
    Figure Legend Snippet: Generation of iPSCs from an AD patient harboring a PSEN1 (E120K) mutation, and an eldely normal subject. (A) Established iPSC lines from both control and PS1-E120K patient showing the expression of pluripotent stem cell markers, such as OCT4 (red), SOX2 (green), SSEA4 (red) and TRA-1-81 (red). (B) Reverse transcription PCR (RT-PCR) showing the expression of pluripotency markers (OCT4, SOX2, NANOG, SSEA4 AND TRA-1-81) in both iPSC lines. (C) Genomic DNA sequences showing the presence of the heterozygous E120K mutation (GAA to AAA) in the PSEN1 gene of the PS1-E120K-iPSC line. (D) Immunofluorescence analysis showing the potential of iPSC lines to form three germ layers, including ectoderm (type III β-tubulin [TUJ1], green), mesoderm (smooth muscle actin [SMA], green), and endoderm (α-fetoprotein [AFP], red). Scale bar: 100 µm. (E) Karyotype analysis of the control and PS1-E120K iPSC lines. (F) Reverse-transcription PCR analysis showing the absence of integration of the Sendai virus vectors. (G) PCR analysis showing no contamination by mycoplasma.

    Techniques Used: Mutagenesis, Expressing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence

    Cortical neuron differentiation of PS1-E120K- and control-derived iPSCs. (A) Schematic diagram showing our stepwise cortical neuronal differentiation protocol. Control and PS1-E120K patient-derived iPSC lines were differentiated into neural precursor cells (NPC) using the Dual SMAD inhibition method. Afterwards, NPCs were treated with neurotrophic factors including BDNF, GDNF and NT3 to induce cortical neurons. (B) Immunofluorescence analysis of control and PS1-E120K iPSC-derived NPCs, showing the expression of NPC markers, such as Nestin (green), SOX2 (red) and Musashi (green) with DAPI (blue). (C) Immunofluorescence analysis of control and AD-iPSC-derived cortical neurons (TUJ1 [red] and Map2 [green]). Cholinergic neurons (ChAT [red]) and cortical neurons (TBR1 [red] and CTIP2 [green]) at 10 weeks after differentiation were shown. (D) Ratios of each mature neuronal cell type relative to DAPI staining. Scale bar: 50 µm.
    Figure Legend Snippet: Cortical neuron differentiation of PS1-E120K- and control-derived iPSCs. (A) Schematic diagram showing our stepwise cortical neuronal differentiation protocol. Control and PS1-E120K patient-derived iPSC lines were differentiated into neural precursor cells (NPC) using the Dual SMAD inhibition method. Afterwards, NPCs were treated with neurotrophic factors including BDNF, GDNF and NT3 to induce cortical neurons. (B) Immunofluorescence analysis of control and PS1-E120K iPSC-derived NPCs, showing the expression of NPC markers, such as Nestin (green), SOX2 (red) and Musashi (green) with DAPI (blue). (C) Immunofluorescence analysis of control and AD-iPSC-derived cortical neurons (TUJ1 [red] and Map2 [green]). Cholinergic neurons (ChAT [red]) and cortical neurons (TBR1 [red] and CTIP2 [green]) at 10 weeks after differentiation were shown. (D) Ratios of each mature neuronal cell type relative to DAPI staining. Scale bar: 50 µm.

    Techniques Used: Derivative Assay, Inhibition, Immunofluorescence, Expressing, Staining

    19) Product Images from "MARCKS modulates radial progenitor placement, proliferation and organization in the developing cerebral cortex"

    Article Title: MARCKS modulates radial progenitor placement, proliferation and organization in the developing cerebral cortex

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.036616

    Molecular identity of ectopic progenitors in Marcks -/- cortex. ( A-F ) Immunolabeling of E15.5 radial progenitors in WT (A,D) and Marcks -/- (B,E) cortex with anti-PAX6 and anti-SOX2 antibodies illustrates the presence of ectopic PAX6 + (bracket, B) and
    Figure Legend Snippet: Molecular identity of ectopic progenitors in Marcks -/- cortex. ( A-F ) Immunolabeling of E15.5 radial progenitors in WT (A,D) and Marcks -/- (B,E) cortex with anti-PAX6 and anti-SOX2 antibodies illustrates the presence of ectopic PAX6 + (bracket, B) and

    Techniques Used: Immunolabeling

    20) Product Images from "Mitochondrial E3 ligase March5 maintains stemness of mouse ES cells via suppression of ERK signalling"

    Article Title: Mitochondrial E3 ligase March5 maintains stemness of mouse ES cells via suppression of ERK signalling

    Journal: Nature Communications

    doi: 10.1038/ncomms8112

    March5 increases somatic cell reprogramming efficiency. ( a ) Total RNA was extracted from MEF cells on day 0, 4 and 8 after transduction with OSCK (Oct4, Sox2, c-Myc and Klf4) and OSCK-derived iPS cells and analysed for March5 mRNA expression by real-time RT–PCR. Data are shown as the mean±s.d. from three independent experiments. * P
    Figure Legend Snippet: March5 increases somatic cell reprogramming efficiency. ( a ) Total RNA was extracted from MEF cells on day 0, 4 and 8 after transduction with OSCK (Oct4, Sox2, c-Myc and Klf4) and OSCK-derived iPS cells and analysed for March5 mRNA expression by real-time RT–PCR. Data are shown as the mean±s.d. from three independent experiments. * P

    Techniques Used: Transduction, Derivative Assay, Expressing, Quantitative RT-PCR

    21) Product Images from "EYA1 and SIX1 drive the neuronal developmental program in cooperation with the SWI/SNF chromatin-remodeling complex and SOX2 in the mammalian inner ear"

    Article Title: EYA1 and SIX1 drive the neuronal developmental program in cooperation with the SWI/SNF chromatin-remodeling complex and SOX2 in the mammalian inner ear

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.071670

    SOX2 cooperates with EYA1 and SIX1 and the SWI/SNF chromatin-remodeling complex to coordinate neuronal differentiation. ( A-G ) Cochlear explants transfected with the indicated constructs and stained with anti-NF (red) and Neurod1 probe. ( H ) CoIP of SOX2
    Figure Legend Snippet: SOX2 cooperates with EYA1 and SIX1 and the SWI/SNF chromatin-remodeling complex to coordinate neuronal differentiation. ( A-G ) Cochlear explants transfected with the indicated constructs and stained with anti-NF (red) and Neurod1 probe. ( H ) CoIP of SOX2

    Techniques Used: Transfection, Construct, Staining, Co-Immunoprecipitation Assay

    22) Product Images from "Hypoxia-Regulated Delta-like 1 Homologue Enhances Cancer Cell Stemness and Tumorigenicity"

    Article Title: Hypoxia-Regulated Delta-like 1 Homologue Enhances Cancer Cell Stemness and Tumorigenicity

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-09-1605

    DLK1 maintains an undifferentiated NB phenotype. A, BE(2)C cells were differentiated with 1 μmol/L RA or 10 μmol/L BrdUrd for 5 d. DLK1, Sox2, c-kit, and CD-133 were detected by Western blot. B, BE(2)C cells were infected with lentivirus
    Figure Legend Snippet: DLK1 maintains an undifferentiated NB phenotype. A, BE(2)C cells were differentiated with 1 μmol/L RA or 10 μmol/L BrdUrd for 5 d. DLK1, Sox2, c-kit, and CD-133 were detected by Western blot. B, BE(2)C cells were infected with lentivirus

    Techniques Used: Western Blot, Infection

    23) Product Images from "Cross talk between microRNA and epigenetic regulation in adult neurogenesis"

    Article Title: Cross talk between microRNA and epigenetic regulation in adult neurogenesis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200908151

    Overexpression of miR-137 suppresses the expression of Ezh2 post-transcriptionally and results in an overall reduction in H3K27-TriMe. (A) Overexpression of miR-137 in WT aNSCs led to the reduction of endogenous Ezh2 protein expression (top, n = 4; *, P = 0.0366) without a proportional reduction in Ezh2 mRNA (bottom, n = 3, error bars indicate the mean with a 95% CI). (B) Loss of MeCP2 in aNSCs led to a similar reduction in endogenous Ezh2 protein expression (top, n = 4; *, P = 0.0417) without a proportional reduction in Ezh2 mRNA (bottom, n = 3, error bars indicate the mean with a 95% CI). (C) Overexpression miR-137 resulted in a reduction in H3K27-TriMe relative to histone H4 (*, P = 0.0379; n ≥ 3, unpaired t test). (D) H3K27-TriMe is also reduced relative to histone H4 in MeCP2-/y aNSCs (*, P = 0.0367; n ≥ 3, unpaired t test). (E) Model for the cross talk between MeCP2, miR-137, and Ezh2 in modulating adult neurogenesis. MeCP2 along with Sox2 mediates the epigenetic regulation of miR-137 in aNSCs, where increased expression of miR-137 promotes aNSC proliferation and inhibits aNSC differentiation, whereas decreased expression of miR-137 promotes differentiation of aNSCs. One target gene involved in this process is Ezh2. The miR-137–mediated suppression of Ezh2 feeds back to chromatin by decreasing global H3K27-TriMe. Error bars indicate mean ± SEM.
    Figure Legend Snippet: Overexpression of miR-137 suppresses the expression of Ezh2 post-transcriptionally and results in an overall reduction in H3K27-TriMe. (A) Overexpression of miR-137 in WT aNSCs led to the reduction of endogenous Ezh2 protein expression (top, n = 4; *, P = 0.0366) without a proportional reduction in Ezh2 mRNA (bottom, n = 3, error bars indicate the mean with a 95% CI). (B) Loss of MeCP2 in aNSCs led to a similar reduction in endogenous Ezh2 protein expression (top, n = 4; *, P = 0.0417) without a proportional reduction in Ezh2 mRNA (bottom, n = 3, error bars indicate the mean with a 95% CI). (C) Overexpression miR-137 resulted in a reduction in H3K27-TriMe relative to histone H4 (*, P = 0.0379; n ≥ 3, unpaired t test). (D) H3K27-TriMe is also reduced relative to histone H4 in MeCP2-/y aNSCs (*, P = 0.0367; n ≥ 3, unpaired t test). (E) Model for the cross talk between MeCP2, miR-137, and Ezh2 in modulating adult neurogenesis. MeCP2 along with Sox2 mediates the epigenetic regulation of miR-137 in aNSCs, where increased expression of miR-137 promotes aNSC proliferation and inhibits aNSC differentiation, whereas decreased expression of miR-137 promotes differentiation of aNSCs. One target gene involved in this process is Ezh2. The miR-137–mediated suppression of Ezh2 feeds back to chromatin by decreasing global H3K27-TriMe. Error bars indicate mean ± SEM.

    Techniques Used: Over Expression, Expressing

    Transcriptional regulation of miR-137 involves coregulation by Sox2. (A) Schematic showing the miR-137 genomic locus and the location of a conserved Sox2 consensus-binding site within the 2.5-kb upstream region of miR-137 with which MeCP2 was also found to interact by ChIP. (B and C) Genomic structure and CpG content surrounding the miR-137 genomic locus. (B) Percentage of CG content across a 7-kb region surrounding miR-137, with a threshold indicated at 60%. (C) Ratio of observed CpG dinucleotides to the number of CpGs expected with a normal distribution across the same 7-kb region surrounding miR-137. A threshold is indicated at a ratio of 0.6 (dotted line). Data for both plots were generated using EMBOSS CpG plot with a 100-nt window size and a 1-nt window shift increment ( Larsen et al., 1992 ). (D) Sequences 2.5 kb upstream of miR-137 enriched in a Sox2-specific ChIP relative to IgG only in WT aNSCs but not MeCP2-/y aNSCs, normalized to the directly adjacent 1.5-kb upstream region ( n = 3, error bars indicate mean ± SEM, two-way ANOVA, Bonferroni post-test; ***, P
    Figure Legend Snippet: Transcriptional regulation of miR-137 involves coregulation by Sox2. (A) Schematic showing the miR-137 genomic locus and the location of a conserved Sox2 consensus-binding site within the 2.5-kb upstream region of miR-137 with which MeCP2 was also found to interact by ChIP. (B and C) Genomic structure and CpG content surrounding the miR-137 genomic locus. (B) Percentage of CG content across a 7-kb region surrounding miR-137, with a threshold indicated at 60%. (C) Ratio of observed CpG dinucleotides to the number of CpGs expected with a normal distribution across the same 7-kb region surrounding miR-137. A threshold is indicated at a ratio of 0.6 (dotted line). Data for both plots were generated using EMBOSS CpG plot with a 100-nt window size and a 1-nt window shift increment ( Larsen et al., 1992 ). (D) Sequences 2.5 kb upstream of miR-137 enriched in a Sox2-specific ChIP relative to IgG only in WT aNSCs but not MeCP2-/y aNSCs, normalized to the directly adjacent 1.5-kb upstream region ( n = 3, error bars indicate mean ± SEM, two-way ANOVA, Bonferroni post-test; ***, P

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Generated

    Identification of miRNAs with altered expression in Mecp2 -deficient adult NSCs. (A) Adult NSCs cultured under proliferating conditions express Sox2 (nuclear, green) and Nestin (cytoplasmic, red), and incorporate BrdU (nuclear, red). Adult NSCs used in this study were multipotent and, when subjected to differentiation, expressed neuron-specific TuJ1 (red) and astrocyte-specific GFAP (green, DAPI is shown in blue), Bar, 50 µm. (B) Western blot showing expression of MeCP2 in WT aNSCs and the absence of MeCP2 in MeCP2-/y aNSCs (ab2828 antibody; Abcam). (C) Heat map of miRNA with a ≥2.5-fold change in expression in proliferating MeCP2-/y aNSCs. Quantities relative to WT aNSCs from each of four independent miRNA profiling experiments are shown. Relative quantity scale is shown below for reference. (D) Relative quantity of miRNA with ≥2.5-fold change in expression shown for MeCP2-/y proliferating aNSCs, calibrated to WT proliferating aNSCs. WT relative quantity = 1, mean relative quantity from three WT/ MeCP2-/y pairs plus one pooled sample per genotype is plotted, with error bars representing a 95% CI. Dotted lines indicate a threshold of 2.5-fold change in expression.
    Figure Legend Snippet: Identification of miRNAs with altered expression in Mecp2 -deficient adult NSCs. (A) Adult NSCs cultured under proliferating conditions express Sox2 (nuclear, green) and Nestin (cytoplasmic, red), and incorporate BrdU (nuclear, red). Adult NSCs used in this study were multipotent and, when subjected to differentiation, expressed neuron-specific TuJ1 (red) and astrocyte-specific GFAP (green, DAPI is shown in blue), Bar, 50 µm. (B) Western blot showing expression of MeCP2 in WT aNSCs and the absence of MeCP2 in MeCP2-/y aNSCs (ab2828 antibody; Abcam). (C) Heat map of miRNA with a ≥2.5-fold change in expression in proliferating MeCP2-/y aNSCs. Quantities relative to WT aNSCs from each of four independent miRNA profiling experiments are shown. Relative quantity scale is shown below for reference. (D) Relative quantity of miRNA with ≥2.5-fold change in expression shown for MeCP2-/y proliferating aNSCs, calibrated to WT proliferating aNSCs. WT relative quantity = 1, mean relative quantity from three WT/ MeCP2-/y pairs plus one pooled sample per genotype is plotted, with error bars representing a 95% CI. Dotted lines indicate a threshold of 2.5-fold change in expression.

    Techniques Used: Expressing, Cell Culture, Western Blot

    24) Product Images from "Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury"

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury

    Journal: Cerebral Cortex (New York, NY)

    doi: 10.1093/cercor/bhx303

    ChIP-seq analysis to reveal SOX2-regulated genes in the adult mouse cortex. ( a ) The predominant SOX2-bound motifs identified by genome-wide ChIP-seq analysis. ( b ) Genome-wide distribution of SOX2-binding peaks. ( c ) Representative genes directly targeted by SOX2. ChIP-seq was performed in triplicates using independent cortical tissues. ( d ) Highly enriched Gene Ontology terms by Wikipathway analysis.
    Figure Legend Snippet: ChIP-seq analysis to reveal SOX2-regulated genes in the adult mouse cortex. ( a ) The predominant SOX2-bound motifs identified by genome-wide ChIP-seq analysis. ( b ) Genome-wide distribution of SOX2-binding peaks. ( c ) Representative genes directly targeted by SOX2. ChIP-seq was performed in triplicates using independent cortical tissues. ( d ) Highly enriched Gene Ontology terms by Wikipathway analysis.

    Techniques Used: Chromatin Immunoprecipitation, Genome Wide, Binding Assay

    Lack of overt effects of SOX2-deletion on adult quiescent astrocytes. ( a ) An inducible approach to specifically delete Sox2 in adult astrocytes. tdT, tdTomato. Tam, tamoxifen. ( b ) Representative confocal images showing deletion of SOX2 in tdT-traced astrocytes. ( c ) Quantification showing robust deletion of SOX2 in cortical astrocytes (means ± S.E.M., n = 3 mice, **** P
    Figure Legend Snippet: Lack of overt effects of SOX2-deletion on adult quiescent astrocytes. ( a ) An inducible approach to specifically delete Sox2 in adult astrocytes. tdT, tdTomato. Tam, tamoxifen. ( b ) Representative confocal images showing deletion of SOX2 in tdT-traced astrocytes. ( c ) Quantification showing robust deletion of SOX2 in cortical astrocytes (means ± S.E.M., n = 3 mice, **** P

    Techniques Used: Mouse Assay

    Broader SOX2 expression in reactive cortical glial cells. ( a ) Robust SOX2 expression in reactive cortical astrocytes, which are marked by GFAP and GFP expression in mGfap-Cre;Rosa-YFP mice at 3 dpi. ( b ) A predominant and increased SOX2 expression in reactive astrocytes (means ± S.E.M., n = 3 mice, **** P
    Figure Legend Snippet: Broader SOX2 expression in reactive cortical glial cells. ( a ) Robust SOX2 expression in reactive cortical astrocytes, which are marked by GFAP and GFP expression in mGfap-Cre;Rosa-YFP mice at 3 dpi. ( b ) A predominant and increased SOX2 expression in reactive astrocytes (means ± S.E.M., n = 3 mice, **** P

    Techniques Used: Expressing, Mouse Assay

    Astrocyte activation requires SOX2. ( a ) A strategy for analysis of astrocyte activation post CCI-induced injury. Immunohistochemistry was performed at the indicated time points. dpi, days postinjury. ( b ) Quantification of reactive astrocytes during a time course. Cells were counted surrounding the injured cortex (means ± S.E.M., n = 4 mice). ( c ) Representative images of activated cortical astrocytes indicated by BrdU-incorporation and GFAP staining. ( d ) Confocal images showing reduced proliferation of cortical astrocytes in mice with Sox2 -deletion. Enlarged views of the boxed regions are shown on the respective right panels. ( e ) Quantification of proliferating cortical astrocytes at 7 dpi (means ± S.E.M., n = 4 mice for each genotype, ** P = 0.0049 by t -test). ( f ) Quantification of total activated cortical astrocytes indicated by GFAP staining at 7 dpi (means ± S.E.M., n = 4 mice for each genotype, ** P = 0.0009 by t -test). ( g ) Quantification of cell body areas of GFAP + cells at 7 dpi (means ± S.E.M., n = 4 mice, ** P
    Figure Legend Snippet: Astrocyte activation requires SOX2. ( a ) A strategy for analysis of astrocyte activation post CCI-induced injury. Immunohistochemistry was performed at the indicated time points. dpi, days postinjury. ( b ) Quantification of reactive astrocytes during a time course. Cells were counted surrounding the injured cortex (means ± S.E.M., n = 4 mice). ( c ) Representative images of activated cortical astrocytes indicated by BrdU-incorporation and GFAP staining. ( d ) Confocal images showing reduced proliferation of cortical astrocytes in mice with Sox2 -deletion. Enlarged views of the boxed regions are shown on the respective right panels. ( e ) Quantification of proliferating cortical astrocytes at 7 dpi (means ± S.E.M., n = 4 mice for each genotype, ** P = 0.0049 by t -test). ( f ) Quantification of total activated cortical astrocytes indicated by GFAP staining at 7 dpi (means ± S.E.M., n = 4 mice for each genotype, ** P = 0.0009 by t -test). ( g ) Quantification of cell body areas of GFAP + cells at 7 dpi (means ± S.E.M., n = 4 mice, ** P

    Techniques Used: Activation Assay, Immunohistochemistry, Mouse Assay, BrdU Incorporation Assay, Staining

    Sox2 -deletion ameliorates TBI-induced functional impairments. ( a ) Whole brain overviews of the indicated mice at 2 months after CCI. The lesioned brain areas are indicated by arrows. ( b ) Quantification of lesion size. Coronal brain sections showing areas for quantification (means ± S.E.M.; n = 5 mice for each genotype; *** P
    Figure Legend Snippet: Sox2 -deletion ameliorates TBI-induced functional impairments. ( a ) Whole brain overviews of the indicated mice at 2 months after CCI. The lesioned brain areas are indicated by arrows. ( b ) Quantification of lesion size. Coronal brain sections showing areas for quantification (means ± S.E.M.; n = 5 mice for each genotype; *** P

    Techniques Used: Functional Assay, Mouse Assay

    TBI-induced upregulation of SOX2 expression. ( a ) A schematic diagram showing controlled cortical impact (CCI)-induced TBI and counting area (red colored box) for quantification. ( b ) Density of SOX2 + cells surrounding the injured cortex (means ± S.E.M., n = 3-5 mice; F = 42.82 and P
    Figure Legend Snippet: TBI-induced upregulation of SOX2 expression. ( a ) A schematic diagram showing controlled cortical impact (CCI)-induced TBI and counting area (red colored box) for quantification. ( b ) Density of SOX2 + cells surrounding the injured cortex (means ± S.E.M., n = 3-5 mice; F = 42.82 and P

    Techniques Used: Expressing, Mouse Assay

    SOX2 expression in adult mouse cortex. ( a ) Rare and weak SOX2 expression in cortical neurons (indicated by an arrowhead). Non-neuronal expression is generally much stronger (indicated by arrows). ( b ) SOX2 expression in cortical astrocytes of Aldh1l1-EGFP mice. Astrocytes were identified by GS and the reporter GFP. Arrows show a representative GFP + GS + SOX2 + cell. mo, month. ( c ) SOX2 expression in cortical OLIG2 + oligodendrocytes or oligodendrocyte precursors of Aldh1l1-EGFP mice. Arrows show a representative SOX2 high OLIG2 − GFP + cell, whereas arrowheads show a representative SOX2 low OLIG2 + GFP − cell. SOX2 expression is always weaker in OLIG2 + cells. ( d ) SOX2 is not expressed in IBA1 + microglia. A representative SOX2 + IBA1 − cell is indicated by an arrow. ( e ) SOX2 expression in cortical GFP + astrocytes (indicated by an arrow, SOX2 high OLIG2 − GFP + ) or OLIG2 + cells (indicated by an arrowhead, SOX2 low OLIG2 + GFP − ) of 24-month-old Aldh1l1-EGFP mice. Scale bars: 25 μm ( a ) and 50 μm ( b – e ).
    Figure Legend Snippet: SOX2 expression in adult mouse cortex. ( a ) Rare and weak SOX2 expression in cortical neurons (indicated by an arrowhead). Non-neuronal expression is generally much stronger (indicated by arrows). ( b ) SOX2 expression in cortical astrocytes of Aldh1l1-EGFP mice. Astrocytes were identified by GS and the reporter GFP. Arrows show a representative GFP + GS + SOX2 + cell. mo, month. ( c ) SOX2 expression in cortical OLIG2 + oligodendrocytes or oligodendrocyte precursors of Aldh1l1-EGFP mice. Arrows show a representative SOX2 high OLIG2 − GFP + cell, whereas arrowheads show a representative SOX2 low OLIG2 + GFP − cell. SOX2 expression is always weaker in OLIG2 + cells. ( d ) SOX2 is not expressed in IBA1 + microglia. A representative SOX2 + IBA1 − cell is indicated by an arrow. ( e ) SOX2 expression in cortical GFP + astrocytes (indicated by an arrow, SOX2 high OLIG2 − GFP + ) or OLIG2 + cells (indicated by an arrowhead, SOX2 low OLIG2 + GFP − ) of 24-month-old Aldh1l1-EGFP mice. Scale bars: 25 μm ( a ) and 50 μm ( b – e ).

    Techniques Used: Expressing, Mouse Assay

    25) Product Images from "A multi-stage process including transient polyploidization and EMT precedes the emergence of chemoresistent ovarian carcinoma cells with a dedifferentiated and pro-inflammatory secretory phenotype"

    Article Title: A multi-stage process including transient polyploidization and EMT precedes the emergence of chemoresistent ovarian carcinoma cells with a dedifferentiated and pro-inflammatory secretory phenotype

    Journal: Oncotarget

    doi:

    Expression of stemness markers after CPT treatment of SKOV3 cells A. Flow cytometry dot plot and B. histogram of nuclear OCT4 in untreated SKOV3 cells, SKOV3 cells treated for 14 days 21 weeks. The x-axis in panel A shows the forward scatter as an indication of cell size. A validation of the OCT4 antibody is shown in Figure S5 . C. Quantitation of the transcriptional activity of OCT4 in SKOV3 cells harboring a stably integrated luciferase reporter construct driven by OCT4 binding sites after different times of CPT treatment. D. RT-qPCR analysis of POU5F1 mRNA levels (sample size: n ≥ 3). E. Median fluorescence intensity (MFI) determined by flow cytometry for stem cell markers (CD24, CD44, CD117 and CD133 surface expression and nuclear OCT4, SOX2 and NANOG) after different times of CPT treatment (sample size: n ≥ 3).
    Figure Legend Snippet: Expression of stemness markers after CPT treatment of SKOV3 cells A. Flow cytometry dot plot and B. histogram of nuclear OCT4 in untreated SKOV3 cells, SKOV3 cells treated for 14 days 21 weeks. The x-axis in panel A shows the forward scatter as an indication of cell size. A validation of the OCT4 antibody is shown in Figure S5 . C. Quantitation of the transcriptional activity of OCT4 in SKOV3 cells harboring a stably integrated luciferase reporter construct driven by OCT4 binding sites after different times of CPT treatment. D. RT-qPCR analysis of POU5F1 mRNA levels (sample size: n ≥ 3). E. Median fluorescence intensity (MFI) determined by flow cytometry for stem cell markers (CD24, CD44, CD117 and CD133 surface expression and nuclear OCT4, SOX2 and NANOG) after different times of CPT treatment (sample size: n ≥ 3).

    Techniques Used: Expressing, Cycling Probe Technology, Flow Cytometry, Cytometry, Quantitation Assay, Activity Assay, Stable Transfection, Luciferase, Construct, Binding Assay, Quantitative RT-PCR, Fluorescence

    26) Product Images from "The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance"

    Article Title: The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance

    Journal: Oncogene

    doi: 10.1038/s41388-019-0712-y

    Expression of pluripotency master regulators identifies aggressive cancers and disease resistance. a Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN lo ) levels of expression (middle panel) and correlation of OSN sum score with disease-specific survival (DSS) by Kaplan–Meier analysis (right panel). b Same as a but for muscle-invasive bladder cancer (MIBC). c Same as b but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan–Meier analysis (right panel)
    Figure Legend Snippet: Expression of pluripotency master regulators identifies aggressive cancers and disease resistance. a Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN lo ) levels of expression (middle panel) and correlation of OSN sum score with disease-specific survival (DSS) by Kaplan–Meier analysis (right panel). b Same as a but for muscle-invasive bladder cancer (MIBC). c Same as b but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan–Meier analysis (right panel)

    Techniques Used: Expressing, Immunohistochemistry, Staining

    A preclinical model to recreate a stem cell-like aggressive cancer phenotype. a Schematic of culture details of generation of Acquired Pluripotent Stem Cell Environment (APSCE). Briefly, cancer cells were transferred from culture in their regular serum supplemented medium (FM) to culture conditions used for human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) as described in ‘Materials and methods’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. b – d Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. e – g Stemness (OCT4, SOX2, NANOG) and mesenchymal (vimentin, Snail, Slug, N-cadherin) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM (*denotes p -value
    Figure Legend Snippet: A preclinical model to recreate a stem cell-like aggressive cancer phenotype. a Schematic of culture details of generation of Acquired Pluripotent Stem Cell Environment (APSCE). Briefly, cancer cells were transferred from culture in their regular serum supplemented medium (FM) to culture conditions used for human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) as described in ‘Materials and methods’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. b – d Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. e – g Stemness (OCT4, SOX2, NANOG) and mesenchymal (vimentin, Snail, Slug, N-cadherin) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM (*denotes p -value

    Techniques Used: Cell Culture, Magnetic Cell Separation, Selection, Expressing, Real-time Polymerase Chain Reaction

    27) Product Images from "Neurogenic decisions require a cell cycle independent function of the CDC25B phosphatase"

    Article Title: Neurogenic decisions require a cell cycle independent function of the CDC25B phosphatase

    Journal: eLife

    doi: 10.7554/eLife.32937

    CDC25B gain-of-function promotes neurogenic divisions. ( A ) Representative cross-sections of HH17 chick spinal cord, 24 hr after electroporating Sox2::GFP and Tis21::RFP reporters, plus a control vector pccRE::lacZ, or a pccRE::CDC25B vector. Scale bars indicate 50 µm. ( B ) Representative cross-sections of HH21 chick spinal cord, 40 hr after electroporation of Nucbow and pCX CRE vectors, and immunostaining with HuC/D antibody. Scale bar indicates 50 µm. ( C ) Specific two cell clone examples, 40 hr after transfection of Nucbow and immunostaining with HuC/D antibody. Scale bars indicate 10 µm. ( D ) Box plots (5/95 percentile) comparing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 5 control and 6 CDC25B gain-of-function embryos. ( E ) Box plots (5/95 percentile) comparing the percentage of two cell clones expressing Nucbow and pCX CRE vectors, 40 hr after co-electroporation with control or CDC25B vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 387 clones in 12 control embryos, and 659 clones in 11 CDC25B gain-of-function embryos. ( F ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B vectors in the dorsal and ventral spinal cord. Data represent the means ± SEM. Data represent three different experiments with 5 dorsal and 10 ventral neural tubes in the control, and 5 dorsal and six ventral neural tubes in the CDC25B gain-of-function.
    Figure Legend Snippet: CDC25B gain-of-function promotes neurogenic divisions. ( A ) Representative cross-sections of HH17 chick spinal cord, 24 hr after electroporating Sox2::GFP and Tis21::RFP reporters, plus a control vector pccRE::lacZ, or a pccRE::CDC25B vector. Scale bars indicate 50 µm. ( B ) Representative cross-sections of HH21 chick spinal cord, 40 hr after electroporation of Nucbow and pCX CRE vectors, and immunostaining with HuC/D antibody. Scale bar indicates 50 µm. ( C ) Specific two cell clone examples, 40 hr after transfection of Nucbow and immunostaining with HuC/D antibody. Scale bars indicate 10 µm. ( D ) Box plots (5/95 percentile) comparing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 5 control and 6 CDC25B gain-of-function embryos. ( E ) Box plots (5/95 percentile) comparing the percentage of two cell clones expressing Nucbow and pCX CRE vectors, 40 hr after co-electroporation with control or CDC25B vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 387 clones in 12 control embryos, and 659 clones in 11 CDC25B gain-of-function embryos. ( F ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B vectors in the dorsal and ventral spinal cord. Data represent the means ± SEM. Data represent three different experiments with 5 dorsal and 10 ventral neural tubes in the control, and 5 dorsal and six ventral neural tubes in the CDC25B gain-of-function.

    Techniques Used: Plasmid Preparation, Electroporation, Immunostaining, Transfection, Expressing, Clone Assay

    CDC25B gain-of-function promotes neurogenesis independently of CDK interaction. ( A ) Curves representing the percentage of electroporated GFP + EdU + PH3 + over the total GFP + EdU + cells with increasing EdU exposure times: control (black), CDC25B Δ ⁢ CDK (red). Note that the curve for the CDC25B Δ ⁢ CDK condition is similar to the control, indicating an absence of effect on G2 length. ( B ) Box plots (5/95 percentile) comparing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 6 control and 6 CDC25B Δ ⁢ CDK gain-of-function embryos. ( C ) Box plots (5/95 percentile) comparing the percentage of two cell clones expressing Nucbow and pCX CRE vectors, 40 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 387 clones in 12 control embryos, and 692 clones in 10 CDC25B Δ ⁢ CDK gain-of-function embryos. ( D ) Bar plot representing the percentage of cells expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors, in the dorsal or ventral spinal cord. Data represent the means ± SEM. Data represent three different experiments with a total of 5 dorsal and 10 ventral neural tubes under control conditions, and 4 dorsal and 9 ventral neural tubes in CDC25B Δ ⁢ CDK gain-of-function. ( E ) Box plots (5/95 percentile) comparing the percentage of HuC/D + cells within the electroporated population in control or CDC25B Δ ⁢ CDK gain-of-function experiments, in the dorsal or ventral neural tube at HH22. Data represent three different experiments with 13 dorsal and 6 ventral neural tubes in the control and 6 dorsal and 3 ventral neural tubes in the CDC25B Δ ⁢ CDK gain-of-function. ( F ) Box plots (5/95 percentile) comparing the percentage of Pax2 + cells in the dorsal neural tube at HH22. Data from three different experiments with 8 control embryos, and 11 CDC25B Δ ⁢ CDK gain-of-function embryos. ( G ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP at HH17, 24 hr after electroporation of a control or CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK expressing vector in the dorsal half of the spinal cord. Data from three different experiments with 6 control embryos, and 9 CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK embryos. ( H ) Box plots (5/95 percentile) comparing the percentage of Sox2 + or HuC/D + cells within the electroporated population in the control or CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK gain-of-function experiments, in the dorsal spinal cord at HH17. Data from three different experiments with 11 control embryos, and 6 CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK embryos. The cross indicates the mean value.
    Figure Legend Snippet: CDC25B gain-of-function promotes neurogenesis independently of CDK interaction. ( A ) Curves representing the percentage of electroporated GFP + EdU + PH3 + over the total GFP + EdU + cells with increasing EdU exposure times: control (black), CDC25B Δ ⁢ CDK (red). Note that the curve for the CDC25B Δ ⁢ CDK condition is similar to the control, indicating an absence of effect on G2 length. ( B ) Box plots (5/95 percentile) comparing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 6 control and 6 CDC25B Δ ⁢ CDK gain-of-function embryos. ( C ) Box plots (5/95 percentile) comparing the percentage of two cell clones expressing Nucbow and pCX CRE vectors, 40 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors in the entire spinal cord. Data represent the means ± SEM of 3 different experiments with 387 clones in 12 control embryos, and 692 clones in 10 CDC25B Δ ⁢ CDK gain-of-function embryos. ( D ) Bar plot representing the percentage of cells expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation with control or CDC25B Δ ⁢ CDK vectors, in the dorsal or ventral spinal cord. Data represent the means ± SEM. Data represent three different experiments with a total of 5 dorsal and 10 ventral neural tubes under control conditions, and 4 dorsal and 9 ventral neural tubes in CDC25B Δ ⁢ CDK gain-of-function. ( E ) Box plots (5/95 percentile) comparing the percentage of HuC/D + cells within the electroporated population in control or CDC25B Δ ⁢ CDK gain-of-function experiments, in the dorsal or ventral neural tube at HH22. Data represent three different experiments with 13 dorsal and 6 ventral neural tubes in the control and 6 dorsal and 3 ventral neural tubes in the CDC25B Δ ⁢ CDK gain-of-function. ( F ) Box plots (5/95 percentile) comparing the percentage of Pax2 + cells in the dorsal neural tube at HH22. Data from three different experiments with 8 control embryos, and 11 CDC25B Δ ⁢ CDK gain-of-function embryos. ( G ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP at HH17, 24 hr after electroporation of a control or CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK expressing vector in the dorsal half of the spinal cord. Data from three different experiments with 6 control embryos, and 9 CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK embryos. ( H ) Box plots (5/95 percentile) comparing the percentage of Sox2 + or HuC/D + cells within the electroporated population in the control or CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK gain-of-function experiments, in the dorsal spinal cord at HH17. Data from three different experiments with 11 control embryos, and 6 CDC25B Δ ⁢ P ⁢ Δ ⁢ CDK embryos. The cross indicates the mean value.

    Techniques Used: Expressing, Electroporation, Clone Assay, Plasmid Preparation

    Schematic of CDC25B modes of action. CDC25B activity on an unknown substrate changes G1 nucleus basalward movement during Interkinetic Nuclear Migration (INM), and also acts on the mode of division leading to increased neurogenesis. It remains to be determined whether a link exists between these two activities. In addition to this new pathway, the data obtained in mice and using the Tis21/Sox2 assay suggest that the activity of CDC25B on CDK might account for part of its activity on the mode of division and neurogenesis.
    Figure Legend Snippet: Schematic of CDC25B modes of action. CDC25B activity on an unknown substrate changes G1 nucleus basalward movement during Interkinetic Nuclear Migration (INM), and also acts on the mode of division leading to increased neurogenesis. It remains to be determined whether a link exists between these two activities. In addition to this new pathway, the data obtained in mice and using the Tis21/Sox2 assay suggest that the activity of CDC25B on CDK might account for part of its activity on the mode of division and neurogenesis.

    Techniques Used: Activity Assay, Migration, Mouse Assay

    Cdc25b conditional genetic loss-of-function affects the progenitor pool. ( A–C ) Cross-sections of E11.5 embryo neural tubes in control ( A ) and conditional nesKO conditions ( B–C ). The progenitor pool size is evaluated by the percentage of the Pax7 progenitor area (B, yellow dashes) compared to the neural tube area (B, red dashes). Nuclei number is quantified using DAPI staining ( C ) in a 80 × 80 µm square (B-C, white dashes). ( D–F ) Cross-sections of E12.5 embryo neural tubes in control ( D ) and conditional nesKO conditions ( E–F ). The progenitor pool size is evaluated by the percentage of the dorsal Sox2 progenitor area delimited by Tlx3 domain (E, yellow dashes) compared to the neural tube area (E, red dashes). Nucleus density ( F ) is quantified using DAPI staining in a 71 × 71 µm square (E-F, white dashes). ( G–J ) Box plots (5/95 percentile) comparing at E11.5 the progenitor area in 19 control, and 13 nesKO embryos ( G ), the nucleus density in 8 Control, and 6 NesKO embryos ( H ), at E12.5, the progenitor area in 15 control, and 9 nesKO embryos ( I ), and the nucleus density in 12 control, and 8 nesKO embryos ( J ). The cross indicates the mean value. Scale bar represents 100 µm.
    Figure Legend Snippet: Cdc25b conditional genetic loss-of-function affects the progenitor pool. ( A–C ) Cross-sections of E11.5 embryo neural tubes in control ( A ) and conditional nesKO conditions ( B–C ). The progenitor pool size is evaluated by the percentage of the Pax7 progenitor area (B, yellow dashes) compared to the neural tube area (B, red dashes). Nuclei number is quantified using DAPI staining ( C ) in a 80 × 80 µm square (B-C, white dashes). ( D–F ) Cross-sections of E12.5 embryo neural tubes in control ( D ) and conditional nesKO conditions ( E–F ). The progenitor pool size is evaluated by the percentage of the dorsal Sox2 progenitor area delimited by Tlx3 domain (E, yellow dashes) compared to the neural tube area (E, red dashes). Nucleus density ( F ) is quantified using DAPI staining in a 71 × 71 µm square (E-F, white dashes). ( G–J ) Box plots (5/95 percentile) comparing at E11.5 the progenitor area in 19 control, and 13 nesKO embryos ( G ), the nucleus density in 8 Control, and 6 NesKO embryos ( H ), at E12.5, the progenitor area in 15 control, and 9 nesKO embryos ( I ), and the nucleus density in 12 control, and 8 nesKO embryos ( J ). The cross indicates the mean value. Scale bar represents 100 µm.

    Techniques Used: Staining

    CDC25B downregulation reduces neurogenic divisions. ( A ) Schematic representation of the Sox2::GFP Tis21::RFP labelling strategy. A GFP expressing cell (green cell) corresponds to a PP division, a cell expressing both GFP and RFP (yellow cell) corresponds to a PN division, and a RFP expressing cell (red cell) corresponds to a NN division. ( B ) Bar plot representing the percentage of cells expressing the reporters Sox2::GFP and Tis21::RFP at HH17 in the entire progenitor population, or in progenitors performing mitosis identified with phospho-histone-3 (PH3) immunostaining. Note that these results are not significantly different. These data are obtained from three different experiments, seven embryos, 365 progenitors, and 79 mitoses. ( C ) In situ hybridization for CDC25B on HH17 spinal cord, 24 hr post electroporation of Control RNAi (left panel) and CDC25B RNAi (right panel). The reduction of CDC25B expression in the intermediate region is indicated by a bracket. Cells were electroporated on the right side of the neural tube (not shown). Scale bars indicate 100 µm. ( D ) Cross-sections of chick spinal cord at HH17, 24 hr after co-electroporation of Sox2::GFP and Tis21::RFP reporter, plus a control RNAi vector or the CDC25B-RNAi vector. Scale bars indicate 50 µm. ( E ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation of a control vector or a CDC25B RNAi vector. 4 experiments include seven control embryos and 15 CDC25B RNAi embryos.
    Figure Legend Snippet: CDC25B downregulation reduces neurogenic divisions. ( A ) Schematic representation of the Sox2::GFP Tis21::RFP labelling strategy. A GFP expressing cell (green cell) corresponds to a PP division, a cell expressing both GFP and RFP (yellow cell) corresponds to a PN division, and a RFP expressing cell (red cell) corresponds to a NN division. ( B ) Bar plot representing the percentage of cells expressing the reporters Sox2::GFP and Tis21::RFP at HH17 in the entire progenitor population, or in progenitors performing mitosis identified with phospho-histone-3 (PH3) immunostaining. Note that these results are not significantly different. These data are obtained from three different experiments, seven embryos, 365 progenitors, and 79 mitoses. ( C ) In situ hybridization for CDC25B on HH17 spinal cord, 24 hr post electroporation of Control RNAi (left panel) and CDC25B RNAi (right panel). The reduction of CDC25B expression in the intermediate region is indicated by a bracket. Cells were electroporated on the right side of the neural tube (not shown). Scale bars indicate 100 µm. ( D ) Cross-sections of chick spinal cord at HH17, 24 hr after co-electroporation of Sox2::GFP and Tis21::RFP reporter, plus a control RNAi vector or the CDC25B-RNAi vector. Scale bars indicate 50 µm. ( E ) Bar plot representing the percentage of progenitors expressing Sox2::GFP and Tis21::RFP 24 hr after co-electroporation of a control vector or a CDC25B RNAi vector. 4 experiments include seven control embryos and 15 CDC25B RNAi embryos.

    Techniques Used: Expressing, Immunostaining, In Situ Hybridization, Electroporation, Plasmid Preparation

    28) Product Images from "Aqp 9 and Brain Tumour Stem Cells"

    Article Title: Aqp 9 and Brain Tumour Stem Cells

    Journal: The Scientific World Journal

    doi: 10.1100/2012/915176

    Expression of some proteins in tumourspheres. Tumourspheres from glioblastoma were mainly negative for the aquaporins 4 and 9 but were positive for immature and glial markers. (a, b) A few tumourspheres were weakly positive for aqp4 (a, red) but most were negative (b). (c) Few sphere cells were found to express aqp9. (d) Many sphere cells expressed aqp1. (e) A sphere showing the immature markers nestin (green) and Sox2 (red). (f) A sphere stained for nestin (green) and GFAP (red). Scale bars: (a, b, d, and e) 20 μ m; (c) 50 μ m.
    Figure Legend Snippet: Expression of some proteins in tumourspheres. Tumourspheres from glioblastoma were mainly negative for the aquaporins 4 and 9 but were positive for immature and glial markers. (a, b) A few tumourspheres were weakly positive for aqp4 (a, red) but most were negative (b). (c) Few sphere cells were found to express aqp9. (d) Many sphere cells expressed aqp1. (e) A sphere showing the immature markers nestin (green) and Sox2 (red). (f) A sphere stained for nestin (green) and GFAP (red). Scale bars: (a, b, d, and e) 20 μ m; (c) 50 μ m.

    Techniques Used: Expressing, Staining

    29) Product Images from "Human Cytomegalovirus IE2 Protein Disturbs Brain Development by the Dysregulation of Neural Stem Cell Maintenance and the Polarization of Migrating Neurons"

    Article Title: Human Cytomegalovirus IE2 Protein Disturbs Brain Development by the Dysregulation of Neural Stem Cell Maintenance and the Polarization of Migrating Neurons

    Journal: Journal of Virology

    doi: 10.1128/JVI.00799-17

    HCMV IE2 expression disturbs cortical brain development in vivo . (A) Schematic of gene delivery into the embryonic brain through in utero electroporation of plasmid DNA and assessment of the neurodevelopment-modulating activity of a gene of interest by determining the transgene-expressing cell positions in the cortical layers. Initially, only neural stem cells lining the VZ are electroporated, and as development proceeds, they give rise to neural stem cells that reside in the VZ or neurons that migrate up to the pial surface. (B) IE expression in the brains at 2 days postelectroporation was confirmed by immunostaining using anti-GFP (reporter gene; green) and anti-IE1/2 (red) primary antibodies as well as Alexa Fluor 488- and 555-conjugated secondary antibodies. IE2-expressing cells in E15.5 (C) or E18.5 (H and I) embryonic brains that were electroporated at E13.5 were immunolabeled using anti-GFP primary and Alexa 488-conjugated secondary antibodies. For panel C, GFP immunofluorescence merged with DAPI-counterstained images are shown on the right. (D) Quantification of GFP + cell positions from panel C. (E) Double immunolabeling of E15.5 brain sections electroporated with IE2-expressing plasmid at E13.5 using anti-GFP (green) and anti-Sox2 (red) primary antibodies. (F) The shapes of GFP + electroporated cells in E15.5 cortices at the transition between MMZ and RMZ. The dotted red lines indicate the direction of radial migration. Radial cells were defined as cells with a leading process with a deviation angle of less than 45° relative to the normal radial migration direction. (G) Quantification of cell shapes shown in panel F. (I) Examination of callosal axon trajectory (closed arrowheads) using immunolabeling of GFP at E18.5. The dotted lines indicate the midline, and an open arrowhead indicates where IE2 + callosal axons stop projection. VZ, ventricular zone; SVZ, subventricular zone; IZ, intermediate zone; CP, cortical plate; MMZ, multipolar morphology zone; RMZ, radial morphology zone; CC, corpus callosum; LV, lateral ventricle. Scale bars were 20 μm (B, E, and F), 50 μm (C), and 100 μm (H and I). Error bars represent SD. Student's t test was used to determine statistical significance. **, P
    Figure Legend Snippet: HCMV IE2 expression disturbs cortical brain development in vivo . (A) Schematic of gene delivery into the embryonic brain through in utero electroporation of plasmid DNA and assessment of the neurodevelopment-modulating activity of a gene of interest by determining the transgene-expressing cell positions in the cortical layers. Initially, only neural stem cells lining the VZ are electroporated, and as development proceeds, they give rise to neural stem cells that reside in the VZ or neurons that migrate up to the pial surface. (B) IE expression in the brains at 2 days postelectroporation was confirmed by immunostaining using anti-GFP (reporter gene; green) and anti-IE1/2 (red) primary antibodies as well as Alexa Fluor 488- and 555-conjugated secondary antibodies. IE2-expressing cells in E15.5 (C) or E18.5 (H and I) embryonic brains that were electroporated at E13.5 were immunolabeled using anti-GFP primary and Alexa 488-conjugated secondary antibodies. For panel C, GFP immunofluorescence merged with DAPI-counterstained images are shown on the right. (D) Quantification of GFP + cell positions from panel C. (E) Double immunolabeling of E15.5 brain sections electroporated with IE2-expressing plasmid at E13.5 using anti-GFP (green) and anti-Sox2 (red) primary antibodies. (F) The shapes of GFP + electroporated cells in E15.5 cortices at the transition between MMZ and RMZ. The dotted red lines indicate the direction of radial migration. Radial cells were defined as cells with a leading process with a deviation angle of less than 45° relative to the normal radial migration direction. (G) Quantification of cell shapes shown in panel F. (I) Examination of callosal axon trajectory (closed arrowheads) using immunolabeling of GFP at E18.5. The dotted lines indicate the midline, and an open arrowhead indicates where IE2 + callosal axons stop projection. VZ, ventricular zone; SVZ, subventricular zone; IZ, intermediate zone; CP, cortical plate; MMZ, multipolar morphology zone; RMZ, radial morphology zone; CC, corpus callosum; LV, lateral ventricle. Scale bars were 20 μm (B, E, and F), 50 μm (C), and 100 μm (H and I). Error bars represent SD. Student's t test was used to determine statistical significance. **, P

    Techniques Used: Expressing, In Vivo, In Utero, Electroporation, Plasmid Preparation, Activity Assay, Immunostaining, Immunolabeling, Immunofluorescence, Migration

    30) Product Images from "Expression of pannexin 1 and 2 in cortical lesions from intractable epilepsy patients with focal cortical dysplasia"

    Article Title: Expression of pannexin 1 and 2 in cortical lesions from intractable epilepsy patients with focal cortical dysplasia

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14317

    Double immunofluorescent staining of Panx2 in BCs in FCDIIb A-C . Representative confocal images show some Panx2 positive (green) BCs (arrowheads) colocalize with SOX2 (red), and some are SOX2 negative (arrow, insert). D-F . Double labeling staining shows the Panx2 (green, arrowheads) don't colocalize with vimentin (vim, red, arrows) in BCs. G-I . Merged images show Panx2 (green) colocalize with MASH1 (red) in pyramidal neuron (double arrowheads) and BCs (arrowheads). 5-μm paraffin-embedded sections are counterstained with DAPI. Scale bars = 30 μm.
    Figure Legend Snippet: Double immunofluorescent staining of Panx2 in BCs in FCDIIb A-C . Representative confocal images show some Panx2 positive (green) BCs (arrowheads) colocalize with SOX2 (red), and some are SOX2 negative (arrow, insert). D-F . Double labeling staining shows the Panx2 (green, arrowheads) don't colocalize with vimentin (vim, red, arrows) in BCs. G-I . Merged images show Panx2 (green) colocalize with MASH1 (red) in pyramidal neuron (double arrowheads) and BCs (arrowheads). 5-μm paraffin-embedded sections are counterstained with DAPI. Scale bars = 30 μm.

    Techniques Used: Staining, Labeling

    31) Product Images from "The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance"

    Article Title: The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance

    Journal: Oncogene

    doi: 10.1038/s41388-019-0712-y

    Expression of pluripotency master regulators identifies aggressive cancers and disease resistance. a Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN lo ) levels of expression (middle panel) and correlation of OSN sum score with disease-specific survival (DSS) by Kaplan–Meier analysis (right panel). b Same as a but for muscle-invasive bladder cancer (MIBC). c Same as b but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan–Meier analysis (right panel)
    Figure Legend Snippet: Expression of pluripotency master regulators identifies aggressive cancers and disease resistance. a Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN lo ) levels of expression (middle panel) and correlation of OSN sum score with disease-specific survival (DSS) by Kaplan–Meier analysis (right panel). b Same as a but for muscle-invasive bladder cancer (MIBC). c Same as b but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan–Meier analysis (right panel)

    Techniques Used: Expressing, Immunohistochemistry, Staining

    A preclinical model to recreate a stem cell-like aggressive cancer phenotype. a Schematic of culture details of generation of Acquired Pluripotent Stem Cell Environment (APSCE). Briefly, cancer cells were transferred from culture in their regular serum supplemented medium (FM) to culture conditions used for human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) as described in ‘Materials and methods’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. b – d Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. e – g Stemness (OCT4, SOX2, NANOG) and mesenchymal (vimentin, Snail, Slug, N-cadherin) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM (*denotes p -value
    Figure Legend Snippet: A preclinical model to recreate a stem cell-like aggressive cancer phenotype. a Schematic of culture details of generation of Acquired Pluripotent Stem Cell Environment (APSCE). Briefly, cancer cells were transferred from culture in their regular serum supplemented medium (FM) to culture conditions used for human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) as described in ‘Materials and methods’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. b – d Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. e – g Stemness (OCT4, SOX2, NANOG) and mesenchymal (vimentin, Snail, Slug, N-cadherin) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM (*denotes p -value

    Techniques Used: Cell Culture, Magnetic Cell Separation, Selection, Expressing, Real-time Polymerase Chain Reaction

    32) Product Images from "The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance"

    Article Title: The induction of core pluripotency master regulators in cancers defines poor clinical outcomes and treatment resistance

    Journal: Oncogene

    doi: 10.1038/s41388-019-0712-y

    ‘A preclinical model to recreate a stem cell-like aggressive cancer phenotype’. (A) ’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. (B-D) Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. (E-G) Stemness (OCT4, SOX2, NANOG) and mesenchymal (VIMENTIN, SNAIL, SLUG, N-CADHERIN) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM. (*denotes p-value
    Figure Legend Snippet: ‘A preclinical model to recreate a stem cell-like aggressive cancer phenotype’. (A) ’. Following culture of cancer cells in APSCE, tight colonies consisting of smaller cells, morphologically similar to that of ESCs and iPSCs, were observed. (B-D) Prostate (LNCaP), bladder (RT112) and renal (Caki-2) cancer cell growth in serum supplemented medium (FM) and APSCE after 7 days. Of note, for cells cultured in APSCE, feeder cells were used though no MACS selection was performed. (E-G) Stemness (OCT4, SOX2, NANOG) and mesenchymal (VIMENTIN, SNAIL, SLUG, N-CADHERIN) gene expression was measured by quantitative PCR (qPCR) following culture in FM vs APSCE in LNCaP, RT112 and Caki-2 cells. Data represents at least three independent experiments ± SEM. (*denotes p-value

    Techniques Used: Cell Culture, Magnetic Cell Separation, Selection, Expressing, Real-time Polymerase Chain Reaction

    ‘A preclinical model to recreate a stem cell-like aggressive cancer phenotype and identify the underpinning regulatory gene expression networks defining cancer treatment resistance’. (A) Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN low ) levels of expression and correlation of OSN sum score with Disease Specific Survival (DSS) by Kaplan-Meier analysis (right panel). (B) Same as (A) but for muscle-invasive bladder cancer (MIBC). (C) Same as (B) but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan-Meier analysis (right panel).
    Figure Legend Snippet: ‘A preclinical model to recreate a stem cell-like aggressive cancer phenotype and identify the underpinning regulatory gene expression networks defining cancer treatment resistance’. (A) Immunohistochemical analysis of tissue microarrays for prostate cancer demonstrating frequency of OCT4, SOX2 and NANOG expression (left panel), illustrative tissue cores of prostate cancer stained for OCT4, SOX2 and NANOG (OSN) representative of high (OSN hi ) and low (OSN low ) levels of expression and correlation of OSN sum score with Disease Specific Survival (DSS) by Kaplan-Meier analysis (right panel). (B) Same as (A) but for muscle-invasive bladder cancer (MIBC). (C) Same as (B) but for renal cancer. Note correlation of OSN sum score with Progression Free Survival (PFS) by Kaplan-Meier analysis (right panel).

    Techniques Used: Expressing, Immunohistochemistry, Staining

    33) Product Images from "ERK inhibition promotes neuroectodermal precursor commitment by blocking self-renewal and primitive streak formation of the epiblast"

    Article Title: ERK inhibition promotes neuroectodermal precursor commitment by blocking self-renewal and primitive streak formation of the epiblast

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-017-0750-8

    Epiblast cells were committed to neural lineage in 2i/LIF culture condition. a Epiblasts isolated from mouse E5.75 embryos. b Small domed colonies appeared after culturing epiblast cell clumps on MEF feeder in 2i/LIF medium for 3 days. c All clones exhibited neural-like morphology after two passages in 2i/LIF medium. d Real-time PCR showed the mRNA expression pattern of neural-like clones (NLC) was similar to neural stem cells (NSC) other than ESCs. Pluripotent markers, Oct4 and Sox2 ; neuroectoderm markers, Sox2 and Pax6 ; neural stem cell marker, Nestin . RNA collected on day 3 after replating the domed colonies. e Morphology of EpiSCs isolated from mouse E5.75 epiblasts. f NLC emerged by passaging EpiSCs in 2i/LIF medium twice. g NLC expressed the neural stem cell marker NESTIN (green) and the neuron marker TuJ-1 (red). Nuclei counterstained by Hoechst 33342 (blue). h Embryos were obtained from ROSA mT/mG × Nes-cre mouse strains. ROSA mT/mG × Nes-cre E13.5 embryos expressed GFP in the neural system. Only domed ESC clones cultured in 2i/LIF medium and flattened EpiSCs maintained in AFX medium (10 ng/ml Activin A, 5 ng/ml FGF2, and 2 μM XAV939) expressed red tomato; however, domed colonies expressing GFP were observed after EpiSCs were cultured in 2i/LIF for 3 days, indicating CRE activity driven by the Nestin promoter. Bar, 100 μm. E embryonic day, ESC embryonic stem cell, MEF mouse embryonic fibroblasts, EpiSC epiblast stem cell, OCT4 octamer-binding transcription factor 4, Pax6 paired box 6, SOX2 sex determining region Y-box 2
    Figure Legend Snippet: Epiblast cells were committed to neural lineage in 2i/LIF culture condition. a Epiblasts isolated from mouse E5.75 embryos. b Small domed colonies appeared after culturing epiblast cell clumps on MEF feeder in 2i/LIF medium for 3 days. c All clones exhibited neural-like morphology after two passages in 2i/LIF medium. d Real-time PCR showed the mRNA expression pattern of neural-like clones (NLC) was similar to neural stem cells (NSC) other than ESCs. Pluripotent markers, Oct4 and Sox2 ; neuroectoderm markers, Sox2 and Pax6 ; neural stem cell marker, Nestin . RNA collected on day 3 after replating the domed colonies. e Morphology of EpiSCs isolated from mouse E5.75 epiblasts. f NLC emerged by passaging EpiSCs in 2i/LIF medium twice. g NLC expressed the neural stem cell marker NESTIN (green) and the neuron marker TuJ-1 (red). Nuclei counterstained by Hoechst 33342 (blue). h Embryos were obtained from ROSA mT/mG × Nes-cre mouse strains. ROSA mT/mG × Nes-cre E13.5 embryos expressed GFP in the neural system. Only domed ESC clones cultured in 2i/LIF medium and flattened EpiSCs maintained in AFX medium (10 ng/ml Activin A, 5 ng/ml FGF2, and 2 μM XAV939) expressed red tomato; however, domed colonies expressing GFP were observed after EpiSCs were cultured in 2i/LIF for 3 days, indicating CRE activity driven by the Nestin promoter. Bar, 100 μm. E embryonic day, ESC embryonic stem cell, MEF mouse embryonic fibroblasts, EpiSC epiblast stem cell, OCT4 octamer-binding transcription factor 4, Pax6 paired box 6, SOX2 sex determining region Y-box 2

    Techniques Used: Isolation, Clone Assay, Real-time Polymerase Chain Reaction, Expressing, Marker, Passaging, Cell Culture, Activity Assay, Binding Assay

    PD0325901 blocked formation of the primitive streak by preventing β-catenin accumulation in the nucleus. a Immunostaining showed that PD0325901 could not prevent the translocation of SMAD2 into nucleus in EpiSCs induced by Activin A. Bar, 100 μm. b Inhibition of phospho-ERK1/2 by PD0325901 did not affect phospho-SMAD2 and SMAD4 detected by western blot analysis. c Locations of SMAD2/3/4 were not changed in EpiSCs after PD0325901 treatment for 24 hours. C cytoplasm, N nucleus. d Western blot analysis showed that PD0325901 inhibited translocation of β-catenin into the nucleus. XAV939 (XAV, 2 μM) was used as a positive control that promoted the retention of β-catenin in cytoplasm. e PD0325901 increased expression of E-cadherin protein upon N2B27, CHIR99021, and Activin A treatment. SMAD SMAD family member, DMSO dimethyl sulfoxide, PD PD0325901, ERK extracellular signal-regulated protein kinase, SOX2 sex determining region Y-box 2, CHIR CHIR99021, OCT4 octamer-binding transcription factor 4, T brachyury
    Figure Legend Snippet: PD0325901 blocked formation of the primitive streak by preventing β-catenin accumulation in the nucleus. a Immunostaining showed that PD0325901 could not prevent the translocation of SMAD2 into nucleus in EpiSCs induced by Activin A. Bar, 100 μm. b Inhibition of phospho-ERK1/2 by PD0325901 did not affect phospho-SMAD2 and SMAD4 detected by western blot analysis. c Locations of SMAD2/3/4 were not changed in EpiSCs after PD0325901 treatment for 24 hours. C cytoplasm, N nucleus. d Western blot analysis showed that PD0325901 inhibited translocation of β-catenin into the nucleus. XAV939 (XAV, 2 μM) was used as a positive control that promoted the retention of β-catenin in cytoplasm. e PD0325901 increased expression of E-cadherin protein upon N2B27, CHIR99021, and Activin A treatment. SMAD SMAD family member, DMSO dimethyl sulfoxide, PD PD0325901, ERK extracellular signal-regulated protein kinase, SOX2 sex determining region Y-box 2, CHIR CHIR99021, OCT4 octamer-binding transcription factor 4, T brachyury

    Techniques Used: Immunostaining, Translocation Assay, Inhibition, Western Blot, Positive Control, Expressing, Binding Assay

    PD0325901 prevented formation of the primitive streak and inhibits EpiSC self-renewal. a Western blot analysis showed PD0325901 (PD, 1 μM) prevented expression of PS marker T in the presence of CHIR99021 (CHIR, 3 μM) in EpiSCs cultured in N2B27 for 24 hours. b PD0325901 prevented expression of PS marker T and endoderm marker FOXA2 in the presence of Activin A (10 ng/ml) in EpiSCs cultured in N2B27 for 24 hours. c Real-time PCR showed that PD0325901 inhibited differentiation of PS even in the presence of Activin A or CHIR99021. d Immunostaining showed that PD0325901 inhibited both OCT4 and NANOG expression, whereas SB431542 (2 μM) only inhibited NANOG expression in EpiSCs differentiated in N2B27 for 24 hours. Bar, 100 μm. e PD0325901 inhibited both OCT4 and NANOG expression detected by western blot analysis. f Oct4 knockdown promoted PS differentiation in EpiSCs cultured in N2B27 medium for 24 hours. Pluripotent markers, Oct4 and Nanog ; primitive streak markers, T and Mixl1 ; endoderm marker, Foxa2 ; neuroectoderm markers, Sox1, Sox2 and Pax6. AA Activin A, NC negative control, DMSO dimethyl sulfoxide, EpiSC epiblast stem cell, FGF fibroblast growth factor, T brachyury, ERK extracellular signal-regulated protein kinase, OCT4 octamer-binding transcription factor 4, FOXA2 forkhead box protein A2, SOX2 sex determining region Y-box 2, Mixl1 mix paired-like homeobox, Pax6 paired box 6
    Figure Legend Snippet: PD0325901 prevented formation of the primitive streak and inhibits EpiSC self-renewal. a Western blot analysis showed PD0325901 (PD, 1 μM) prevented expression of PS marker T in the presence of CHIR99021 (CHIR, 3 μM) in EpiSCs cultured in N2B27 for 24 hours. b PD0325901 prevented expression of PS marker T and endoderm marker FOXA2 in the presence of Activin A (10 ng/ml) in EpiSCs cultured in N2B27 for 24 hours. c Real-time PCR showed that PD0325901 inhibited differentiation of PS even in the presence of Activin A or CHIR99021. d Immunostaining showed that PD0325901 inhibited both OCT4 and NANOG expression, whereas SB431542 (2 μM) only inhibited NANOG expression in EpiSCs differentiated in N2B27 for 24 hours. Bar, 100 μm. e PD0325901 inhibited both OCT4 and NANOG expression detected by western blot analysis. f Oct4 knockdown promoted PS differentiation in EpiSCs cultured in N2B27 medium for 24 hours. Pluripotent markers, Oct4 and Nanog ; primitive streak markers, T and Mixl1 ; endoderm marker, Foxa2 ; neuroectoderm markers, Sox1, Sox2 and Pax6. AA Activin A, NC negative control, DMSO dimethyl sulfoxide, EpiSC epiblast stem cell, FGF fibroblast growth factor, T brachyury, ERK extracellular signal-regulated protein kinase, OCT4 octamer-binding transcription factor 4, FOXA2 forkhead box protein A2, SOX2 sex determining region Y-box 2, Mixl1 mix paired-like homeobox, Pax6 paired box 6

    Techniques Used: Western Blot, Expressing, Marker, Cell Culture, Real-time Polymerase Chain Reaction, Immunostaining, Negative Control, Binding Assay

    34) Product Images from "Vaccination with Human Induced Pluripotent Stem Cells Creates an Antigen-Specific Immune Response Against HIV-1 gp160"

    Article Title: Vaccination with Human Induced Pluripotent Stem Cells Creates an Antigen-Specific Immune Response Against HIV-1 gp160

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2011.00027

    Expression of HIV-1 gp160 in hiPSCs . (A,B) hiPSCs were transduced with adenoviral vectors encoding HIV-1 gp160 (3,000 vp/cell) or DsRed (3,000 vp/cell) for 24 h. The HIV-1 gp160 protein and its cleaved product (gp41 and gp120) were detected by immunoblotting against anti-HIV-1 gp41 [ (A) left] or anti-HIV-1 gp120 antibodies [ (A) right]. β-actin was used as the internal control. The expression of DsRed or HIV-1 gp160 protein was measured by flow cytometry (B) . The staining patterns of transduced (thick line) and non-transduced (thin line) cells are shown. Percentages of positive-cells after transduction with each adenoviral vectors are also indicated. (C) iPSC markers (Oct4, Nanog, and hTERT) and GAPDH mRNAs were detected in, MRC5 fibroblasts, non-transduced hiPSCs or Ad-gp160-transduced hiPSCs at 24 h by RT-PCR. (D) The iPSC markers Oct4 and SOX2, and HIV-1 gp160 proteins were detected by immunoblotting of MRC5 fibroblasts, non-transduced hiPSCs, and Ad-gp160-transduced hiPSCs.
    Figure Legend Snippet: Expression of HIV-1 gp160 in hiPSCs . (A,B) hiPSCs were transduced with adenoviral vectors encoding HIV-1 gp160 (3,000 vp/cell) or DsRed (3,000 vp/cell) for 24 h. The HIV-1 gp160 protein and its cleaved product (gp41 and gp120) were detected by immunoblotting against anti-HIV-1 gp41 [ (A) left] or anti-HIV-1 gp120 antibodies [ (A) right]. β-actin was used as the internal control. The expression of DsRed or HIV-1 gp160 protein was measured by flow cytometry (B) . The staining patterns of transduced (thick line) and non-transduced (thin line) cells are shown. Percentages of positive-cells after transduction with each adenoviral vectors are also indicated. (C) iPSC markers (Oct4, Nanog, and hTERT) and GAPDH mRNAs were detected in, MRC5 fibroblasts, non-transduced hiPSCs or Ad-gp160-transduced hiPSCs at 24 h by RT-PCR. (D) The iPSC markers Oct4 and SOX2, and HIV-1 gp160 proteins were detected by immunoblotting of MRC5 fibroblasts, non-transduced hiPSCs, and Ad-gp160-transduced hiPSCs.

    Techniques Used: Expressing, Transduction, Flow Cytometry, Cytometry, Staining, Reverse Transcription Polymerase Chain Reaction

    35) Product Images from "The RNA-Binding Protein RBM3 Promotes Neural Stem Cell (NSC) Proliferation Under Hypoxia"

    Article Title: The RNA-Binding Protein RBM3 Promotes Neural Stem Cell (NSC) Proliferation Under Hypoxia

    Journal: Frontiers in Cell and Developmental Biology

    doi: 10.3389/fcell.2019.00288

    Oxygen-sensitive gene expression in NSCs upon hypoxic exposure. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double stainings of C17.2 cells cultured in standard condition with 21% O 2 ; nuclei were counterstained with DAPI. (B–D) mRNA expression of rbm3 (B) , cirp (C) , and kdm3a (D) was measured 16 h after ambient normoxic (21% O 2 ) or indicated hypoxic treatment. Actb was used as an internal control. One-way ANOVA followed by Dunnett’s test was used to compare each hypoxic condition to the normoxic group. N.S. not significant; ∗ p
    Figure Legend Snippet: Oxygen-sensitive gene expression in NSCs upon hypoxic exposure. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double stainings of C17.2 cells cultured in standard condition with 21% O 2 ; nuclei were counterstained with DAPI. (B–D) mRNA expression of rbm3 (B) , cirp (C) , and kdm3a (D) was measured 16 h after ambient normoxic (21% O 2 ) or indicated hypoxic treatment. Actb was used as an internal control. One-way ANOVA followed by Dunnett’s test was used to compare each hypoxic condition to the normoxic group. N.S. not significant; ∗ p

    Techniques Used: Expressing, Cell Culture

    RBM3 positively regulates proliferation in primary NSC from P0 mice under hypoxia. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double staining of primary RBM3 WT and KO NSCs from the forebrains of P0 mice. Nuclei were counterstained with DAPI. (B) RBM3 protein expression in RBM3 WT and KO primary NSCs, and vector transfected WT NSCs from the forebrains of P0 mice. Vec: empty vector; OE: RBM3-overexpressing vector. (C) Representative BrdU and DAPI staining of P0 WT or KO NSCs after 24 h 21, 5, 2.5, or 1% O 2 treatment. (D) Two-way ANOVA followed by Tukey’s test was used for the comparisons in panel (C) . N.S., not significant; ∗ p
    Figure Legend Snippet: RBM3 positively regulates proliferation in primary NSC from P0 mice under hypoxia. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double staining of primary RBM3 WT and KO NSCs from the forebrains of P0 mice. Nuclei were counterstained with DAPI. (B) RBM3 protein expression in RBM3 WT and KO primary NSCs, and vector transfected WT NSCs from the forebrains of P0 mice. Vec: empty vector; OE: RBM3-overexpressing vector. (C) Representative BrdU and DAPI staining of P0 WT or KO NSCs after 24 h 21, 5, 2.5, or 1% O 2 treatment. (D) Two-way ANOVA followed by Tukey’s test was used for the comparisons in panel (C) . N.S., not significant; ∗ p

    Techniques Used: Mouse Assay, Double Staining, Expressing, Plasmid Preparation, Transfection, Staining

    RBM3 positively regulates proliferation in primary NSC from the SGZ of adult mice under hypoxia. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double staining of primary RBM3 WT and KO NSCs from the SGZ of adult mice. Nuclei were counterstained with DAPI. (B) RBM3 protein expression in RBM3 WT and KO primary NSCs, and vector transfected WT NSCs from the SGZ of adult mice. Vec: empty vector; OE: RBM3-overexpressing vector. (C) Representative BrdU and DAPI staining of SGZ-derived adult WT or KO NSCs after 24 h 21, 5, 2.5, or 1% O 2 treatment. (D) Two-way ANOVA followed by Tukey’s test was used for the comparisons in panel (C) . ∗ p
    Figure Legend Snippet: RBM3 positively regulates proliferation in primary NSC from the SGZ of adult mice under hypoxia. (A) Representative Nestin/Sox2 and Dcx/Tuj1 double staining of primary RBM3 WT and KO NSCs from the SGZ of adult mice. Nuclei were counterstained with DAPI. (B) RBM3 protein expression in RBM3 WT and KO primary NSCs, and vector transfected WT NSCs from the SGZ of adult mice. Vec: empty vector; OE: RBM3-overexpressing vector. (C) Representative BrdU and DAPI staining of SGZ-derived adult WT or KO NSCs after 24 h 21, 5, 2.5, or 1% O 2 treatment. (D) Two-way ANOVA followed by Tukey’s test was used for the comparisons in panel (C) . ∗ p

    Techniques Used: Mouse Assay, Double Staining, Expressing, Plasmid Preparation, Transfection, Staining, Derivative Assay

    36) Product Images from "iPSC Modeling of Presenilin1 Mutation in Alzheimer's Disease with Cerebellar Ataxia"

    Article Title: iPSC Modeling of Presenilin1 Mutation in Alzheimer's Disease with Cerebellar Ataxia

    Journal: Experimental Neurobiology

    doi: 10.5607/en.2018.27.5.350

    Generation of iPSCs from an AD patient harboring a PSEN1 (E120K) mutation, and an eldely normal subject. (A) Established iPSC lines from both control and PS1-E120K patient showing the expression of pluripotent stem cell markers, such as OCT4 (red), SOX2 (green), SSEA4 (red) and TRA-1-81 (red). (B) Reverse transcription PCR (RT-PCR) showing the expression of pluripotency markers (OCT4, SOX2, NANOG, SSEA4 AND TRA-1-81) in both iPSC lines. (C) Genomic DNA sequences showing the presence of the heterozygous E120K mutation (GAA to AAA) in the PSEN1 gene of the PS1-E120K-iPSC line. (D) Immunofluorescence analysis showing the potential of iPSC lines to form three germ layers, including ectoderm (type III β-tubulin [TUJ1], green), mesoderm (smooth muscle actin [SMA], green), and endoderm (α-fetoprotein [AFP], red). Scale bar: 100 µm. (E) Karyotype analysis of the control and PS1-E120K iPSC lines. (F) Reverse-transcription PCR analysis showing the absence of integration of the Sendai virus vectors. (G) PCR analysis showing no contamination by mycoplasma.
    Figure Legend Snippet: Generation of iPSCs from an AD patient harboring a PSEN1 (E120K) mutation, and an eldely normal subject. (A) Established iPSC lines from both control and PS1-E120K patient showing the expression of pluripotent stem cell markers, such as OCT4 (red), SOX2 (green), SSEA4 (red) and TRA-1-81 (red). (B) Reverse transcription PCR (RT-PCR) showing the expression of pluripotency markers (OCT4, SOX2, NANOG, SSEA4 AND TRA-1-81) in both iPSC lines. (C) Genomic DNA sequences showing the presence of the heterozygous E120K mutation (GAA to AAA) in the PSEN1 gene of the PS1-E120K-iPSC line. (D) Immunofluorescence analysis showing the potential of iPSC lines to form three germ layers, including ectoderm (type III β-tubulin [TUJ1], green), mesoderm (smooth muscle actin [SMA], green), and endoderm (α-fetoprotein [AFP], red). Scale bar: 100 µm. (E) Karyotype analysis of the control and PS1-E120K iPSC lines. (F) Reverse-transcription PCR analysis showing the absence of integration of the Sendai virus vectors. (G) PCR analysis showing no contamination by mycoplasma.

    Techniques Used: Mutagenesis, Expressing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence

    Cortical neuron differentiation of PS1-E120K- and control-derived iPSCs. (A) Schematic diagram showing our stepwise cortical neuronal differentiation protocol. Control and PS1-E120K patient-derived iPSC lines were differentiated into neural precursor cells (NPC) using the Dual SMAD inhibition method. Afterwards, NPCs were treated with neurotrophic factors including BDNF, GDNF and NT3 to induce cortical neurons. (B) Immunofluorescence analysis of control and PS1-E120K iPSC-derived NPCs, showing the expression of NPC markers, such as Nestin (green), SOX2 (red) and Musashi (green) with DAPI (blue). (C) Immunofluorescence analysis of control and AD-iPSC-derived cortical neurons (TUJ1 [red] and Map2 [green]). Cholinergic neurons (ChAT [red]) and cortical neurons (TBR1 [red] and CTIP2 [green]) at 10 weeks after differentiation were shown. (D) Ratios of each mature neuronal cell type relative to DAPI staining. Scale bar: 50 µm.
    Figure Legend Snippet: Cortical neuron differentiation of PS1-E120K- and control-derived iPSCs. (A) Schematic diagram showing our stepwise cortical neuronal differentiation protocol. Control and PS1-E120K patient-derived iPSC lines were differentiated into neural precursor cells (NPC) using the Dual SMAD inhibition method. Afterwards, NPCs were treated with neurotrophic factors including BDNF, GDNF and NT3 to induce cortical neurons. (B) Immunofluorescence analysis of control and PS1-E120K iPSC-derived NPCs, showing the expression of NPC markers, such as Nestin (green), SOX2 (red) and Musashi (green) with DAPI (blue). (C) Immunofluorescence analysis of control and AD-iPSC-derived cortical neurons (TUJ1 [red] and Map2 [green]). Cholinergic neurons (ChAT [red]) and cortical neurons (TBR1 [red] and CTIP2 [green]) at 10 weeks after differentiation were shown. (D) Ratios of each mature neuronal cell type relative to DAPI staining. Scale bar: 50 µm.

    Techniques Used: Derivative Assay, Inhibition, Immunofluorescence, Expressing, Staining

    37) Product Images from "Multimodal Therapeutic Effects of Neural Precursor Cells Derived from Human-Induced Pluripotent Stem Cells through Episomal Plasmid-Based Reprogramming in a Rodent Model of Ischemic Stroke"

    Article Title: Multimodal Therapeutic Effects of Neural Precursor Cells Derived from Human-Induced Pluripotent Stem Cells through Episomal Plasmid-Based Reprogramming in a Rodent Model of Ischemic Stroke

    Journal: Stem Cells International

    doi: 10.1155/2020/4061516

    Neural induction of human ep-iPSCs into neural precursor cells. (a) Immunofluorescence staining of undifferentiated markers (OCT4, SOX2, NANOG, SSEA4, TRA-1-60, and TRA-1-81) in induced pluripotent stem cells (ep-iPSCs). (b) Fluorescent-activated cell sorting (FACS) analysis of undifferentiated markers (SSEA4 and TRA-1-60) in ep-iPSCs. (c) Polymerase chain reaction (PCR) of undifferentiated markers (OCT4, NANOG, SOX2, and LIN28) in ep-iPSCs. (d) Double immunofluorescence staining for neural precursor cell (NPC) markers (Nestin and SOX2) in ep-iPSC-NPCs. DAPI (blue) stain nuclei. (e) PCR analysis of NPC markers (Nestin and SOX2) in ep-iPSC-NPCs. Scale bars: 50 μ m. ep-iPSC-NPCs: neural precursor cells differentiated from induced pluripotent stem cells.
    Figure Legend Snippet: Neural induction of human ep-iPSCs into neural precursor cells. (a) Immunofluorescence staining of undifferentiated markers (OCT4, SOX2, NANOG, SSEA4, TRA-1-60, and TRA-1-81) in induced pluripotent stem cells (ep-iPSCs). (b) Fluorescent-activated cell sorting (FACS) analysis of undifferentiated markers (SSEA4 and TRA-1-60) in ep-iPSCs. (c) Polymerase chain reaction (PCR) of undifferentiated markers (OCT4, NANOG, SOX2, and LIN28) in ep-iPSCs. (d) Double immunofluorescence staining for neural precursor cell (NPC) markers (Nestin and SOX2) in ep-iPSC-NPCs. DAPI (blue) stain nuclei. (e) PCR analysis of NPC markers (Nestin and SOX2) in ep-iPSC-NPCs. Scale bars: 50 μ m. ep-iPSC-NPCs: neural precursor cells differentiated from induced pluripotent stem cells.

    Techniques Used: Immunofluorescence, Staining, FACS, Polymerase Chain Reaction, Double Immunofluorescence Staining

    38) Product Images from "Sox2 Transcriptionally Regulates Pqbp1, an Intellectual Disability-Microcephaly Causative Gene, in Neural Stem Progenitor Cells"

    Article Title: Sox2 Transcriptionally Regulates Pqbp1, an Intellectual Disability-Microcephaly Causative Gene, in Neural Stem Progenitor Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0068627

    Sox2 regulates PQBP1 expression in vivo . (A) Western blot of primary-cultured neural stem progenitor cells from two Sox2+/− mice and two littermate mice (WT) (E14). Sox2 and PQBP1 proteins were both reduced. (B) Ratios of western blot signal intensities (Sox2/internal control and PQBP1/internal control) were quantified. Asterisk indicates statistical differences (N = 6, p
    Figure Legend Snippet: Sox2 regulates PQBP1 expression in vivo . (A) Western blot of primary-cultured neural stem progenitor cells from two Sox2+/− mice and two littermate mice (WT) (E14). Sox2 and PQBP1 proteins were both reduced. (B) Ratios of western blot signal intensities (Sox2/internal control and PQBP1/internal control) were quantified. Asterisk indicates statistical differences (N = 6, p

    Techniques Used: Expressing, In Vivo, Western Blot, Cell Culture, Mouse Assay

    Screening of cis- elements by luciferase assay. (A) The double-positive cis -elements ( Table 1 ) were subcloned into a reporter plasmid (pGreenFire1-mCMV), and their transcriptional activity was tested by cotransfection with effecter plasmids (Sox2+Pax6 or Sox2+Brn2) into P19 cells. Fold activation was calculated in comparison to the activity of the negative control reporter plasmid possessing a nonsense sequence as the cis -element. We simultaneously tested positive controls (PC) and negative controls (NC) that possess Sox2-Pax6 or Sox2-Brn2 consensus and mutated elements, respectively. Red and yellow bars represent transcriptional activity of PC and NC, respectively. (B) The transcriptional activity of the cis -element (P16A) in neural stem/progenitor cells in vivo was examined by in utero electroporation of the reporter plasmid. Electroporation was performed on E14 and sampling was done on E15. The positive control reporter plasmid, pGreenFire1-PC (Sox2+Pax6)-mCMV, possesses a Sox2-Pax6 consensus sequence. pGreenFire1-16A-mCMV was generated by inserting the 16A oligpnucleotides:GTGAACCCTTTCAGATTTAGTGACGTAGCTTCACAAAGTGATTAA into pGreenFire1-mCMV. Confocal microscopy (LSM510META, CarlZeiss AG) with 40X water emersion lens was used to visualize the fluorescence. Green fluorescent protein signals were detected in NSPCs, even though the DsRed signals were weaker than the positive control, indicating that 16A possessed strong enhancer activity in vivo .
    Figure Legend Snippet: Screening of cis- elements by luciferase assay. (A) The double-positive cis -elements ( Table 1 ) were subcloned into a reporter plasmid (pGreenFire1-mCMV), and their transcriptional activity was tested by cotransfection with effecter plasmids (Sox2+Pax6 or Sox2+Brn2) into P19 cells. Fold activation was calculated in comparison to the activity of the negative control reporter plasmid possessing a nonsense sequence as the cis -element. We simultaneously tested positive controls (PC) and negative controls (NC) that possess Sox2-Pax6 or Sox2-Brn2 consensus and mutated elements, respectively. Red and yellow bars represent transcriptional activity of PC and NC, respectively. (B) The transcriptional activity of the cis -element (P16A) in neural stem/progenitor cells in vivo was examined by in utero electroporation of the reporter plasmid. Electroporation was performed on E14 and sampling was done on E15. The positive control reporter plasmid, pGreenFire1-PC (Sox2+Pax6)-mCMV, possesses a Sox2-Pax6 consensus sequence. pGreenFire1-16A-mCMV was generated by inserting the 16A oligpnucleotides:GTGAACCCTTTCAGATTTAGTGACGTAGCTTCACAAAGTGATTAA into pGreenFire1-mCMV. Confocal microscopy (LSM510META, CarlZeiss AG) with 40X water emersion lens was used to visualize the fluorescence. Green fluorescent protein signals were detected in NSPCs, even though the DsRed signals were weaker than the positive control, indicating that 16A possessed strong enhancer activity in vivo .

    Techniques Used: Luciferase, Plasmid Preparation, Activity Assay, Cotransfection, Activation Assay, Negative Control, Sequencing, In Vivo, In Utero, Electroporation, Sampling, Positive Control, Generated, Confocal Microscopy, Fluorescence

    Screening of cis -elements by a gel mobility shift assay with Sox2-Brn2 or Sox2-Pax6 full-length protein heterodimer. The left panel shows a representative gel mobility shift of Sox2-Brn2 or Sox2-Pax6 consensus probes by the heterodimer of Sox2-Brn2 or Sox2-Pax6 full-length proteins. A supershift of the band with anti-Brn2 or -Pax6 antibody is also shown in the 3 rd lane. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC andSox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA. The right graphs show the radioactivity in the expected area of the gel shift of Sox2-Brn2 or Sox2-Pax6 full-length proteins. The threshold is the average signal intensity plus 1× standard deviation.
    Figure Legend Snippet: Screening of cis -elements by a gel mobility shift assay with Sox2-Brn2 or Sox2-Pax6 full-length protein heterodimer. The left panel shows a representative gel mobility shift of Sox2-Brn2 or Sox2-Pax6 consensus probes by the heterodimer of Sox2-Brn2 or Sox2-Pax6 full-length proteins. A supershift of the band with anti-Brn2 or -Pax6 antibody is also shown in the 3 rd lane. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC andSox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA. The right graphs show the radioactivity in the expected area of the gel shift of Sox2-Brn2 or Sox2-Pax6 full-length proteins. The threshold is the average signal intensity plus 1× standard deviation.

    Techniques Used: Mobility Shift, Radioactivity, Electrophoretic Mobility Shift Assay, Standard Deviation

    PQBP1 is expressed in neural stem progenitor cells (NSPC). (A) Confocal microscopic analysis of VZ at E15 confirmed the colocalization of PQBP1 and Sox2 in the nuclei of NSPCs. Confocal microscopy (LSM510META, Carl Zeiss AG) with 40X water emersion lens was used to visualize the fluorescence. (B) NSPCs from E15 mouse were differentiated by plating them on dishes coated with polyethyleneimine or poly-L-lysine. The upper panels show the chronological expression of the differentiation markers. The lower panels show the downregulation of PQBP1 protein levels by the differentiation of NSPCs. The positive control is Drosophila Schneider cells that express PQBP1 and that do not show a band that is reactive to anti mammal beta-actin antibody. Digital images were captured by an Olympus IX71 microscope.
    Figure Legend Snippet: PQBP1 is expressed in neural stem progenitor cells (NSPC). (A) Confocal microscopic analysis of VZ at E15 confirmed the colocalization of PQBP1 and Sox2 in the nuclei of NSPCs. Confocal microscopy (LSM510META, Carl Zeiss AG) with 40X water emersion lens was used to visualize the fluorescence. (B) NSPCs from E15 mouse were differentiated by plating them on dishes coated with polyethyleneimine or poly-L-lysine. The upper panels show the chronological expression of the differentiation markers. The lower panels show the downregulation of PQBP1 protein levels by the differentiation of NSPCs. The positive control is Drosophila Schneider cells that express PQBP1 and that do not show a band that is reactive to anti mammal beta-actin antibody. Digital images were captured by an Olympus IX71 microscope.

    Techniques Used: Confocal Microscopy, Fluorescence, Expressing, Positive Control, Microscopy

    Possible cis -elements upstream and downstream of the PQBP1 gene. (A) Possible cis -elements were selected by their similarity to the consensus binding sequence of Sox2-Brn2 or Sox2-Pax6. The positions on the genome of the first nucleotide in candidate cis -element sequences are shown. The distance from the 5′-end nucleotide of the PQBP1 gene or from the 3′-end nucleotide of the PQBP1 gene are shown as – or +, respectively. (B) The schematic shows the sites of the candidate cis -elements in the genomic region surrounding the PQBP1 gene.
    Figure Legend Snippet: Possible cis -elements upstream and downstream of the PQBP1 gene. (A) Possible cis -elements were selected by their similarity to the consensus binding sequence of Sox2-Brn2 or Sox2-Pax6. The positions on the genome of the first nucleotide in candidate cis -element sequences are shown. The distance from the 5′-end nucleotide of the PQBP1 gene or from the 3′-end nucleotide of the PQBP1 gene are shown as – or +, respectively. (B) The schematic shows the sites of the candidate cis -elements in the genomic region surrounding the PQBP1 gene.

    Techniques Used: Binding Assay, Sequencing

    Screening of cis- elements by a gel mobility shift assay with the Brn2 or Pax6 DNA-binding domain (DBD). The left panel shows a representative gel mobility shift of the Sox2-Brn2 or Sox2-Pax6 consensus probe by Brn2-DBD or Pax6-DBD. A NF-κB consensus probe was used as a negative control. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC , Sox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA , and NF-κB: GGGAGTTGAGGGGACTTTCCCAGGC. The right graphs show the radioactivity in the expected area of the gel shift of Brn2-DBD or Pax6-DBD (surrounded by red line). The values indicate the fold increase of the band intensity when the intensity of the positive control was set as 1.0.
    Figure Legend Snippet: Screening of cis- elements by a gel mobility shift assay with the Brn2 or Pax6 DNA-binding domain (DBD). The left panel shows a representative gel mobility shift of the Sox2-Brn2 or Sox2-Pax6 consensus probe by Brn2-DBD or Pax6-DBD. A NF-κB consensus probe was used as a negative control. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC , Sox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA , and NF-κB: GGGAGTTGAGGGGACTTTCCCAGGC. The right graphs show the radioactivity in the expected area of the gel shift of Brn2-DBD or Pax6-DBD (surrounded by red line). The values indicate the fold increase of the band intensity when the intensity of the positive control was set as 1.0.

    Techniques Used: Mobility Shift, Binding Assay, Negative Control, Radioactivity, Electrophoretic Mobility Shift Assay, Positive Control

    39) Product Images from "Estrogen-Related Receptor Beta Interacts with Oct4 To Positively Regulate Nanog Gene Expression ▿"

    Article Title: Estrogen-Related Receptor Beta Interacts with Oct4 To Positively Regulate Nanog Gene Expression ▿

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00301-08

    A degenerate ERRE binds Esrrb and is important for Nanog promoter activity. (A) Representation of the degenerate ERRE upstream of the Oct-Sox site in the Nanog promoter. The generated mutation is indicated. (B) Luciferase reporter assays with a wt Nanog promoter construct (wt ERRE) or mutated ERRE promoter construct (mut ERRE). Cotransfected shRNA plasmids are indicated. Error bars represent the standard error of the mean of three independent experiments. (C) Cell lysates from 293T cells cotransfected with FLAG-Esrrb, Oct4, and Sox2 expression plasmids were used in an EMSA with a 57-nucleotide Nanog promoter probe containing the Oct-Sox site sequence and a wt or mutated ERRE. Antibodies were added as indicated. The complex of Esrrb-Oct4-Sox2 (E-O-S) is indicated. (D) Cell lysates from 293T cells transfected with FLAG-Esrrb, Oct4, or Sox2 expression plasmids were subjected to EMSA using the wt Nanog promoter probe. (E) Model showing the enhancement of Esrrb binding to the Nanog promoter by Oct4 and Sox2 which positively affects Nanog promoter activity.
    Figure Legend Snippet: A degenerate ERRE binds Esrrb and is important for Nanog promoter activity. (A) Representation of the degenerate ERRE upstream of the Oct-Sox site in the Nanog promoter. The generated mutation is indicated. (B) Luciferase reporter assays with a wt Nanog promoter construct (wt ERRE) or mutated ERRE promoter construct (mut ERRE). Cotransfected shRNA plasmids are indicated. Error bars represent the standard error of the mean of three independent experiments. (C) Cell lysates from 293T cells cotransfected with FLAG-Esrrb, Oct4, and Sox2 expression plasmids were used in an EMSA with a 57-nucleotide Nanog promoter probe containing the Oct-Sox site sequence and a wt or mutated ERRE. Antibodies were added as indicated. The complex of Esrrb-Oct4-Sox2 (E-O-S) is indicated. (D) Cell lysates from 293T cells transfected with FLAG-Esrrb, Oct4, or Sox2 expression plasmids were subjected to EMSA using the wt Nanog promoter probe. (E) Model showing the enhancement of Esrrb binding to the Nanog promoter by Oct4 and Sox2 which positively affects Nanog promoter activity.

    Techniques Used: Activity Assay, Generated, Mutagenesis, Luciferase, Construct, shRNA, Expressing, Sequencing, Transfection, Binding Assay

    40) Product Images from "Nuclear Factor I isoforms regulate gene expression during the differentiation of human neural progenitors to astrocytes"

    Article Title: Nuclear Factor I isoforms regulate gene expression during the differentiation of human neural progenitors to astrocytes

    Journal: Stem cells (Dayton, Ohio)

    doi: 10.1002/stem.35

    Differentiation of NP into astrocytes NP were submitted to the astrocyte differentiation protocol as described in the M M section for 21 days. (A) Contrast phase microscopic image of NP, generated astrocytes (Diff. Astr), and primary human astrocytes (Astr). (B) Immunocytochemical double-staining of differentiated astrocytes with anti-GFAP (green) and anti-CD44 (red). DAPI (blue) was performed as described in the M M section. (C) Immunocytochemical staining of differentiated astrocytes with anti-GFAP, anti-SOX2, anti-Msi-1, anti-O1, anti-βIII-tubulin, non-specific antibodies (NS), and DAPI (blue). (D) Glutamate uptake was assayed in ESC, NP, Diff. Astr., and Astr. as described in the M M section. Data are expressed in picomoles of glutamate per mg of cellular protein. Experiments were performed at least twice using multiple samples (NEP, n=7, Diff. Astr., n=5; Astr., n=6, ESC, n=4), and error bars indicate the standard deviation values.
    Figure Legend Snippet: Differentiation of NP into astrocytes NP were submitted to the astrocyte differentiation protocol as described in the M M section for 21 days. (A) Contrast phase microscopic image of NP, generated astrocytes (Diff. Astr), and primary human astrocytes (Astr). (B) Immunocytochemical double-staining of differentiated astrocytes with anti-GFAP (green) and anti-CD44 (red). DAPI (blue) was performed as described in the M M section. (C) Immunocytochemical staining of differentiated astrocytes with anti-GFAP, anti-SOX2, anti-Msi-1, anti-O1, anti-βIII-tubulin, non-specific antibodies (NS), and DAPI (blue). (D) Glutamate uptake was assayed in ESC, NP, Diff. Astr., and Astr. as described in the M M section. Data are expressed in picomoles of glutamate per mg of cellular protein. Experiments were performed at least twice using multiple samples (NEP, n=7, Diff. Astr., n=5; Astr., n=6, ESC, n=4), and error bars indicate the standard deviation values.

    Techniques Used: Generated, Double Staining, Staining, Standard Deviation

    Related Articles

    Staining:

    Article Title: Targeted silencing of the oncogenic transcription factor SOX2 in breast cancer
    Article Snippet: .. For staining of tumor sections we used the following antibodies: anti-SOX2 (AB 5603, Millipore, Billerica, MA) 1:500, an anti-Ki67 antibody (ab833, Abcam, Cambridge, MA) 1:100, and an anti-HA antibody (Covance, Princeton, NJ) 1:1000. .. SOX2 was detected using an Alexa-Fluor555 anti-rabbit IgG (Invitrogen, Carlsbad, CA) 1:1000 dilution in MCF7 cells and 1:750 on tumor sections.

    Incubation:

    Article Title: Vascularization and Engraftment of Transplanted Human Cerebral Organoids in Mouse Cortex
    Article Snippet: .. For immunofluorescence analysis, non-specific binding sites were blocked with 4% BSA in PBS (Fisher Bioreagents), 0.2% Tween (Tween 20, Acros Organics), and 10% normal donkey serum (Jackson ImmunoResearch) for 1 h at room temperature, and slices were then incubated with the following antibodies diluted in 4% BSA/PBS, 0.2% Tween: rabbit anti-activated caspase 3 (AC3; Abcam, ab2302, 1:100); rat anti-mouse CD31 (BD Biosciences, 553370, 1:200); rat anti-mouse CD45 (BD Biosciences, 550539, 1:200); guinea pig anti-DCX (Millipore AB2253, 1:500); mouse anti-GalC (Millipore MAB342, 1:200); rabbit anti-GFAP (Invitrogen 180063, 1:200); chicken anti-GFP (Aves Lab, GFP-1020, 1:300); rabbit anti-Iba1 (Wako Chemicals, 019-19741, 1:200); rabbit anti-Ki67 (Abcam, ab15580, 1:500); mouse anti-MTCO2 (Mitochondrially Encoded Cytochrome C Oxidase II; Abcam, ab110258, 1:100); rabbit anti-Nanog (Abcam, ab109250, 1:300); chicken anti-Neurofilament H (NF-H, Abcam Ab5539, 1:300); mouse anti-Oct4 (Abcam, ab184665, 1:300); rabbit anti-Olig2 (Millipore AB9610, 1:500); rabbit anti-SOX2 (Millipore AB5603, 1:200), rabbit anti-TBR1 (Abcam ab31940, 1:500); rabbit anti-TBR2 (Abcam ab23345, 1:500), and mouse anti-tubulin β-III (Tuj1, R & D Systems MAB1195, 1:100). .. Slides were then washed in PBS with 0.1% Tween and detection was performed with Alexa Fluor-coupled secondary antibodies (Invitrogen and Jackson ImmunoResearch) and DAPI nuclear counterstain (Invitrogen).

    Binding Assay:

    Article Title: Vascularization and Engraftment of Transplanted Human Cerebral Organoids in Mouse Cortex
    Article Snippet: .. For immunofluorescence analysis, non-specific binding sites were blocked with 4% BSA in PBS (Fisher Bioreagents), 0.2% Tween (Tween 20, Acros Organics), and 10% normal donkey serum (Jackson ImmunoResearch) for 1 h at room temperature, and slices were then incubated with the following antibodies diluted in 4% BSA/PBS, 0.2% Tween: rabbit anti-activated caspase 3 (AC3; Abcam, ab2302, 1:100); rat anti-mouse CD31 (BD Biosciences, 553370, 1:200); rat anti-mouse CD45 (BD Biosciences, 550539, 1:200); guinea pig anti-DCX (Millipore AB2253, 1:500); mouse anti-GalC (Millipore MAB342, 1:200); rabbit anti-GFAP (Invitrogen 180063, 1:200); chicken anti-GFP (Aves Lab, GFP-1020, 1:300); rabbit anti-Iba1 (Wako Chemicals, 019-19741, 1:200); rabbit anti-Ki67 (Abcam, ab15580, 1:500); mouse anti-MTCO2 (Mitochondrially Encoded Cytochrome C Oxidase II; Abcam, ab110258, 1:100); rabbit anti-Nanog (Abcam, ab109250, 1:300); chicken anti-Neurofilament H (NF-H, Abcam Ab5539, 1:300); mouse anti-Oct4 (Abcam, ab184665, 1:300); rabbit anti-Olig2 (Millipore AB9610, 1:500); rabbit anti-SOX2 (Millipore AB5603, 1:200), rabbit anti-TBR1 (Abcam ab31940, 1:500); rabbit anti-TBR2 (Abcam ab23345, 1:500), and mouse anti-tubulin β-III (Tuj1, R & D Systems MAB1195, 1:100). .. Slides were then washed in PBS with 0.1% Tween and detection was performed with Alexa Fluor-coupled secondary antibodies (Invitrogen and Jackson ImmunoResearch) and DAPI nuclear counterstain (Invitrogen).

    Immunofluorescence:

    Article Title: Vascularization and Engraftment of Transplanted Human Cerebral Organoids in Mouse Cortex
    Article Snippet: .. For immunofluorescence analysis, non-specific binding sites were blocked with 4% BSA in PBS (Fisher Bioreagents), 0.2% Tween (Tween 20, Acros Organics), and 10% normal donkey serum (Jackson ImmunoResearch) for 1 h at room temperature, and slices were then incubated with the following antibodies diluted in 4% BSA/PBS, 0.2% Tween: rabbit anti-activated caspase 3 (AC3; Abcam, ab2302, 1:100); rat anti-mouse CD31 (BD Biosciences, 553370, 1:200); rat anti-mouse CD45 (BD Biosciences, 550539, 1:200); guinea pig anti-DCX (Millipore AB2253, 1:500); mouse anti-GalC (Millipore MAB342, 1:200); rabbit anti-GFAP (Invitrogen 180063, 1:200); chicken anti-GFP (Aves Lab, GFP-1020, 1:300); rabbit anti-Iba1 (Wako Chemicals, 019-19741, 1:200); rabbit anti-Ki67 (Abcam, ab15580, 1:500); mouse anti-MTCO2 (Mitochondrially Encoded Cytochrome C Oxidase II; Abcam, ab110258, 1:100); rabbit anti-Nanog (Abcam, ab109250, 1:300); chicken anti-Neurofilament H (NF-H, Abcam Ab5539, 1:300); mouse anti-Oct4 (Abcam, ab184665, 1:300); rabbit anti-Olig2 (Millipore AB9610, 1:500); rabbit anti-SOX2 (Millipore AB5603, 1:200), rabbit anti-TBR1 (Abcam ab31940, 1:500); rabbit anti-TBR2 (Abcam ab23345, 1:500), and mouse anti-tubulin β-III (Tuj1, R & D Systems MAB1195, 1:100). .. Slides were then washed in PBS with 0.1% Tween and detection was performed with Alexa Fluor-coupled secondary antibodies (Invitrogen and Jackson ImmunoResearch) and DAPI nuclear counterstain (Invitrogen).

    Blocking Assay:

    Article Title: SOX2 Regulates P63 and Stem/Progenitor Cell State in the Corneal Epithelium
    Article Snippet: .. The membranes were blocked with trisma base buffer supplemented with 0.1% tween 20 (TBST, Sigma, USA) containing 5% milk (Bio‐Rad, USA) and probed with one of the following antibodies diluted in blocking solution: rabbit anti‐SOX2 (1:1,000, Millipore, USA), mouse anti‐P63 (1:500, 4A4 Santa Cruz Biotechnology, USA), mouse anti‐K14 (1:1,000, Millipore, USA), mouse anti‐K3 (1:1,000, Millipore, USA), goat anti‐K12 (1:1,000, Santa Cruz Biotechnology, USA), and rabbit anti‐ERK (1:3,500, Santa Cruz Biotechnology, USA) at 4°C, overnight, followed by three washes with TBST. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore anti sox2
    Tamoxifen induces <t>SOX2</t> to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.
    Anti Sox2, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti sox2/product/Millipore
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    anti sox2 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    94
    Millipore sox2
    Phenotype of spinal cord-derived LeX+ cells. a , LeX+ cells were isolated from VZ cells of E10.5 mouse spinal cords by immunomagnetic selection and expanded in vitro . b , FACS analysis of negative control cells. c , FACS analysis showed that positive fractions were 70–98% pure for LeX+ cells. d–f , Isolated LeX+ cells formed a monolayer of cells in culture that were positive for both nestin ( e , red) and LeX ( d , green). g–i , Phase-contrast and immunofluorescence images of LeX+ cells expressing both <t>SOX2</t> (red) and the proliferation marker PCNA (light blue). j , k , LeX+ cells coexpressed the stem cell markers SOX 2 (green) and Musashi-1 (red). Nuclei are labeled with DAPI (4′,6-diamidino-2-phenylindole; blue). f , i , and l show the merged images. Scale bar: d–f , 40 μm; g–l , 50 μm.
    Sox2, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 252 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sox2/product/Millipore
    Average 94 stars, based on 252 article reviews
    Price from $9.99 to $1999.99
    sox2 - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    94
    Millipore mouse monoclonal anti sox2 antibody
    <t>SOX2</t> is required for cutaneous SCC initiation and growth (a) Tumor growth curves of human SCCs infected with lentivirus expressing short hairpin RNA (shRNA) against SOX2 along with nuclear red fluorescent protein (H2B-RFP; shSOX2) or scrambled control shRNA along with nuclear green fluorescent protein (H2B-GFP; shSCR) followed by transplantation onto Nude recipient mice. Data are represented as mean with error bars indicating ± s.e.m. (n=6, *P
    Mouse Monoclonal Anti Sox2 Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse monoclonal anti sox2 antibody/product/Millipore
    Average 94 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    mouse monoclonal anti sox2 antibody - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Tamoxifen induces SOX2 to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

    Journal: Cancers

    Article Title: TARBP2-Enhanced Resistance during Tamoxifen Treatment in Breast Cancer

    doi: 10.3390/cancers11020210

    Figure Lengend Snippet: Tamoxifen induces SOX2 to enhance tamoxifen resistance through TARBP2. ( A , B ) Expression of different stem cell markers after tamoxifen treatment. MCF-7 cells were treated with 2 μM tamoxifen for 48 h and then RNA was isolated to analyze the mRNA expression of stem cell markers by reverse-transcription PCR (qRT-PCR). The experiments were repeated at least 3 times, and ATP5E was used as a positive control for tamoxifen treatment ( A ). * p ≤ 0.05 by t -test. Cells as indicated in ( A ) were collected to analyze protein expression by western blotting ( B ). ( C , D ) Effect of SOX2 expression on tamoxifen sensitivity. MCF-7 cells were transfected with shRNA targeting SOX2 for 48 h and treated with different concentrations of tamoxifen (1, 2, 5, 10, 20 μM) for 72 h. The efficiency of SOX2 knock-down was examined by western blot ( C ), and the proliferation and colony formation were determined by MTT ( D ) and colony formation assays ( E ), respectively. MTT experimental results are given as the means ± SEM from at least three separate experiments that were performed in duplicate or triplicate and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01. ( F , G ) Tamoxifen downregulated the protein level of SOX2 through TARBP2. MCF-7 cells were transfected with shRNAs targeting TARBP2 for 48 h; 2 μM tamoxifen was then added to the culture medium for 48 h. The cells were harvested to determine the protein expressions by western blot. ( G – I ) TARBP2-regulated protein stability of SOX2 in tamoxifen-treated and resistant cells. Tamoxifen-treated (2 μM for 48 h) MCF-7 ( G ) and MCF-7/TR1 ( H ) cells were treated with 50 μg/mL cycloheximide to block protein synthesis and were then harvested at the indicated time point to analyze the expression of SOX2 by western blotting. ( I ) MCF-7 cells were transfected with the indicated shRNAs targeting TARBP2 for 48 h and treated with 2 μM tamoxifen for 48 h. Cells were add 50 μg/mL cycloheximide and harvested at the indicated time point to analyze the expression of SOX2 by western blotting. The degradation rates were plotted for the average ± SEM of at least three independent experiments and analyzed by two-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

    Article Snippet: The primary antibodies used were anti-SOX2 (Millipore, MA, USA; cat. AB5603, 1:50) anti-TARBP2 (Thermo, MA, USA; cat. LF-MA0209, Clone 46D1, 1:600) for 30 min.

    Techniques: Expressing, Isolation, Polymerase Chain Reaction, Quantitative RT-PCR, Positive Control, Western Blot, Transfection, shRNA, MTT Assay, Blocking Assay

    Both SOX2 and TARBP2 expression are elevated in hormone therapy-resistant tumor cells. ( A ) The correlation of SOX2 expression with the overall survival of ER-positive breast cancer patients was analyzed and downloaded using Kaplan-Meier Plotter ( http://kmplot.com/ ). ( B , C ) Association of SOX2 expression and hormone therapy resistance in breast cancer tissues. Representative serial sections of Figure 1 B showed images of SOX2 IHC in primary tumors and tumors in lymph nodes in cases of cancer recurrence ( B ). Scale Bar: 100 uM. Statistics of SOX2 protein expression levels in primary tumors and metastatic tumor cells in cases of cancer recurrence ( C ). ( D ) Resistance mechanism for tamoxifen–induced TARBP2-SOX2 in breast cancer.

    Journal: Cancers

    Article Title: TARBP2-Enhanced Resistance during Tamoxifen Treatment in Breast Cancer

    doi: 10.3390/cancers11020210

    Figure Lengend Snippet: Both SOX2 and TARBP2 expression are elevated in hormone therapy-resistant tumor cells. ( A ) The correlation of SOX2 expression with the overall survival of ER-positive breast cancer patients was analyzed and downloaded using Kaplan-Meier Plotter ( http://kmplot.com/ ). ( B , C ) Association of SOX2 expression and hormone therapy resistance in breast cancer tissues. Representative serial sections of Figure 1 B showed images of SOX2 IHC in primary tumors and tumors in lymph nodes in cases of cancer recurrence ( B ). Scale Bar: 100 uM. Statistics of SOX2 protein expression levels in primary tumors and metastatic tumor cells in cases of cancer recurrence ( C ). ( D ) Resistance mechanism for tamoxifen–induced TARBP2-SOX2 in breast cancer.

    Article Snippet: The primary antibodies used were anti-SOX2 (Millipore, MA, USA; cat. AB5603, 1:50) anti-TARBP2 (Thermo, MA, USA; cat. LF-MA0209, Clone 46D1, 1:600) for 30 min.

    Techniques: Expressing, Immunohistochemistry

    Phenotype of spinal cord-derived LeX+ cells. a , LeX+ cells were isolated from VZ cells of E10.5 mouse spinal cords by immunomagnetic selection and expanded in vitro . b , FACS analysis of negative control cells. c , FACS analysis showed that positive fractions were 70–98% pure for LeX+ cells. d–f , Isolated LeX+ cells formed a monolayer of cells in culture that were positive for both nestin ( e , red) and LeX ( d , green). g–i , Phase-contrast and immunofluorescence images of LeX+ cells expressing both SOX2 (red) and the proliferation marker PCNA (light blue). j , k , LeX+ cells coexpressed the stem cell markers SOX 2 (green) and Musashi-1 (red). Nuclei are labeled with DAPI (4′,6-diamidino-2-phenylindole; blue). f , i , and l show the merged images. Scale bar: d–f , 40 μm; g–l , 50 μm.

    Journal: The Journal of Neuroscience

    Article Title: Motoneuron Transplantation Rescues the Phenotype of SMARD1 (Spinal Muscular Atrophy with Respiratory Distress Type 1)

    doi: 10.1523/JNEUROSCI.2734-09.2009

    Figure Lengend Snippet: Phenotype of spinal cord-derived LeX+ cells. a , LeX+ cells were isolated from VZ cells of E10.5 mouse spinal cords by immunomagnetic selection and expanded in vitro . b , FACS analysis of negative control cells. c , FACS analysis showed that positive fractions were 70–98% pure for LeX+ cells. d–f , Isolated LeX+ cells formed a monolayer of cells in culture that were positive for both nestin ( e , red) and LeX ( d , green). g–i , Phase-contrast and immunofluorescence images of LeX+ cells expressing both SOX2 (red) and the proliferation marker PCNA (light blue). j , k , LeX+ cells coexpressed the stem cell markers SOX 2 (green) and Musashi-1 (red). Nuclei are labeled with DAPI (4′,6-diamidino-2-phenylindole; blue). f , i , and l show the merged images. Scale bar: d–f , 40 μm; g–l , 50 μm.

    Article Snippet: The following proteins were evaluated using the diluted antibodies indicated in parentheses: nestin (mouse monoclonal antibody; 1:200; Millipore Bioscience Research Reagents), LeX (mouse antibody; 1:200; BD Biosciences), Sox2 (rabbit antibody; 1:200; Millipore Bioscience Research Reagents), Musashi-1 (rabbit antibody; 1:200; Millipore Bioscience Research Reagents), proliferating cell nuclear antigen (PCNA; mouse monoclonal antibody; 1:200; Millipore Bioscience Research Reagents), nuclear neural-specific antigen (NeuN; mouse monoclonal antibody; 1:100; Millipore Bioscience Research Reagents), anti-PDGFRα (platelet-derived growth factor receptor α) antibody (clone APA5, 1:200; eBioscience), Olig2 (rabbit polyclonal antibody; 1:500; Millipore Bioscience Research Reagents), Irx3 (rabbit polyclonal antibody; 1:100; Santa Cruz Biotechnology), Nkx2.2 (rabbit polyclonal antibody;1:200; Millipore Bioscience Research Reagents), HOXC6 (goat polyclonal antibody; 1:100; Santa Cruz Biotechnology), HOXC8 (mouse antibody; 1:200; Covance), otx2 (rabbit polyclonal antibody; 1:200; Millipore Bioscience Research Reagents), En1 (rabbit polyclonal antibody; 1:200; Millipore Bioscience Research Reagents), HB9 (rabbit antibody; 1:200; Millipore Bioscience Research Reagents), Islet-1 (rabbit antibody; 1:200; Millipore Bioscience Research Reagents), TuJ-1 (mouse monoclonal antibody; 1:200; Millipore Bioscience Research Reagents), phosphorylated neurofilament (NF)-M and NF-H (mouse monoclonal antibody; 1:200; Millipore Bioscience Research Reagents), microtubule-associated protein 2 (MAP2; mouse monoclonal antibody; 1:100; Sigma-Aldrich), anti-choline acetyltransferase (ChAT; rabbit antibody; 1:100; Millipore Bioscience Research Reagents), and GFP (Alexa 488 rabbit polyclonal antibody; 1:400; Molecular Probes).

    Techniques: Derivative Assay, Isolation, Selection, In Vitro, FACS, Negative Control, Immunofluorescence, Expressing, Marker, Labeling

    SOX2 is required for cutaneous SCC initiation and growth (a) Tumor growth curves of human SCCs infected with lentivirus expressing short hairpin RNA (shRNA) against SOX2 along with nuclear red fluorescent protein (H2B-RFP; shSOX2) or scrambled control shRNA along with nuclear green fluorescent protein (H2B-GFP; shSCR) followed by transplantation onto Nude recipient mice. Data are represented as mean with error bars indicating ± s.e.m. (n=6, *P

    Journal: Nature communications

    Article Title: SOX2 is a cancer-specific regulator of tumor initiating potential in cutaneous squamous cell carcinoma

    doi: 10.1038/ncomms5511

    Figure Lengend Snippet: SOX2 is required for cutaneous SCC initiation and growth (a) Tumor growth curves of human SCCs infected with lentivirus expressing short hairpin RNA (shRNA) against SOX2 along with nuclear red fluorescent protein (H2B-RFP; shSOX2) or scrambled control shRNA along with nuclear green fluorescent protein (H2B-GFP; shSCR) followed by transplantation onto Nude recipient mice. Data are represented as mean with error bars indicating ± s.e.m. (n=6, *P

    Article Snippet: Chromatin (40 or 80 µg per IP) was immunoprecipitated with 2 or 4 µg mouse monoclonal anti-Sox2 antibody (17–656, Millipore) or control normal mouse IgG (17–656, Millipore) at 4°C overnight.

    Techniques: Infection, Expressing, shRNA, Transplantation Assay, Mouse Assay

    SOX2 expression promotes TIC divisions along the tumor-stroma interface (a) Confocal sections of human SCCs stained with SOX2 (green), Survivin (SURV, red), α6-integrin (α6, white) and DAPI (blue). Scale bars indicate 10 µm. (b–c) Radial histograms indicating the orientation of basal cell divisions relative to the tumor-stroma interface expressing high (green) or low (red) levels of SOX2 in human (b) and mouse (c) SCCs. Blue lines indicate median division angles. (d) Projections of representative three-dimensional immunofluorescence micrographs of shSCR;H2B-GFP and shSOX2;H2B-RFP clones in A431 xenografts stained with Survivin (SURV, white), α6-integrin (blue). Scale bars indicate 10 µm. (e–f) Radial histograms describe the orientation of basal cell divisions relative to the tumor-stroma interface in shSCR;H2B-GFP (green) and shSOX2;H2B-RFP (red) clones in human (e) and mouse (f) SCC transplants. Blue lines indicate median division angles. (g–h) Flow cytometric analyses of shSCR;H2B-GFP and shSOX2;H2B-RFP clonal competition assays two weeks after transplantation. (g) Scatter plots illustrate the relative abundance of shSCR;H2B-GFP and shSOX2;H2B-RFP cells within the α6/β1-integrin high and low gates. (h) Bar graphs show mean population size of shSOX2;H2B-RFP and shSCR;H2B-GFP expressing cells within the α6-integrin-high and α6-integrin-low gates with error bars indicating ± s.d (n=6, *P

    Journal: Nature communications

    Article Title: SOX2 is a cancer-specific regulator of tumor initiating potential in cutaneous squamous cell carcinoma

    doi: 10.1038/ncomms5511

    Figure Lengend Snippet: SOX2 expression promotes TIC divisions along the tumor-stroma interface (a) Confocal sections of human SCCs stained with SOX2 (green), Survivin (SURV, red), α6-integrin (α6, white) and DAPI (blue). Scale bars indicate 10 µm. (b–c) Radial histograms indicating the orientation of basal cell divisions relative to the tumor-stroma interface expressing high (green) or low (red) levels of SOX2 in human (b) and mouse (c) SCCs. Blue lines indicate median division angles. (d) Projections of representative three-dimensional immunofluorescence micrographs of shSCR;H2B-GFP and shSOX2;H2B-RFP clones in A431 xenografts stained with Survivin (SURV, white), α6-integrin (blue). Scale bars indicate 10 µm. (e–f) Radial histograms describe the orientation of basal cell divisions relative to the tumor-stroma interface in shSCR;H2B-GFP (green) and shSOX2;H2B-RFP (red) clones in human (e) and mouse (f) SCC transplants. Blue lines indicate median division angles. (g–h) Flow cytometric analyses of shSCR;H2B-GFP and shSOX2;H2B-RFP clonal competition assays two weeks after transplantation. (g) Scatter plots illustrate the relative abundance of shSCR;H2B-GFP and shSOX2;H2B-RFP cells within the α6/β1-integrin high and low gates. (h) Bar graphs show mean population size of shSOX2;H2B-RFP and shSCR;H2B-GFP expressing cells within the α6-integrin-high and α6-integrin-low gates with error bars indicating ± s.d (n=6, *P

    Article Snippet: Chromatin (40 or 80 µg per IP) was immunoprecipitated with 2 or 4 µg mouse monoclonal anti-Sox2 antibody (17–656, Millipore) or control normal mouse IgG (17–656, Millipore) at 4°C overnight.

    Techniques: Expressing, Staining, Immunofluorescence, Clone Assay, Flow Cytometry, Transplantation Assay

    SOX2 expression distinguishes TICs from normal skin epithelial cells (a) Scatter plot illustrating gene expression values of 45,101 transcripts in tumor-initiating cells (TIC) of murine (m) cutaneous squamous cell carcinoma (SCC) compared to hair follicle stem cells (HFSCs). Red and green dots indicate highly enriched transcription factors in mTICs and mHFSCs, respectively. (b) qRT-PCR analyses of Sox2, Pitx1, and Twist1 on RNA from freshly sorted mTICs and mHFSCs. (c) qRT-PCR analysis of Sox2, Pitx1, and Twist1 on RNA from cultured mTICs and mHFSCs. (d) qRT-PCR analysis of SOX2, PITX1, and TWIST1 on RNA from human foreskin (FSK) and SCC13 cultures. (b–d) Data are represented as mean with error bars indicating ± s.d. (n=3, *P

    Journal: Nature communications

    Article Title: SOX2 is a cancer-specific regulator of tumor initiating potential in cutaneous squamous cell carcinoma

    doi: 10.1038/ncomms5511

    Figure Lengend Snippet: SOX2 expression distinguishes TICs from normal skin epithelial cells (a) Scatter plot illustrating gene expression values of 45,101 transcripts in tumor-initiating cells (TIC) of murine (m) cutaneous squamous cell carcinoma (SCC) compared to hair follicle stem cells (HFSCs). Red and green dots indicate highly enriched transcription factors in mTICs and mHFSCs, respectively. (b) qRT-PCR analyses of Sox2, Pitx1, and Twist1 on RNA from freshly sorted mTICs and mHFSCs. (c) qRT-PCR analysis of Sox2, Pitx1, and Twist1 on RNA from cultured mTICs and mHFSCs. (d) qRT-PCR analysis of SOX2, PITX1, and TWIST1 on RNA from human foreskin (FSK) and SCC13 cultures. (b–d) Data are represented as mean with error bars indicating ± s.d. (n=3, *P

    Article Snippet: Chromatin (40 or 80 µg per IP) was immunoprecipitated with 2 or 4 µg mouse monoclonal anti-Sox2 antibody (17–656, Millipore) or control normal mouse IgG (17–656, Millipore) at 4°C overnight.

    Techniques: Expressing, Quantitative RT-PCR, Cell Culture

    Sox2 promotes the expression of pro-angiogenic factors in tumor-initiating cells (a) Venn diagram depicting overlap of 466 genes between the mouse TIC signature and a list of direct Sox2 targets in mouse ES cells. (b) Histogram illustrating the relative enrichment of 466 putative Sox2 target genes in mouse TICs compared to skin epithelial stem and progenitor cells. 254 genes are > 2 fold upregulated (red) and 212 genes are > 2-fold downregulated (blue). Pro-angiogenic molecules and Pitx1 are amongst the highest differentially expressed genes (c) Heat map exemplifying elevated expression of Pitx1 and pro-angiogenic factors, and the suppression of HFSC markers in TICs. d , qRT-PCR analysis of Spp1, Pitpnc, and Igf2bp2 on TIC and HFSC cultures. (e) qRT-PCR analysis of Pitx1 and pro-angiogenic factors on mTIC cultures transduced with shScr or shSox2. (f) qRT-PCR analyses on chromatin samples from cultured mTICs after immunoprecipitation with anti-Sox2 and IgG control antibodies. (g) qRT-PCR analysis of EGF and VEGF signaling pathway components on primary mTICs and mHFSC cultures. (h) qRT-PCR analysis of EGF and VEGF signaling pathway components on mTIC cultures transduced with shScr or shSox2. (d–h) Bar graphs showing mean with error bars indicating ± s.d. (n=3, *P

    Journal: Nature communications

    Article Title: SOX2 is a cancer-specific regulator of tumor initiating potential in cutaneous squamous cell carcinoma

    doi: 10.1038/ncomms5511

    Figure Lengend Snippet: Sox2 promotes the expression of pro-angiogenic factors in tumor-initiating cells (a) Venn diagram depicting overlap of 466 genes between the mouse TIC signature and a list of direct Sox2 targets in mouse ES cells. (b) Histogram illustrating the relative enrichment of 466 putative Sox2 target genes in mouse TICs compared to skin epithelial stem and progenitor cells. 254 genes are > 2 fold upregulated (red) and 212 genes are > 2-fold downregulated (blue). Pro-angiogenic molecules and Pitx1 are amongst the highest differentially expressed genes (c) Heat map exemplifying elevated expression of Pitx1 and pro-angiogenic factors, and the suppression of HFSC markers in TICs. d , qRT-PCR analysis of Spp1, Pitpnc, and Igf2bp2 on TIC and HFSC cultures. (e) qRT-PCR analysis of Pitx1 and pro-angiogenic factors on mTIC cultures transduced with shScr or shSox2. (f) qRT-PCR analyses on chromatin samples from cultured mTICs after immunoprecipitation with anti-Sox2 and IgG control antibodies. (g) qRT-PCR analysis of EGF and VEGF signaling pathway components on primary mTICs and mHFSC cultures. (h) qRT-PCR analysis of EGF and VEGF signaling pathway components on mTIC cultures transduced with shScr or shSox2. (d–h) Bar graphs showing mean with error bars indicating ± s.d. (n=3, *P

    Article Snippet: Chromatin (40 or 80 µg per IP) was immunoprecipitated with 2 or 4 µg mouse monoclonal anti-Sox2 antibody (17–656, Millipore) or control normal mouse IgG (17–656, Millipore) at 4°C overnight.

    Techniques: Expressing, Quantitative RT-PCR, Transduction, Cell Culture, Immunoprecipitation

    NRP1 expression is regulated by SOX2 and required for SCC growth (a) qRT-PCR analysis of SOX2 and NRP1 on human SCC13 cells transduced with shSCR and shSOX2. (b) qRT-PCR analyses on chromatin samples from cultured human SCC13 and A431 cells after immunoprecipitation with anti-Sox2 and IgG control antibodies. (a–b) Bar graphs show mean with error bars indicating ± s.d (n=3, *P

    Journal: Nature communications

    Article Title: SOX2 is a cancer-specific regulator of tumor initiating potential in cutaneous squamous cell carcinoma

    doi: 10.1038/ncomms5511

    Figure Lengend Snippet: NRP1 expression is regulated by SOX2 and required for SCC growth (a) qRT-PCR analysis of SOX2 and NRP1 on human SCC13 cells transduced with shSCR and shSOX2. (b) qRT-PCR analyses on chromatin samples from cultured human SCC13 and A431 cells after immunoprecipitation with anti-Sox2 and IgG control antibodies. (a–b) Bar graphs show mean with error bars indicating ± s.d (n=3, *P

    Article Snippet: Chromatin (40 or 80 µg per IP) was immunoprecipitated with 2 or 4 µg mouse monoclonal anti-Sox2 antibody (17–656, Millipore) or control normal mouse IgG (17–656, Millipore) at 4°C overnight.

    Techniques: Expressing, Quantitative RT-PCR, Transduction, Cell Culture, Immunoprecipitation

    Expression of Smad3 at different stages of neuronal precursor maturation. (A) In the prevailing model of AHN, quiescent radial glia-like cells (RGL or Type-1 cells) generate proliferative precursors known as intermediate progenitors cells (Type-2 cells), which give rise to neuroblasts (Type-3 cells), then to immature neurons and finally generating mature granule neurons. The identification of the different type of cells is based on the expression of specific precursors and lineage markers. Confocal microscopy images of (B) Nestin/Smad3, (C) Sox2/Smad3, (D) GFAP/Smad3, (E) Mash1/Smad3, (F) DCX/Smad3 double-labeled cells with no dendrite maturation, indicative of Type 2b or neuroblast cells, and (G) with dendrite maturation indicative of immature neurons. Scale bar 10 μm.

    Journal: Cell Communication and Signaling : CCS

    Article Title: Smad3 is required for the survival of proliferative intermediate progenitor cells in the dentate gyrus of adult mice

    doi: 10.1186/1478-811X-11-93

    Figure Lengend Snippet: Expression of Smad3 at different stages of neuronal precursor maturation. (A) In the prevailing model of AHN, quiescent radial glia-like cells (RGL or Type-1 cells) generate proliferative precursors known as intermediate progenitors cells (Type-2 cells), which give rise to neuroblasts (Type-3 cells), then to immature neurons and finally generating mature granule neurons. The identification of the different type of cells is based on the expression of specific precursors and lineage markers. Confocal microscopy images of (B) Nestin/Smad3, (C) Sox2/Smad3, (D) GFAP/Smad3, (E) Mash1/Smad3, (F) DCX/Smad3 double-labeled cells with no dendrite maturation, indicative of Type 2b or neuroblast cells, and (G) with dendrite maturation indicative of immature neurons. Scale bar 10 μm.

    Article Snippet: Double immunofluorescence was performed using antigen retrieval and the following antibodies: rabbit anti-Smad3 (1:150; Abcam), rat anti-BrdU (1:1500; Abcam), rabbit anti-phospho-Smad3 (1:200; Cell Signal, Danver, MA, USA), mouse anti-nestin (1:200; Millipore, Billerica, MA, USA); mouse anti-GFAP (1:1500; Chemicon, Temecula, CA, USA), mouse anti-SOX2 (1:1000; Calbiochem, San Diego, CA, USA), mouse anti-Mash1 (1:100; BD Biosciences, San José, CA, USA), mouse anti-NeuN (1:400; Chemicon), goat anti-DCX (1:300; Santa Cruz, Dallas, TX, USA), rabbit anti-S100β (1:1000; Millipore), rabbit anti-pHisH3 (1:8000; Santa Cruz), and rabbit anti-activated caspase 3 (1:800; Cell Signal).

    Techniques: Expressing, Confocal Microscopy, Labeling