Structured Review

Santa Cruz Biotechnology anti rarα
RAR expression. (A) Analysis of <t>RARα</t> and RARγ expression in 2B1 cells by Western blot analysis. (B) Schematic diagram of a prototypical RAR. Three RAR genes (α, β, and γ) encode receptors that are unrelated in their amino-terminal A and B domains but highly similar in their DNA and ligand binding domains (DBD and LBD, respectively).
Anti Rarα, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti rarα/product/Santa Cruz Biotechnology
Average 99 stars, based on 9 article reviews
Price from $9.99 to $1999.99
anti rarα - by Bioz Stars, 2019-10
99/100 stars

Images

1) Product Images from "Retinoic Acid Repression of Bone Morphogenetic Protein 4 in Inner Ear Development"

Article Title: Retinoic Acid Repression of Bone Morphogenetic Protein 4 in Inner Ear Development

Journal:

doi: 10.1128/MCB.23.7.2277-2286.2003

RAR expression. (A) Analysis of RARα and RARγ expression in 2B1 cells by Western blot analysis. (B) Schematic diagram of a prototypical RAR. Three RAR genes (α, β, and γ) encode receptors that are unrelated in their amino-terminal A and B domains but highly similar in their DNA and ligand binding domains (DBD and LBD, respectively).
Figure Legend Snippet: RAR expression. (A) Analysis of RARα and RARγ expression in 2B1 cells by Western blot analysis. (B) Schematic diagram of a prototypical RAR. Three RAR genes (α, β, and γ) encode receptors that are unrelated in their amino-terminal A and B domains but highly similar in their DNA and ligand binding domains (DBD and LBD, respectively).

Techniques Used: Expressing, Western Blot, Ligand Binding Assay

2) Product Images from "Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system"

Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

Journal: Mucosal immunology

doi: 10.1038/mi.2017.91

Dendritic cell numbers are decreased in RARα villin mice. Cell suspensions from small intestinal lamina propria were analyzed by FACS. ( a ) Analysis of single live CD45 + events from the flow cytometry data of SI lamina propria isolated form control or RARα villin mice using the t-distributed stochastic linear embedding (tSNE) algorithm (one representative analysis of two) ( b ) Representative dot plots showing total dendritic cells (left column) and subsets defined by CD103 and CD11b expression (middle column) as well as macrophages defined by CD64 (right column). ( c ) Quantification of the frequencies of dendritic cells (DCs) and the CD103 + subset. ( n = 4; 2 experiments) ( d ) Expression of CD11c in the small intestine was determined by immunohistochemistry. Representative images of 6 images/mouse (n = 3 mice). ( e ) Representative dot plot and quantification of RA-producing dendritic cells in the small intestine lamina propria determined by ALDEFLUOR (ALDE) ( n = 4; 2 experiments). * P
Figure Legend Snippet: Dendritic cell numbers are decreased in RARα villin mice. Cell suspensions from small intestinal lamina propria were analyzed by FACS. ( a ) Analysis of single live CD45 + events from the flow cytometry data of SI lamina propria isolated form control or RARα villin mice using the t-distributed stochastic linear embedding (tSNE) algorithm (one representative analysis of two) ( b ) Representative dot plots showing total dendritic cells (left column) and subsets defined by CD103 and CD11b expression (middle column) as well as macrophages defined by CD64 (right column). ( c ) Quantification of the frequencies of dendritic cells (DCs) and the CD103 + subset. ( n = 4; 2 experiments) ( d ) Expression of CD11c in the small intestine was determined by immunohistochemistry. Representative images of 6 images/mouse (n = 3 mice). ( e ) Representative dot plot and quantification of RA-producing dendritic cells in the small intestine lamina propria determined by ALDEFLUOR (ALDE) ( n = 4; 2 experiments). * P

Techniques Used: Mouse Assay, FACS, Flow Cytometry, Cytometry, Isolation, Expressing, Immunohistochemistry

RARα signaling on IECs regulates intestinal secretory cell differentiation and immunological fitness. Scheme showing the proposed model in which RARα expression in proliferating cells (transit amplifying progenitors) restrict secretory cell differentiation and Reg3g expression which is associated to proper microbiota composition and immune cell development.
Figure Legend Snippet: RARα signaling on IECs regulates intestinal secretory cell differentiation and immunological fitness. Scheme showing the proposed model in which RARα expression in proliferating cells (transit amplifying progenitors) restrict secretory cell differentiation and Reg3g expression which is associated to proper microbiota composition and immune cell development.

Techniques Used: Cell Differentiation, Expressing

RARα deficiency in the epithelial compartment results in defective clearance of C. rodentium. ( a ) CFU from control and RARα villin mice infected with C. rodentium . ( n = 4; 2 experiments) ( b ). Bioluminescence of cultured stool samples (colon), spleen, and MLN cell suspensions. ( c ) Bioluminescence of whole animal. ( d ) Body weight loss curves from control and RARα villin mice infected with C. rodentium (2 x10 9 CFU). ( n = 5; 2 experiments *** P
Figure Legend Snippet: RARα deficiency in the epithelial compartment results in defective clearance of C. rodentium. ( a ) CFU from control and RARα villin mice infected with C. rodentium . ( n = 4; 2 experiments) ( b ). Bioluminescence of cultured stool samples (colon), spleen, and MLN cell suspensions. ( c ) Bioluminescence of whole animal. ( d ) Body weight loss curves from control and RARα villin mice infected with C. rodentium (2 x10 9 CFU). ( n = 5; 2 experiments *** P

Techniques Used: Mouse Assay, Infection, Cell Culture

RARα controls epithelial homeostasis. ( a–b ) Mucins-containing goblet cells were stained with Alcian Blue and their number per villus determined. ( c–d ) Paneth cells were immunostained with anti-lysozyme and their number per villus and position along the crypt-villus axis determined ( n = 7–19 villus/mouse). ( e–f ) Enteroendocrine cells were immunostained with anti-Chromogranin A and their number per villus determined ( n = 7–12 villus/mouse). Data in ( a–b ) are representative of three mice/genotype. ** P
Figure Legend Snippet: RARα controls epithelial homeostasis. ( a–b ) Mucins-containing goblet cells were stained with Alcian Blue and their number per villus determined. ( c–d ) Paneth cells were immunostained with anti-lysozyme and their number per villus and position along the crypt-villus axis determined ( n = 7–19 villus/mouse). ( e–f ) Enteroendocrine cells were immunostained with anti-Chromogranin A and their number per villus determined ( n = 7–12 villus/mouse). Data in ( a–b ) are representative of three mice/genotype. ** P

Techniques Used: Staining, Mouse Assay

RARα modulates differentiation within the secretory branch through KLF4. ( a ) Proliferative cells were identified by BrdU incorporation in parallel with lysozyme or muc-2 to detect paneth cells (left) and goblet cells (right), respectively. ( b–c ) KLF4 expression was measured in the distal small intestine ( b ) and colon ( c ) by immunohistochemistry and number of positive nuclei were counted per intestinal gland. 7–10 crypts were counted per intestine section in 2 mice per genotype. ( d ) RT-qPCR analysis of RAR target gene cyp26a1 and the transcription factor klf4 in zebrafish embryos treated with either vehicle or 1μM RA from 72 hours post-fertilization (hpf) till 108 hpf. Each dot represents a pool of 20 embryos. The mRNA expression was normalized to that of ef1α . ( e ) Whole-mount alcian blue staining of zebrafish embryos treated with either vehicle or 1μM RA from 72 hpf till 108 hpf (images). The graph represent quantification of alcian blue positive cells per intestine ( n =8 per group). * P
Figure Legend Snippet: RARα modulates differentiation within the secretory branch through KLF4. ( a ) Proliferative cells were identified by BrdU incorporation in parallel with lysozyme or muc-2 to detect paneth cells (left) and goblet cells (right), respectively. ( b–c ) KLF4 expression was measured in the distal small intestine ( b ) and colon ( c ) by immunohistochemistry and number of positive nuclei were counted per intestinal gland. 7–10 crypts were counted per intestine section in 2 mice per genotype. ( d ) RT-qPCR analysis of RAR target gene cyp26a1 and the transcription factor klf4 in zebrafish embryos treated with either vehicle or 1μM RA from 72 hours post-fertilization (hpf) till 108 hpf. Each dot represents a pool of 20 embryos. The mRNA expression was normalized to that of ef1α . ( e ) Whole-mount alcian blue staining of zebrafish embryos treated with either vehicle or 1μM RA from 72 hpf till 108 hpf (images). The graph represent quantification of alcian blue positive cells per intestine ( n =8 per group). * P

Techniques Used: BrdU Incorporation Assay, Expressing, Immunohistochemistry, Mouse Assay, Quantitative RT-PCR, Staining

Dysbiosis in RARα villin mice. ( a ) qPCR analysis from FACS-sorted epithelial cells (CD45 neg EpCAM + ) obtained from the proximal or distal small intestine of either control or RARα villin mice. Data shows transcript levels as arbitrary units (A.U.) respect to hprt ( n = 3 mice). ( b ) Fluorescence in situ hybridization of universal 16S ribosomal RNA in DAPI-stained ileal tissues from control and RARα villin mice. Original magnification, 10X. One representative image of 3–6 images/mouse ( n = 2 mice). ( c ) 16S rDNA mean intensities (sum of pixel intensities/number of pixels) are reported. Scale bar, 10 μm. ( d ) qPCR analysis shows arbitrary units (A.U.) of lactobacillus, enterobacterae (entero), bacteroides, clostridia and segmented filamentous bacteria (SFB) relative to universal 16S levels. Bacterial DNA was isolated from luminal stool obtained from the small intestine (SI) or colon ( n = 3; 2 experiments). * P
Figure Legend Snippet: Dysbiosis in RARα villin mice. ( a ) qPCR analysis from FACS-sorted epithelial cells (CD45 neg EpCAM + ) obtained from the proximal or distal small intestine of either control or RARα villin mice. Data shows transcript levels as arbitrary units (A.U.) respect to hprt ( n = 3 mice). ( b ) Fluorescence in situ hybridization of universal 16S ribosomal RNA in DAPI-stained ileal tissues from control and RARα villin mice. Original magnification, 10X. One representative image of 3–6 images/mouse ( n = 2 mice). ( c ) 16S rDNA mean intensities (sum of pixel intensities/number of pixels) are reported. Scale bar, 10 μm. ( d ) qPCR analysis shows arbitrary units (A.U.) of lactobacillus, enterobacterae (entero), bacteroides, clostridia and segmented filamentous bacteria (SFB) relative to universal 16S levels. Bacterial DNA was isolated from luminal stool obtained from the small intestine (SI) or colon ( n = 3; 2 experiments). * P

Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction, FACS, Fluorescence, In Situ Hybridization, Staining, Isolation

RARα deficiency results in altered intestinal immune development. ( a ) Expression of CD3 in the small intestine was determined by immunohistochemistry. Representative image of 6 images/mouse (n = 3 mice). ( b–c ) Representative dot plots showing total CD90 + cells ( b ) and T cells and ILCs within the CD90 + compartment (c) ( n = 3–4; 2 experiments). ( d ) Colon Swiss rolls showing immunohistochemistry for B220 in control and RARα villin mice. Data are representative of three mice/genotype. ( e ) Colon cell suspension staining for B220 and CD11c reveals decreased B cells in RARα villin mice ( n = 3; 2 experiments). * P
Figure Legend Snippet: RARα deficiency results in altered intestinal immune development. ( a ) Expression of CD3 in the small intestine was determined by immunohistochemistry. Representative image of 6 images/mouse (n = 3 mice). ( b–c ) Representative dot plots showing total CD90 + cells ( b ) and T cells and ILCs within the CD90 + compartment (c) ( n = 3–4; 2 experiments). ( d ) Colon Swiss rolls showing immunohistochemistry for B220 in control and RARα villin mice. Data are representative of three mice/genotype. ( e ) Colon cell suspension staining for B220 and CD11c reveals decreased B cells in RARα villin mice ( n = 3; 2 experiments). * P

Techniques Used: Expressing, Immunohistochemistry, Mouse Assay, Staining

RARα expression in intestinal epithelial cells from the small intestine and colon. ( a–b ) Frozen sections from the proximal, medial and distal small intestine ( a ) and proximal and distal colon ( b ) were stainied for RARα. Onsets show a digital magnification of the crypt within the respective boxes. ( c ) Cartoon showing the RARα expression pattern through the crypt-villi axis (Small intestine) or crypt (colon). One representative figure out of three experiments. ( d ) H E staining of distal small intestine sections of control and RARα villin mice. One representative figure out of three experiments. TA: transit amplifying. Scale bars 100uM
Figure Legend Snippet: RARα expression in intestinal epithelial cells from the small intestine and colon. ( a–b ) Frozen sections from the proximal, medial and distal small intestine ( a ) and proximal and distal colon ( b ) were stainied for RARα. Onsets show a digital magnification of the crypt within the respective boxes. ( c ) Cartoon showing the RARα expression pattern through the crypt-villi axis (Small intestine) or crypt (colon). One representative figure out of three experiments. ( d ) H E staining of distal small intestine sections of control and RARα villin mice. One representative figure out of three experiments. TA: transit amplifying. Scale bars 100uM

Techniques Used: Expressing, Staining, Mouse Assay

3) Product Images from "The Ski protein can inhibit ligand induced RAR? and HDAC3 degradation in the Retinoic acid signaling pathway"

Article Title: The Ski protein can inhibit ligand induced RAR? and HDAC3 degradation in the Retinoic acid signaling pathway

Journal:

doi: 10.1016/j.bbrc.2009.03.141

RA-induced RARα degradation is important for optimal RARα-mediated transactivation
Figure Legend Snippet: RA-induced RARα degradation is important for optimal RARα-mediated transactivation

Techniques Used:

Ski expression inhibits RA-induced RARα degradation
Figure Legend Snippet: Ski expression inhibits RA-induced RARα degradation

Techniques Used: Expressing

Ski and RARα are in the same complex in both the presence and absence of RA
Figure Legend Snippet: Ski and RARα are in the same complex in both the presence and absence of RA

Techniques Used:

4) Product Images from ""

Article Title:

Journal:

doi: 10.1074/jbc.M112.345421

ACTN4 binds and potentiates transcriptional activation by RARα. A , Western blot of co-immunoprecipitated samples demonstrating an interaction between ACTN4 (WT) and RARα. HEK293 cells were transfected with HA-RARα expression plasmids.
Figure Legend Snippet: ACTN4 binds and potentiates transcriptional activation by RARα. A , Western blot of co-immunoprecipitated samples demonstrating an interaction between ACTN4 (WT) and RARα. HEK293 cells were transfected with HA-RARα expression plasmids.

Techniques Used: Activation Assay, Western Blot, Immunoprecipitation, Transfection, Hemagglutination Assay, Expressing

FSGS-linked ACTN4 mutants lose their interactions with nuclear hormone receptors. A , FSGS-linked ACTN4 mutant K228E fails to interact with RARα in HEK293 cells. FLAG-ACTN4 was co-transfected with or without HA-RARα into HEK293 cells. Whole
Figure Legend Snippet: FSGS-linked ACTN4 mutants lose their interactions with nuclear hormone receptors. A , FSGS-linked ACTN4 mutant K228E fails to interact with RARα in HEK293 cells. FLAG-ACTN4 was co-transfected with or without HA-RARα into HEK293 cells. Whole

Techniques Used: Mutagenesis, Transfection, Hemagglutination Assay

FSGS-linked ACTN4 mutants lose their ability to potentiate RARα-mediated transcription activation. A , schematic diagram of ACTN4 indicating the position of FSGS-linked mutations. ACTN4 harbors two CH domains, CH1 and CH2, four spectrin repeats
Figure Legend Snippet: FSGS-linked ACTN4 mutants lose their ability to potentiate RARα-mediated transcription activation. A , schematic diagram of ACTN4 indicating the position of FSGS-linked mutations. ACTN4 harbors two CH domains, CH1 and CH2, four spectrin repeats

Techniques Used: Activation Assay

5) Product Images from "PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response"

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response

Journal: Journal of Hematology & Oncology

doi: 10.1186/s13045-016-0262-5

Effect of ATO on downmodulation of HHEX expression elicited by PML-RARα induction in PR9 cells ( top and middle panels ) and on HHEX expression observed in NB4 cells ( bottom panel ). Top panels ( a , b ): PR9 cells have been grown either in the absence ( c ) or in the presence of ZnSO 4 for 48 h ( left and right panels ), in the presence of ATO for different times (from 6 to 48 h, right panel ), or in the presence of ZnSO 4 + ATO for different time points (from 6 to 48 h, left panel ) and HHEX, PML-RARα, or RARα expression were assessed by WB. A representative WB is shown at the top of each panel and the quantitative evaluation (mean ± SEM in three separate experiments). Bottom panel ( c ): NB4 cells have been grown either in the absence ( c ) or in the presence of ATO for different times (from 6 to 48 h) and HHEX expression was analyzed by WB
Figure Legend Snippet: Effect of ATO on downmodulation of HHEX expression elicited by PML-RARα induction in PR9 cells ( top and middle panels ) and on HHEX expression observed in NB4 cells ( bottom panel ). Top panels ( a , b ): PR9 cells have been grown either in the absence ( c ) or in the presence of ZnSO 4 for 48 h ( left and right panels ), in the presence of ATO for different times (from 6 to 48 h, right panel ), or in the presence of ZnSO 4 + ATO for different time points (from 6 to 48 h, left panel ) and HHEX, PML-RARα, or RARα expression were assessed by WB. A representative WB is shown at the top of each panel and the quantitative evaluation (mean ± SEM in three separate experiments). Bottom panel ( c ): NB4 cells have been grown either in the absence ( c ) or in the presence of ATO for different times (from 6 to 48 h) and HHEX expression was analyzed by WB

Techniques Used: Expressing, Western Blot

Effect of PML/RARα induction on the binding of PML-RARα to the HHEX gene promoter and on the expression of VEGF-A, VEGFR-2, and HHEX at RNA and at protein level. a PML-RARα binding to the HHEX promoter as shown by ChIP experiments. Nuclear extracts derived from PR9 cells grown for 24 h either in the absence ( c ) or in the presence of ZnSO 4 (Zn 2+ ); cells were crosslinked in vivo; after cell lysis, chromatin fragments were immunoprecipitated with anti-RARα antibody; and after DNA purification, DNA regions containing HHEX were amplified. In the figure, the HHEX PCR signal without immunoprecipitation is indicated as −A (IgG control) and, after immunoprecipitation, as +A (RARα antibody). b , c , d ZnSO 4 (Zn 2+ ) was added to PR9 cells and, at different time points and concentrations, cell aliquots were harvested and processed for evaluation of PML-RARα expression at protein level ( b ) and of VEGF-A, VEGFR-2, and HHEX expression at RNA level by RT-PCR ( c ) and at protein level by Western blotting ( d ). S26 was used for RT-PCR and β-actin for Western blotting normalization
Figure Legend Snippet: Effect of PML/RARα induction on the binding of PML-RARα to the HHEX gene promoter and on the expression of VEGF-A, VEGFR-2, and HHEX at RNA and at protein level. a PML-RARα binding to the HHEX promoter as shown by ChIP experiments. Nuclear extracts derived from PR9 cells grown for 24 h either in the absence ( c ) or in the presence of ZnSO 4 (Zn 2+ ); cells were crosslinked in vivo; after cell lysis, chromatin fragments were immunoprecipitated with anti-RARα antibody; and after DNA purification, DNA regions containing HHEX were amplified. In the figure, the HHEX PCR signal without immunoprecipitation is indicated as −A (IgG control) and, after immunoprecipitation, as +A (RARα antibody). b , c , d ZnSO 4 (Zn 2+ ) was added to PR9 cells and, at different time points and concentrations, cell aliquots were harvested and processed for evaluation of PML-RARα expression at protein level ( b ) and of VEGF-A, VEGFR-2, and HHEX expression at RNA level by RT-PCR ( c ) and at protein level by Western blotting ( d ). S26 was used for RT-PCR and β-actin for Western blotting normalization

Techniques Used: Binding Assay, Expressing, Chromatin Immunoprecipitation, Derivative Assay, In Vivo, Lysis, Immunoprecipitation, DNA Purification, Amplification, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot

6) Product Images from "The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation"

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation

Journal:

doi: 10.1074/jbc.M802314200

RARα redistributes mRNA to PB. A , immunocytochemistry with anti-GW182 or G3BP antibodies ( red ) of COS cells co-transfected with FL-MS2BS and MS2-RARα-EGFP ( green ). The nuclei were counterstained with 4′,6′-diamino-2-phenylindole
Figure Legend Snippet: RARα redistributes mRNA to PB. A , immunocytochemistry with anti-GW182 or G3BP antibodies ( red ) of COS cells co-transfected with FL-MS2BS and MS2-RARα-EGFP ( green ). The nuclei were counterstained with 4′,6′-diamino-2-phenylindole

Techniques Used: Immunocytochemistry, Transfection

Localization of RARα in neuronal granules. A , co-localization in DIC12 hippocampal neurons of RARα ( green ) with Pur α ( red ). B , enlargement of dendrites from A , and co-localization of RARα with MAP2 ( purple ). C , localization
Figure Legend Snippet: Localization of RARα in neuronal granules. A , co-localization in DIC12 hippocampal neurons of RARα ( green ) with Pur α ( red ). B , enlargement of dendrites from A , and co-localization of RARα with MAP2 ( purple ). C , localization

Techniques Used:

RARα associates specifically with CaMKII α and GluR1 mRNA in neurons. Lysates of DIC14–15 hippocampal neurons were immunoprecipitated with IgG or anti-RARα and analyzed by reverse transcription-PCR without (–
Figure Legend Snippet: RARα associates specifically with CaMKII α and GluR1 mRNA in neurons. Lysates of DIC14–15 hippocampal neurons were immunoprecipitated with IgG or anti-RARα and analyzed by reverse transcription-PCR without (–

Techniques Used: Immunoprecipitation, Polymerase Chain Reaction

RARα suppresses translation in RRL. A , sequence independence of RARα translation suppression. Effect of GST ( open symbols ) or GST-RARα ( filled symbols ) on FL mRNA translation by a RRL programmed with FL ( squares ) or GluR1-FL
Figure Legend Snippet: RARα suppresses translation in RRL. A , sequence independence of RARα translation suppression. Effect of GST ( open symbols ) or GST-RARα ( filled symbols ) on FL mRNA translation by a RRL programmed with FL ( squares ) or GluR1-FL

Techniques Used: Sequencing

RARα suppresses translation in intact cells. A , a tethering assay for evaluating translation suppression relies on co-expressing FL mRNA, harboring tandem repeats of MS2BS in its 3′-untranslated region, with a chimera of MS2 and a query
Figure Legend Snippet: RARα suppresses translation in intact cells. A , a tethering assay for evaluating translation suppression relies on co-expressing FL mRNA, harboring tandem repeats of MS2BS in its 3′-untranslated region, with a chimera of MS2 and a query

Techniques Used: Expressing

RARα inhibits translation initiation. A and B , polysome distribution of FL-MS2BS mRNA versus endogenous β-actin in COS cells co-transfected with MS2-EGFP ( A ) or MS2-RARα-EGFP ( B ). RNA was monitored at A 260 ( top ). mRNA precipitated
Figure Legend Snippet: RARα inhibits translation initiation. A and B , polysome distribution of FL-MS2BS mRNA versus endogenous β-actin in COS cells co-transfected with MS2-EGFP ( A ) or MS2-RARα-EGFP ( B ). RNA was monitored at A 260 ( top ). mRNA precipitated

Techniques Used: Transfection

RARα associates with neuronal RNA granule proteins. A , RARα and Myc-tagged neuronal proteins selected from were co-transfected into COS cells to confirm their association. RARα was isolated by TAP. Total ( input ) and
Figure Legend Snippet: RARα associates with neuronal RNA granule proteins. A , RARα and Myc-tagged neuronal proteins selected from were co-transfected into COS cells to confirm their association. RARα was isolated by TAP. Total ( input ) and

Techniques Used: Transfection, Isolation

Time courses of RARα effects on FL mRNA translation. RARα ( filled circles ) and GST ( open circles ) were compared for effects on FL mRNA translation. A , capped and untailed; B , capped and tailed; C , uncapped and tailed. D–F ,
Figure Legend Snippet: Time courses of RARα effects on FL mRNA translation. RARα ( filled circles ) and GST ( open circles ) were compared for effects on FL mRNA translation. A , capped and untailed; B , capped and tailed; C , uncapped and tailed. D–F ,

Techniques Used:

7) Product Images from "Retinoic acid regulates cell cycle progression and cell differentiation in human monocytic THP-1 cells"

Article Title: Retinoic acid regulates cell cycle progression and cell differentiation in human monocytic THP-1 cells

Journal:

doi: 10.1016/j.yexcr.2004.02.017

Regulation of cyclin E gene expression in THP-1 cells by retinoic acid. THP-1 cells were plated in RPMI 1640 medium with 5% serum for 24 h and then with 2% FBS for another 24 h. Serum was added to cells at a final concentration of 10% and RA was added to cells at the indicated concentrations. Total RNA was isolated at the end of each treatment and subjected to RT-PCR analysis. (A) Expression level of the cyclin E gene in the absence or presence of RA at different concentrations for 24 h. The level is represented by the ratio of treated cells over the control without RA. (B) Expression of cyclin E in the presence of RA for different times. The numbers shown in graphs A and B are the mean ± SD of three independent experiments. (C) Western blot analysis showing the levels of cyclin E in the presence (10 nM) and absence of RA. The image represents one of three independent experiments performed in duplicate. Same samples were also subjected to the Western blot analysis with anti-actin antibody and the result is shown underneath. (D) Western blot analysis of the same THP-1 cell protein lysates as described in (C) using antibodies specific to RXRα and RARα. (E) Graph showing the correlation between the protein levels of cyclin E and RXRα, both regulated by RA. The axes are arbitrary density units. (F) Western blot analysis of p27 protein in the presence and absence of RA. The actin bands were shown underneath as internal control.
Figure Legend Snippet: Regulation of cyclin E gene expression in THP-1 cells by retinoic acid. THP-1 cells were plated in RPMI 1640 medium with 5% serum for 24 h and then with 2% FBS for another 24 h. Serum was added to cells at a final concentration of 10% and RA was added to cells at the indicated concentrations. Total RNA was isolated at the end of each treatment and subjected to RT-PCR analysis. (A) Expression level of the cyclin E gene in the absence or presence of RA at different concentrations for 24 h. The level is represented by the ratio of treated cells over the control without RA. (B) Expression of cyclin E in the presence of RA for different times. The numbers shown in graphs A and B are the mean ± SD of three independent experiments. (C) Western blot analysis showing the levels of cyclin E in the presence (10 nM) and absence of RA. The image represents one of three independent experiments performed in duplicate. Same samples were also subjected to the Western blot analysis with anti-actin antibody and the result is shown underneath. (D) Western blot analysis of the same THP-1 cell protein lysates as described in (C) using antibodies specific to RXRα and RARα. (E) Graph showing the correlation between the protein levels of cyclin E and RXRα, both regulated by RA. The axes are arbitrary density units. (F) Western blot analysis of p27 protein in the presence and absence of RA. The actin bands were shown underneath as internal control.

Techniques Used: Expressing, Concentration Assay, Isolation, Reverse Transcription Polymerase Chain Reaction, Western Blot

8) Product Images from "SP1 and RARα regulate AGAP2 expression in cancer"

Article Title: SP1 and RARα regulate AGAP2 expression in cancer

Journal: Scientific Reports

doi: 10.1038/s41598-018-36888-x

Mechanism of ATRA-mediated AGAP2 transcription. ( a ) Sheared chromatin of DU145 cells grown under AGAP2 expression conditions was used for immunoprecipitation using 2 μg of antibody (a rabbit IgG as negative control, a rabbit antibody against RNApol II as positive control, a rabbit anti-RARα, a rabbit anti-RXRα or a rabbit anti-PCAF antibody) and optimised primers were used to amplify a region specific to the AGAP2 promoter (see Supplementary Table 1 ). Data are represented as fold enrichment: fold enrich in signal relative to the IgG background signal. ( b ) Diagram representing the proposed mechanism of ATRA-mediated activation of AGAP2 transcription. In the presence of ATRA (lower panel), the heterodimer RARα/RXRα would recruit the lysine acetyl transferase PCAF to activate transcription and the recruitment of SP1 would also be enhanced.
Figure Legend Snippet: Mechanism of ATRA-mediated AGAP2 transcription. ( a ) Sheared chromatin of DU145 cells grown under AGAP2 expression conditions was used for immunoprecipitation using 2 μg of antibody (a rabbit IgG as negative control, a rabbit antibody against RNApol II as positive control, a rabbit anti-RARα, a rabbit anti-RXRα or a rabbit anti-PCAF antibody) and optimised primers were used to amplify a region specific to the AGAP2 promoter (see Supplementary Table 1 ). Data are represented as fold enrichment: fold enrich in signal relative to the IgG background signal. ( b ) Diagram representing the proposed mechanism of ATRA-mediated activation of AGAP2 transcription. In the presence of ATRA (lower panel), the heterodimer RARα/RXRα would recruit the lysine acetyl transferase PCAF to activate transcription and the recruitment of SP1 would also be enhanced.

Techniques Used: Expressing, Immunoprecipitation, Negative Control, Positive Control, Activation Assay

9) Product Images from "Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells"

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells

Journal:

doi: 10.1074/jbc.M110.184994

Transcriptional regulation of MIR21 by retinoids in ERα + cell lines via RARα. A , MCF-7 cells were treated with ATRA (1 μ m ) or vehicle (Me 2 SO) for 48 h. Upper panel , RT-PCR analysis of pri-miR-21, using a primer pair corresponding
Figure Legend Snippet: Transcriptional regulation of MIR21 by retinoids in ERα + cell lines via RARα. A , MCF-7 cells were treated with ATRA (1 μ m ) or vehicle (Me 2 SO) for 48 h. Upper panel , RT-PCR analysis of pri-miR-21, using a primer pair corresponding

Techniques Used: Reverse Transcription Polymerase Chain Reaction

Significance of RARα for miR-21 induction by ATRA and retinoid sensitivity in MCF-7. A , the panel shows the levels of the transcripts encoding RAR and RXR nuclear retinoic acid receptors in MCF-7 and MDA-MB-231 cells. The results were obtained
Figure Legend Snippet: Significance of RARα for miR-21 induction by ATRA and retinoid sensitivity in MCF-7. A , the panel shows the levels of the transcripts encoding RAR and RXR nuclear retinoic acid receptors in MCF-7 and MDA-MB-231 cells. The results were obtained

Techniques Used: Multiple Displacement Amplification

10) Product Images from "Ubiquitin-dependent Degradation of p73 Is Inhibited by PML"

Article Title: Ubiquitin-dependent Degradation of p73 Is Inhibited by PML

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20031943

p73 and PML colocalization within the PML-NBs is required for p73 stabilization (A) Representative image of Cos-1 cells costained with anti-p73 (green, clone 5B429) and anti-PML (red) antibodies and analyzed by confocal microscopy (left). Nuclei were visualized by 4′,6-diamidino-2-phenylindole (DAPI) staining. The arrows indicate p73-containing speckles. (right) A quantitative analysis of the green and red fluorescence intensity at distinct nuclear speckles as indicated by the yellow arrow. (B–D) GFP-p73α was overexpressed into wild type (B) and Pml −/− (C) MEFs. Full-length PML was cotransfected with GFP-p73α into Pml −/− MEFs (D). Nuclei were visualized by DAPI staining. The arrows indicate p73-containing PML-NBs. (E) Pml −/− MEFs were transiently transfected with HA-p73α alone (lane 1) or in combination with full-length Flag-PML (lane 2), Flag-PML ΔRING (lane 3), or PML-RARα (lane 4). Cell extracts were subjected to IB with anti-HA, anti-Flag, anti-RARα, and anti–β-actin antibodies. (bottom) Normalization of transfection efficiency by quantitation of GFP expression.
Figure Legend Snippet: p73 and PML colocalization within the PML-NBs is required for p73 stabilization (A) Representative image of Cos-1 cells costained with anti-p73 (green, clone 5B429) and anti-PML (red) antibodies and analyzed by confocal microscopy (left). Nuclei were visualized by 4′,6-diamidino-2-phenylindole (DAPI) staining. The arrows indicate p73-containing speckles. (right) A quantitative analysis of the green and red fluorescence intensity at distinct nuclear speckles as indicated by the yellow arrow. (B–D) GFP-p73α was overexpressed into wild type (B) and Pml −/− (C) MEFs. Full-length PML was cotransfected with GFP-p73α into Pml −/− MEFs (D). Nuclei were visualized by DAPI staining. The arrows indicate p73-containing PML-NBs. (E) Pml −/− MEFs were transiently transfected with HA-p73α alone (lane 1) or in combination with full-length Flag-PML (lane 2), Flag-PML ΔRING (lane 3), or PML-RARα (lane 4). Cell extracts were subjected to IB with anti-HA, anti-Flag, anti-RARα, and anti–β-actin antibodies. (bottom) Normalization of transfection efficiency by quantitation of GFP expression.

Techniques Used: Confocal Microscopy, Staining, Fluorescence, Transfection, Hemagglutination Assay, Quantitation Assay, Expressing

PML-regulated acetylation of p73 by p300 protects p73 against degradation. (A) GFP-p73α and HA-Ub were expressed in 293T cells in the absence (lane 3) or in the presence (lane 4) of p300bromo-HAT for 24 h. Cells were incubated with 1 μM trichostatin A (TSA) and 1 mM niacinamide for the last 12 h of transfection. After IP of GFP-p73, ubiquitinylation levels of p73 were detected with anti-HA antibody. Acetylated and unacetylated p73 in the immunoprecipitates were determined with anti–acetyl-lysine and anti-GFP antibody, respectively. (B) 293T cells were transfected with a plasmid encoding GFP-p73α alone (lane 1) or in combination with p300bromo-HAT (lanes 2–6), in the absence (lane 2) or in the presence (lanes 3–6) of decreasing doses of HA-Ub for 24 h. Treatment with deacetylase inhibitors and IP experiments were performed as described in A. (C and D) Transformed 3T3 Pml −/− MEFs were transiently transfected with GFP-p73α alone (lane 1) or along with p300 in the absence (lane 2) or in the presence of full-length Flag-PML (lane 3), Flag-PML-ΔRING (lane 4), or Flag-PML-RARα (lane 5) for 24 h. Cells were incubated with deacetylase inhibitors for 8 h. p73 was immunoprecipitated using anti-GFP antibody followed by IB with anti–acetyl-lysine antibody (C). Whole cell extracts were immunoblotted with anti-GFP, anti-Flag, and anti–β-actin antibodies (D).
Figure Legend Snippet: PML-regulated acetylation of p73 by p300 protects p73 against degradation. (A) GFP-p73α and HA-Ub were expressed in 293T cells in the absence (lane 3) or in the presence (lane 4) of p300bromo-HAT for 24 h. Cells were incubated with 1 μM trichostatin A (TSA) and 1 mM niacinamide for the last 12 h of transfection. After IP of GFP-p73, ubiquitinylation levels of p73 were detected with anti-HA antibody. Acetylated and unacetylated p73 in the immunoprecipitates were determined with anti–acetyl-lysine and anti-GFP antibody, respectively. (B) 293T cells were transfected with a plasmid encoding GFP-p73α alone (lane 1) or in combination with p300bromo-HAT (lanes 2–6), in the absence (lane 2) or in the presence (lanes 3–6) of decreasing doses of HA-Ub for 24 h. Treatment with deacetylase inhibitors and IP experiments were performed as described in A. (C and D) Transformed 3T3 Pml −/− MEFs were transiently transfected with GFP-p73α alone (lane 1) or along with p300 in the absence (lane 2) or in the presence of full-length Flag-PML (lane 3), Flag-PML-ΔRING (lane 4), or Flag-PML-RARα (lane 5) for 24 h. Cells were incubated with deacetylase inhibitors for 8 h. p73 was immunoprecipitated using anti-GFP antibody followed by IB with anti–acetyl-lysine antibody (C). Whole cell extracts were immunoblotted with anti-GFP, anti-Flag, and anti–β-actin antibodies (D).

Techniques Used: Hemagglutination Assay, HAT Assay, Incubation, Transfection, Plasmid Preparation, Histone Deacetylase Assay, Transformation Assay, Immunoprecipitation

11) Product Images from "Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?"

Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

Journal: PLoS ONE

doi: 10.1371/journal.pone.0022540

Effect of SSi on the biology of X-RARα-, γ-catenin- and constitutively active β-catenin-expressing murine HSCs. ( A ) Experimental strategy. Sca1 + /lin - BM cells were infected with the indicated retroviruses and plated in semi-solid medium with the indicated growth factors to determine the serial plating potential in the presence of either 100 µM SSi or 0.02% DMSO. ( B ) Long-term serial replating (I–VII) of HSC and X-RARα-positive HSC. SSi withdrawal after plating round V for PML/RARα-positive colonies and after plating round VI for PLZF/RARα-positive colonies. ( C ) Colony morphology of plating rounds I, III, VI, and VII as well as SSi withdrawal. ( D ) Long-term serial replating (I–V) of γ-catenin- and β-catenin-S33A-positive HSC. Data are expressed as the mean of three independent experiments with SD. Control - empty vector; ↓-SSi withdrawal; I–VII: serial plating rounds.
Figure Legend Snippet: Effect of SSi on the biology of X-RARα-, γ-catenin- and constitutively active β-catenin-expressing murine HSCs. ( A ) Experimental strategy. Sca1 + /lin - BM cells were infected with the indicated retroviruses and plated in semi-solid medium with the indicated growth factors to determine the serial plating potential in the presence of either 100 µM SSi or 0.02% DMSO. ( B ) Long-term serial replating (I–VII) of HSC and X-RARα-positive HSC. SSi withdrawal after plating round V for PML/RARα-positive colonies and after plating round VI for PLZF/RARα-positive colonies. ( C ) Colony morphology of plating rounds I, III, VI, and VII as well as SSi withdrawal. ( D ) Long-term serial replating (I–V) of γ-catenin- and β-catenin-S33A-positive HSC. Data are expressed as the mean of three independent experiments with SD. Control - empty vector; ↓-SSi withdrawal; I–VII: serial plating rounds.

Techniques Used: Expressing, Infection, Plasmid Preparation

Effect of SSi on the X-RARα-induced phenotype in murine HSCs. ( A ) Experimental strategy. Sca1+/lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. ( B ) Differentiation was assessed by the expression of Gr-1, Mac-1, c-Kit and Sca1. ( C ) Schematic representation of the proliferation competition assay (PCA). ( D ) GFP expression in X-RARα-positive HPCs assessed by FACS analysis in the presence/absence of SSi at day 2, 4, and 7. One representative result from three independent experiments is shown.
Figure Legend Snippet: Effect of SSi on the X-RARα-induced phenotype in murine HSCs. ( A ) Experimental strategy. Sca1+/lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. ( B ) Differentiation was assessed by the expression of Gr-1, Mac-1, c-Kit and Sca1. ( C ) Schematic representation of the proliferation competition assay (PCA). ( D ) GFP expression in X-RARα-positive HPCs assessed by FACS analysis in the presence/absence of SSi at day 2, 4, and 7. One representative result from three independent experiments is shown.

Techniques Used: Infection, Expressing, Competitive Binding Assay, FACS

Effect of SSi on PML/RARα-mediated aberrant long-term stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the LT-HSC capacity of PML/RARα-expressing HSCs. Sca1 + /lin - BM cells from CD45.1 + mice were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. The cells were co-transplanted with CD45.2 + BM cells into lethally (11 Gy) irradiated CD45.2 + recipient mice. ( B ) Donor chimerism 8 months after transplantation was used to determine LT-HSC capacity in the BM and spleen. Statistical significance was determined using the Log-rank (Mantel-Cox) test (*
Figure Legend Snippet: Effect of SSi on PML/RARα-mediated aberrant long-term stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the LT-HSC capacity of PML/RARα-expressing HSCs. Sca1 + /lin - BM cells from CD45.1 + mice were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. The cells were co-transplanted with CD45.2 + BM cells into lethally (11 Gy) irradiated CD45.2 + recipient mice. ( B ) Donor chimerism 8 months after transplantation was used to determine LT-HSC capacity in the BM and spleen. Statistical significance was determined using the Log-rank (Mantel-Cox) test (*

Techniques Used: Expressing, Mouse Assay, Infection, Irradiation, Transplantation Assay

Induction of apoptosis in patient-derived NB4 cells by Sulindac derivatives. Rate of apoptosis in patient-derived PML/RARα-positive NB4 cells was assessed by 7AAD staining upon exposure to clinically achievable concentrations (50–150 µM) of SSi and SSo. Apoptosis was measured after 72 h. Data are expressed as the mean of three independent experiments with standard deviation (SD). Statistical analysis was performed using Student's t -test (* - p
Figure Legend Snippet: Induction of apoptosis in patient-derived NB4 cells by Sulindac derivatives. Rate of apoptosis in patient-derived PML/RARα-positive NB4 cells was assessed by 7AAD staining upon exposure to clinically achievable concentrations (50–150 µM) of SSi and SSo. Apoptosis was measured after 72 h. Data are expressed as the mean of three independent experiments with standard deviation (SD). Statistical analysis was performed using Student's t -test (* - p

Techniques Used: Derivative Assay, Staining, Standard Deviation

Effect of SSi on PML/RARα-mediated Wnt signaling pathway activation. ( A ) Transactivation assay for Wnt-signaling-related TCF/LEF-dependent transcription. Indicated expression vectors were co-transfected with either Topflash (OT) or Fopflash (OF) (the pGL3-OT promoter contains three TCF/LEF binding sites, whereas pGL3-OF contains mutated inactive binding sites and is a negative control) reporter constructs into 293 cells and exposed them to either 100 µM SSi or 0.02% DMSO. After 48 h, luciferase activity was measured and normalized to co-transfected Renilla activity. ( B ) Western blots for the expression of PML/RARα and S33A using the indicated antibodies, α-β-actin-loading control. ( C ) Effects of SSi on Wnt target genes in X-RARα-positive Sca1 + /lin - HPCs. Results are represented as 2 -ΔΔCT values. Each experiment was performed three times in triplicate, with similar results obtained each time. One representative experiment with SD is shown.
Figure Legend Snippet: Effect of SSi on PML/RARα-mediated Wnt signaling pathway activation. ( A ) Transactivation assay for Wnt-signaling-related TCF/LEF-dependent transcription. Indicated expression vectors were co-transfected with either Topflash (OT) or Fopflash (OF) (the pGL3-OT promoter contains three TCF/LEF binding sites, whereas pGL3-OF contains mutated inactive binding sites and is a negative control) reporter constructs into 293 cells and exposed them to either 100 µM SSi or 0.02% DMSO. After 48 h, luciferase activity was measured and normalized to co-transfected Renilla activity. ( B ) Western blots for the expression of PML/RARα and S33A using the indicated antibodies, α-β-actin-loading control. ( C ) Effects of SSi on Wnt target genes in X-RARα-positive Sca1 + /lin - HPCs. Results are represented as 2 -ΔΔCT values. Each experiment was performed three times in triplicate, with similar results obtained each time. One representative experiment with SD is shown.

Techniques Used: Activation Assay, Transactivation Assay, Expressing, Transfection, Binding Assay, Negative Control, Construct, Luciferase, Activity Assay, Western Blot

The effect of Sulindac derivatives on the expression of β-catenin and γ-catenin in PML/RARα-positive leukemic cells. Protein expression of active β-catenin, total β-catenin, γ-catenin and PML/RARα was assessed by western blot analysis with the indicated antibodies. ( A ) Patient-derived PML/RARα-positive NB4 cells treated with SSo (200 µM), SSi (200 µM) or 0.02% DMSO at 24 h and 48 h. ( B ) PML/RARα-expressing KG-1 cells treated at the cell type-specific IC 50 (100 µM - SSi, 360 µM - SSo and 0.02% DMSO) at 72 h. Control - empty-vector-transfected cells; α-α-tubulin-loading control. ( C – D ) protein quantification of western blots presented in panel A and B, the bars represent the band intensity relative to the intensity of the tubulin bands reveled with a S-800 Densitometer and the Quantity One software (Bio-Rad).
Figure Legend Snippet: The effect of Sulindac derivatives on the expression of β-catenin and γ-catenin in PML/RARα-positive leukemic cells. Protein expression of active β-catenin, total β-catenin, γ-catenin and PML/RARα was assessed by western blot analysis with the indicated antibodies. ( A ) Patient-derived PML/RARα-positive NB4 cells treated with SSo (200 µM), SSi (200 µM) or 0.02% DMSO at 24 h and 48 h. ( B ) PML/RARα-expressing KG-1 cells treated at the cell type-specific IC 50 (100 µM - SSi, 360 µM - SSo and 0.02% DMSO) at 72 h. Control - empty-vector-transfected cells; α-α-tubulin-loading control. ( C – D ) protein quantification of western blots presented in panel A and B, the bars represent the band intensity relative to the intensity of the tubulin bands reveled with a S-800 Densitometer and the Quantity One software (Bio-Rad).

Techniques Used: Expressing, Western Blot, Derivative Assay, Plasmid Preparation, Transfection, Software

Effect of SSi on X-RARα-mediated aberrant stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the ST-HSC capacity of X-RARα-expressing HSCs (CFU-S12). Sca1 + /lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. Cells were inoculated into lethally irradiated (11Gy) recipients that were then sacrificed at day 12 after transplantation. ( B ) Photographs of all the fixed spleen are shown, the arrows indicate an example of a CFU in the fixed spleens. ( C ) Bulks represent the number of CFU-S12 expressed as the mean from three spleens with SD. Statistical analysis was performed using Student's t -test (* - p
Figure Legend Snippet: Effect of SSi on X-RARα-mediated aberrant stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the ST-HSC capacity of X-RARα-expressing HSCs (CFU-S12). Sca1 + /lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. Cells were inoculated into lethally irradiated (11Gy) recipients that were then sacrificed at day 12 after transplantation. ( B ) Photographs of all the fixed spleen are shown, the arrows indicate an example of a CFU in the fixed spleens. ( C ) Bulks represent the number of CFU-S12 expressed as the mean from three spleens with SD. Statistical analysis was performed using Student's t -test (* - p

Techniques Used: Expressing, Infection, Irradiation, Transplantation Assay

12) Product Images from "High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis"

Article Title: High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

Journal: Genes & Cancer

doi:

CRBP-1 transfection influences transcriptional pathways and differentiation of A549 adenocarcinoma cells A, bar graph after real-time PCR showing keratin (K) 1, 5, 14 and involucrin up-regulation, K10 down-regulation and unmodified K7 transcription level in CRBP-1 + compared to CRBP-1 − A549 cells. B, densitometric analysis of RARα, RARβ and RXRα protein expression by blot analysis. C, bar graph of RARs, RXRα, PPARβ/δ, FABP5 and CRABP-2 transcripts. D, bar graph and E, heat map of RT 2 profiler TM PCR assay of EGF/PDGF signaling-specific genes in CRBP-1 + A549 cells. Up-regulated and down-regulated genes are in dark grey and light grey, respectively. F, densitometric analysis of creb1, c-jun, p53, pAkt/Akt, pEGFR/EGFR and pErk1/2 protein expression by blots. Columns are means ± SEM of three different experiments. * p
Figure Legend Snippet: CRBP-1 transfection influences transcriptional pathways and differentiation of A549 adenocarcinoma cells A, bar graph after real-time PCR showing keratin (K) 1, 5, 14 and involucrin up-regulation, K10 down-regulation and unmodified K7 transcription level in CRBP-1 + compared to CRBP-1 − A549 cells. B, densitometric analysis of RARα, RARβ and RXRα protein expression by blot analysis. C, bar graph of RARs, RXRα, PPARβ/δ, FABP5 and CRABP-2 transcripts. D, bar graph and E, heat map of RT 2 profiler TM PCR assay of EGF/PDGF signaling-specific genes in CRBP-1 + A549 cells. Up-regulated and down-regulated genes are in dark grey and light grey, respectively. F, densitometric analysis of creb1, c-jun, p53, pAkt/Akt, pEGFR/EGFR and pErk1/2 protein expression by blots. Columns are means ± SEM of three different experiments. * p

Techniques Used: Transfection, Real-time Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction

13) Product Images from "Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription"

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq023

Nuclear receptors and RNA Pol-II interact with NIS intronic elements in a dynamic manner during the initiation of transcription. MCF-7 cells grown in steroid-free and phenol-red-free DMEM were treated either with DMSO (time 0) or with 1 µM tRA for 15, 30 and 60 min and used for ChIP analysis using RARα and RXR and RNA Pol-II specific antibodies. ( A ) DNA isolated from immunocomplexes was used for quantitative PCR using primers described in Supplementary Table S3 . Ct values were normalized to background levels of bead-only controls. Data are represented as fold enrichment compared to IgG control. ( B ) mRNA was isolated from a fraction of the cells used for ChIP analysis above. Two micrograms of total RNA was converted to cDNA and used for quantitative real-time PCR. Expression was normalized to the levels of GAPDH using the ΔΔCt method and presented as relative fold induction compared to DMSO-treated samples. ( C ) Schematic representation of ChIP data depicting the events of transcription initiation of NIS in response to tRA stimulation. Arrow heads indicate the position of the intronic element investigated, vertical small lines represent NIS exons, numbers below indicate introns studied, asterisks above numbers indicate identical sequences. Parallelograms with question mark represent unidentified interacting proteins. DR, direct repeat; ER, everted repeat. Statistical significance was determined by performing the Student’s t -test ( Figure 7 A) or paired Student’s t -test ( Figure 7 C) using a 95% confidence interval; P -values
Figure Legend Snippet: Nuclear receptors and RNA Pol-II interact with NIS intronic elements in a dynamic manner during the initiation of transcription. MCF-7 cells grown in steroid-free and phenol-red-free DMEM were treated either with DMSO (time 0) or with 1 µM tRA for 15, 30 and 60 min and used for ChIP analysis using RARα and RXR and RNA Pol-II specific antibodies. ( A ) DNA isolated from immunocomplexes was used for quantitative PCR using primers described in Supplementary Table S3 . Ct values were normalized to background levels of bead-only controls. Data are represented as fold enrichment compared to IgG control. ( B ) mRNA was isolated from a fraction of the cells used for ChIP analysis above. Two micrograms of total RNA was converted to cDNA and used for quantitative real-time PCR. Expression was normalized to the levels of GAPDH using the ΔΔCt method and presented as relative fold induction compared to DMSO-treated samples. ( C ) Schematic representation of ChIP data depicting the events of transcription initiation of NIS in response to tRA stimulation. Arrow heads indicate the position of the intronic element investigated, vertical small lines represent NIS exons, numbers below indicate introns studied, asterisks above numbers indicate identical sequences. Parallelograms with question mark represent unidentified interacting proteins. DR, direct repeat; ER, everted repeat. Statistical significance was determined by performing the Student’s t -test ( Figure 7 A) or paired Student’s t -test ( Figure 7 C) using a 95% confidence interval; P -values

Techniques Used: Chromatin Immunoprecipitation, Isolation, Real-time Polymerase Chain Reaction, Expressing

RARα and RXR interacts with the novel intronic RARE in gel retardation assays. Nuclear extracts from E2-treated MCF-7 cells were incubated with biotin labeled oligonucleotide probes representing a consensus RARE, the wild-type DR2-2 or the mutant variant DR2-2mut (DR2-2-Mut1-S in Supplementary Table S2 ). Samples were resolved on a 6% non-denaturing polyacrylamide gel in TBE, transferred to Hybond N+ membranes and then incubated with streptavidin, and biotin-labeled DNA probes were detected by chemiluminescence. The name of the probe used in each binding reaction is indicated on the top of each panel. All binding reactions were competed with 200-fold molar excess of the corresponding unlabeled probe. Arrows point out the nuclear receptor–DNA complexes, while arrowheads point out the super shift. The asterisk indicates a DR2-2 independent interaction with nuclear proteins. Labeled probes were incubated in the absence of nuclear extract (lanes 1, 6 and 11), in the presence of nuclear extract alone (lanes 2, 7 and 12), nuclear extract together with an excess of competing unlabeled probe (lanes 3, 8 and 13), in the presence of RARα antibodies (lanes 4, 9 and 14), or in the presence of RXR antibodies (lanes 5, 10 and 15). Experiments were repeated at least three times and a representative result is shown.
Figure Legend Snippet: RARα and RXR interacts with the novel intronic RARE in gel retardation assays. Nuclear extracts from E2-treated MCF-7 cells were incubated with biotin labeled oligonucleotide probes representing a consensus RARE, the wild-type DR2-2 or the mutant variant DR2-2mut (DR2-2-Mut1-S in Supplementary Table S2 ). Samples were resolved on a 6% non-denaturing polyacrylamide gel in TBE, transferred to Hybond N+ membranes and then incubated with streptavidin, and biotin-labeled DNA probes were detected by chemiluminescence. The name of the probe used in each binding reaction is indicated on the top of each panel. All binding reactions were competed with 200-fold molar excess of the corresponding unlabeled probe. Arrows point out the nuclear receptor–DNA complexes, while arrowheads point out the super shift. The asterisk indicates a DR2-2 independent interaction with nuclear proteins. Labeled probes were incubated in the absence of nuclear extract (lanes 1, 6 and 11), in the presence of nuclear extract alone (lanes 2, 7 and 12), nuclear extract together with an excess of competing unlabeled probe (lanes 3, 8 and 13), in the presence of RARα antibodies (lanes 4, 9 and 14), or in the presence of RXR antibodies (lanes 5, 10 and 15). Experiments were repeated at least three times and a representative result is shown.

Techniques Used: Electrophoretic Mobility Shift Assay, Incubation, Labeling, Mutagenesis, Variant Assay, Binding Assay

RARα and RXR occupy the novel intronic element in vivo . MCF-7 cells grown in DMEM were treated with 1 µM tRA and used for ChIP analysis using RARα and RXR specific antibodies. ( A ) DNA isolated from immunocomplexes was used as a template for PCR amplification using primers specific for DR2-2. PCR products were resolved on a 2% agarose gel (containing Ethidium bromide) and visualized on a UV transilluminator, RARα; anti-RAR-α Ab precipitated DNA, RXR; anti-RXR Ab precipitated DNA, FGFR1; anti-FGFR1 Ab precipitated DNA, No Ab; bead-only control, and -PCR is a negative control with H 2 O as a template. ( B ) Quantitative PCR was performed using immunoprecipitated DNA using DR2-1 and DR2-2 specific primers. Ct values were normalized to background levels of bead-only controls (No Ab) using 2 (δCt) . Data are represented as fold enrichment compared to IgG control. * P -values were calculated using Student’s t -test (average of three experiments) with 95% confidence interval, values
Figure Legend Snippet: RARα and RXR occupy the novel intronic element in vivo . MCF-7 cells grown in DMEM were treated with 1 µM tRA and used for ChIP analysis using RARα and RXR specific antibodies. ( A ) DNA isolated from immunocomplexes was used as a template for PCR amplification using primers specific for DR2-2. PCR products were resolved on a 2% agarose gel (containing Ethidium bromide) and visualized on a UV transilluminator, RARα; anti-RAR-α Ab precipitated DNA, RXR; anti-RXR Ab precipitated DNA, FGFR1; anti-FGFR1 Ab precipitated DNA, No Ab; bead-only control, and -PCR is a negative control with H 2 O as a template. ( B ) Quantitative PCR was performed using immunoprecipitated DNA using DR2-1 and DR2-2 specific primers. Ct values were normalized to background levels of bead-only controls (No Ab) using 2 (δCt) . Data are represented as fold enrichment compared to IgG control. * P -values were calculated using Student’s t -test (average of three experiments) with 95% confidence interval, values

Techniques Used: In Vivo, Chromatin Immunoprecipitation, Isolation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Negative Control, Real-time Polymerase Chain Reaction, Immunoprecipitation

14) Product Images from "RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells"

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells

Journal: Oncotarget

doi: 10.18632/oncotarget.10556

Functional and physical interactions between RARα2 and RARα1 or PML-RAR A . GST pull-down: the GST-tagged recombinant protein, GST-RARα2 and GST were used. The two recombinant proteins conjugated to Glutathione-Sepharose beads were incubated with extracts of COS-7 cells transfected with pcDNA3-RARα1 and treated with vehicle or ATRA (1 μM) for 4 hours. GST pull-down precipitates were blotted on nitro-cellulose filters, hybridized with an anti-RARα [RP alpha (F)] (left panel) and subsequently with an anti-GST antibody (right panel). The blot was not stripped between the two hybridizations. Input: cell extracts (10 μg of protein) representing 10% of the total amount of protein were subjected to Western blot analysis with the above anti-RARα antibody. B . GST pull-down: the GST-tagged recombinant proteins, GST-RARα1 and GST-RARα1DEF were used. The two recombinant proteins conjugated to Glutathione-Sepharose beads were incubated with extracts of COS-7 cells transfected with pHA-RARα2 as well as the negative controls, pHA-SNAIL plasmid and pcDNA3 plasmid containing the HA tag ( pHA ). Transfected cells were treated with vehicle or ATRA as in (A). As an internal control of the experiment, we performed a pull-down assay with the GST protein coupled to Glutathione-Sepharose beads on extracts of cells transfected with pHA-RARα2 . GST pull-down precipitates were subjected to Western blot analysis with anti-HA (upper panels) and anti-GST antibodies (lower panels). C . Far-Western: COS-7 cells were transfected with a pcDNA3 plasmid containing a haemoagglutinin (HA) tagged RAR a 2 cDNA ( pHA-RARα2 ). Cell extracts were precipitated with agarose beads conjugated with an anti-HA monoclonal antibody. The immuno-precipitates were subjected to Far-Western analysis using the following GST-tagged RARα1 recombinant proteins: GST-RARα1 = full-length RARα1; GST-RARα1ABC = RARα1 ABC regions; GST-RARα1DEF = RARα1 DEF regions; GST-RARα1DEFD(408-416) = RARα1 DEF regions lacking the H12 helix. Input: cell extracts (10 μg of protein) representing 10% of the total amount of protein used for the immune-precipitations were subjected to Western blot analysis with an anti-HA antibody. Each line shows cropped lanes of the same gel, hence the results can be compared across the lanes, as they were obtained with the same exposure time. D . Immunoprecipitations (IP): COS-7 cells were transfected with pcDNA3-RARα1 and pcDNA3-RARα2 alone or in combination. Sixteen hours following transfection, cells were treated with vehicle or ATRA (1 μM) for 4 hours. The indicated extracts were immuno-precipitated with anti- RARα2 antibodies and subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. The two leftmost lanes represent controls of RARα1 transfected cells directly submitted to Western blot analysis without immuno-precipitation. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of RARα2 [Ab25alpha2(A2) antibody] and RARα1 [Ab10alpha1(A1)antibody]in the extracts (input). Each line shows cropped lanes of the same gel, hence the results can be compared across the lanes, as they were obtained with the same exposure time. E . Immuno-precipitation (IP): COS-7 cells were co-transfected with wild-type (WT) RARα2 or WT RARα1 and RARα1 mutants and subjected to immune-precipitation and Western blot analysis as in (D). F . Immuno-precipitation (IP): COS-7 cells were co-transfected with wild-type (WT) RARα2 or WT PML-RAR and derived mutant. The extracts of transfected cells were treated and subjected to co-immuno-precipitation studies as in (D and E). Lanes 5,6, 11 and 12 represent controls of PML-RAR and PML-RAR-S873A transfected cells directly submitted to Western blot analysis without immuno-precipitation.
Figure Legend Snippet: Functional and physical interactions between RARα2 and RARα1 or PML-RAR A . GST pull-down: the GST-tagged recombinant protein, GST-RARα2 and GST were used. The two recombinant proteins conjugated to Glutathione-Sepharose beads were incubated with extracts of COS-7 cells transfected with pcDNA3-RARα1 and treated with vehicle or ATRA (1 μM) for 4 hours. GST pull-down precipitates were blotted on nitro-cellulose filters, hybridized with an anti-RARα [RP alpha (F)] (left panel) and subsequently with an anti-GST antibody (right panel). The blot was not stripped between the two hybridizations. Input: cell extracts (10 μg of protein) representing 10% of the total amount of protein were subjected to Western blot analysis with the above anti-RARα antibody. B . GST pull-down: the GST-tagged recombinant proteins, GST-RARα1 and GST-RARα1DEF were used. The two recombinant proteins conjugated to Glutathione-Sepharose beads were incubated with extracts of COS-7 cells transfected with pHA-RARα2 as well as the negative controls, pHA-SNAIL plasmid and pcDNA3 plasmid containing the HA tag ( pHA ). Transfected cells were treated with vehicle or ATRA as in (A). As an internal control of the experiment, we performed a pull-down assay with the GST protein coupled to Glutathione-Sepharose beads on extracts of cells transfected with pHA-RARα2 . GST pull-down precipitates were subjected to Western blot analysis with anti-HA (upper panels) and anti-GST antibodies (lower panels). C . Far-Western: COS-7 cells were transfected with a pcDNA3 plasmid containing a haemoagglutinin (HA) tagged RAR a 2 cDNA ( pHA-RARα2 ). Cell extracts were precipitated with agarose beads conjugated with an anti-HA monoclonal antibody. The immuno-precipitates were subjected to Far-Western analysis using the following GST-tagged RARα1 recombinant proteins: GST-RARα1 = full-length RARα1; GST-RARα1ABC = RARα1 ABC regions; GST-RARα1DEF = RARα1 DEF regions; GST-RARα1DEFD(408-416) = RARα1 DEF regions lacking the H12 helix. Input: cell extracts (10 μg of protein) representing 10% of the total amount of protein used for the immune-precipitations were subjected to Western blot analysis with an anti-HA antibody. Each line shows cropped lanes of the same gel, hence the results can be compared across the lanes, as they were obtained with the same exposure time. D . Immunoprecipitations (IP): COS-7 cells were transfected with pcDNA3-RARα1 and pcDNA3-RARα2 alone or in combination. Sixteen hours following transfection, cells were treated with vehicle or ATRA (1 μM) for 4 hours. The indicated extracts were immuno-precipitated with anti- RARα2 antibodies and subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. The two leftmost lanes represent controls of RARα1 transfected cells directly submitted to Western blot analysis without immuno-precipitation. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of RARα2 [Ab25alpha2(A2) antibody] and RARα1 [Ab10alpha1(A1)antibody]in the extracts (input). Each line shows cropped lanes of the same gel, hence the results can be compared across the lanes, as they were obtained with the same exposure time. E . Immuno-precipitation (IP): COS-7 cells were co-transfected with wild-type (WT) RARα2 or WT RARα1 and RARα1 mutants and subjected to immune-precipitation and Western blot analysis as in (D). F . Immuno-precipitation (IP): COS-7 cells were co-transfected with wild-type (WT) RARα2 or WT PML-RAR and derived mutant. The extracts of transfected cells were treated and subjected to co-immuno-precipitation studies as in (D and E). Lanes 5,6, 11 and 12 represent controls of PML-RAR and PML-RAR-S873A transfected cells directly submitted to Western blot analysis without immuno-precipitation.

Techniques Used: Functional Assay, Recombinant, Incubation, Transfection, Western Blot, Plasmid Preparation, Hemagglutination Assay, Pull Down Assay, Immunoprecipitation, Derivative Assay, Mutagenesis

Interference between RARα2 and RARα1 or PML-RAR transcriptional activity A . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids alone or in combination and β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or ATRA (1 μM) for 24 hours. B . COS-7 cell extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. The same amounts of extracts used for the determination of RARα1 and RARα2 were subjected to Western blot analysis to determine the loading control, β-actin. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 , pSG5-RARβ2 and pSG5-RARg2 plasmids alone or in combination and β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or ATRA (1 μM) for a further 24 hours. Luciferase activity is expressed as the ratio of ATRA/DMSO luciferase activity (fold-change). Each value is the mean±SD of two replicates.
Figure Legend Snippet: Interference between RARα2 and RARα1 or PML-RAR transcriptional activity A . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids alone or in combination and β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or ATRA (1 μM) for 24 hours. B . COS-7 cell extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. The same amounts of extracts used for the determination of RARα1 and RARα2 were subjected to Western blot analysis to determine the loading control, β-actin. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 , pSG5-RARβ2 and pSG5-RARg2 plasmids alone or in combination and β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or ATRA (1 μM) for a further 24 hours. Luciferase activity is expressed as the ratio of ATRA/DMSO luciferase activity (fold-change). Each value is the mean±SD of two replicates.

Techniques Used: Activity Assay, Transfection, Western Blot, Luciferase

PML-RAR, RARα2 and RARα1 knock-down in COS-7 and NB4 cells A . COS-7 cells were transiently transfected with the pcDNA3, pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids in the presence of the indicated shRNA-containing retroviral vectors and corresponding void vector ( VOID ). Sixteen hours following transfection, cell extracts were subjected to Western blot analysis using an anti-RARα antibody [RP alpha (F)]. Actin is used as a loading control. ALLsh = shRNA targeting RARα1 (RARα.v1 and RARα.v3 mRNAs), RARα2 (RARα.v2 mRNA) and RARα4 (RARα.v4 mRNA); RA1sh = shRNA targeting RARα1; RA2sh = shRNA targeting RARα2; PMRsh = shRNA targeting PML-RAR; SCRsh = scramble shRNA (negative control). The (-) symbol represents extracts from COS-7 cell transfected in the absence of any shRNA. B . The indicated NB4 cell populations stably infected with shRNAs targeting PML-RAR ( PMRsh-NB4 ), RARα1 ( RA1sh-NB4 ), RARα2 ( RA2sh-NB4 ) or scramble shRNA ( SCRsh-NB4 ) as well parental NB4 cells ( NB4 ) were grown under standard conditions for 48 hours. Cell extracts were subjected to Western blot analysis using the same anti-RARα antibody as in ( A ). Actin is used as a loading control. C . Upper (WB = Western Blots): Extracts from the indicated COS-7 cells transfected with RARα1 and RARα2 expressing plasmids as well as the indicated NB4 cells [see (B)], were subjected to Western blot analysis with anti-RARα2 [Ab25alpha2(A2)] and β-actin (loading control) antibodies. SCRsh-NB4 = cell treated with vehicle (DMSO) for 24 hours; SCRsh-NB4+ATRA = cell treated with ATRA (1 μM) for 24 hours. Kazumi cells extracts are used as a control for RARα2 expression, as they contain high levels of the protein. Lower (IP = immunoprecipitations): Extracts from the indicated NB4 cell populations and parental NB4 cells [see (B)], were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to Protein G sepharose beads. The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). D . Extracts from the indicated NB4 cell populations [see (B)] were immuno-precipitated with an anti-RARα1 antibody [Ab10alpha1(A1)] or mouse immunoglobulin G (IgG) coupled to Protein G Sepharose beads or Protein G Sepharose beads alone (-). The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. The actin loading control of the immuno-precipitation experiment is shown (input). The calculated molecular weight (M.W.) of each protein is indicated on the left of each blot.
Figure Legend Snippet: PML-RAR, RARα2 and RARα1 knock-down in COS-7 and NB4 cells A . COS-7 cells were transiently transfected with the pcDNA3, pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids in the presence of the indicated shRNA-containing retroviral vectors and corresponding void vector ( VOID ). Sixteen hours following transfection, cell extracts were subjected to Western blot analysis using an anti-RARα antibody [RP alpha (F)]. Actin is used as a loading control. ALLsh = shRNA targeting RARα1 (RARα.v1 and RARα.v3 mRNAs), RARα2 (RARα.v2 mRNA) and RARα4 (RARα.v4 mRNA); RA1sh = shRNA targeting RARα1; RA2sh = shRNA targeting RARα2; PMRsh = shRNA targeting PML-RAR; SCRsh = scramble shRNA (negative control). The (-) symbol represents extracts from COS-7 cell transfected in the absence of any shRNA. B . The indicated NB4 cell populations stably infected with shRNAs targeting PML-RAR ( PMRsh-NB4 ), RARα1 ( RA1sh-NB4 ), RARα2 ( RA2sh-NB4 ) or scramble shRNA ( SCRsh-NB4 ) as well parental NB4 cells ( NB4 ) were grown under standard conditions for 48 hours. Cell extracts were subjected to Western blot analysis using the same anti-RARα antibody as in ( A ). Actin is used as a loading control. C . Upper (WB = Western Blots): Extracts from the indicated COS-7 cells transfected with RARα1 and RARα2 expressing plasmids as well as the indicated NB4 cells [see (B)], were subjected to Western blot analysis with anti-RARα2 [Ab25alpha2(A2)] and β-actin (loading control) antibodies. SCRsh-NB4 = cell treated with vehicle (DMSO) for 24 hours; SCRsh-NB4+ATRA = cell treated with ATRA (1 μM) for 24 hours. Kazumi cells extracts are used as a control for RARα2 expression, as they contain high levels of the protein. Lower (IP = immunoprecipitations): Extracts from the indicated NB4 cell populations and parental NB4 cells [see (B)], were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to Protein G sepharose beads. The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). D . Extracts from the indicated NB4 cell populations [see (B)] were immuno-precipitated with an anti-RARα1 antibody [Ab10alpha1(A1)] or mouse immunoglobulin G (IgG) coupled to Protein G Sepharose beads or Protein G Sepharose beads alone (-). The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. The actin loading control of the immuno-precipitation experiment is shown (input). The calculated molecular weight (M.W.) of each protein is indicated on the left of each blot.

Techniques Used: Transfection, shRNA, Plasmid Preparation, Western Blot, Negative Control, Stable Transfection, Infection, Expressing, Immunoprecipitation, Molecular Weight

Effects of RARα2 over-expression on the growth and differentiation of NB4 cells NB4 cells were transfected with the pCDH-RA2 plasmid and the corresponding void vector, pCDH . Two distinct RARα2 expressing ( pRA2-NB4a and pRA2-NB4b ) and two ( pCDH-NB4a and pCDH-NB4b ) cell populations were isolated. A . Cells were treated with ATRA (1 μM) for 24 hours. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to Protein G sepharose beads. The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin present in the extracts before addition of the anti-RARα2 antibody (input). B . Cells were treated with vehicle (DMSO) or ATRA (1 μM) for the indicated amount of time. The number of viable cells determined after staining with trypan blue is indicated. Each point is the mean±S.D. of three replicate cultures. C . Cells were grown in the presence of vehicle (DMSO) or ATRA (1 μM) for 72 hours and subjected to FACS analysis for the determination of CD11b and CD11c. The column graphs indicate the MAF (mean-associated-fluorescence) values determined. D . Cells were grown as in (C) and treated with vehicle (DMSO) or ATRA (1 μM) for 48 hours. Cell extracts were subjected to Western blot analysis for the indicated proteins. Actin is used as a loading control. The calculated molecular weight (M.W.) of each protein is indicated on the left.
Figure Legend Snippet: Effects of RARα2 over-expression on the growth and differentiation of NB4 cells NB4 cells were transfected with the pCDH-RA2 plasmid and the corresponding void vector, pCDH . Two distinct RARα2 expressing ( pRA2-NB4a and pRA2-NB4b ) and two ( pCDH-NB4a and pCDH-NB4b ) cell populations were isolated. A . Cells were treated with ATRA (1 μM) for 24 hours. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to Protein G sepharose beads. The immuno-precipitates were subjected to Western blot analysis with a different anti-RARα antibody [RP alpha (F)]. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin present in the extracts before addition of the anti-RARα2 antibody (input). B . Cells were treated with vehicle (DMSO) or ATRA (1 μM) for the indicated amount of time. The number of viable cells determined after staining with trypan blue is indicated. Each point is the mean±S.D. of three replicate cultures. C . Cells were grown in the presence of vehicle (DMSO) or ATRA (1 μM) for 72 hours and subjected to FACS analysis for the determination of CD11b and CD11c. The column graphs indicate the MAF (mean-associated-fluorescence) values determined. D . Cells were grown as in (C) and treated with vehicle (DMSO) or ATRA (1 μM) for 48 hours. Cell extracts were subjected to Western blot analysis for the indicated proteins. Actin is used as a loading control. The calculated molecular weight (M.W.) of each protein is indicated on the left.

Techniques Used: Over Expression, Transfection, Plasmid Preparation, Expressing, Isolation, Western Blot, Staining, FACS, Fluorescence, Molecular Weight

Expression, ATRA-dependent proteolytic degradation and transcriptional activity of PML-RAR, RARα2 and RARα1 A . NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 48 hours. Total RNA was extracted and subjected to RT-PCR analysis using Taqman assays for the indicated mRNAs. The results are expressed as the mean±SD of 3 replicates. B . Upper: NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 40 hours before addition of the proteasome inhibitor, MG132 (40 μM) for 8 hours. Total protein extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. Actin was used as a loading control. Lower: NB4 cells were treated as above with vehicle (DMSO), ATRA (0.1 μM), the proteasome inhibitor, MG132 (20 and 40 μM) or ATRA+MG132. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to protein G-sepharose beads (IP = immuno-precipitation) and the immuno-precipitates were subjected to Western blot analysis with the same anti-RARα antibody used in the Upper panel. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). COS-7 = Total extracts of COS-7 cells transfected with a pcDNA3-RARα2 plasmid. The calculated molecular weight (M.W.) of the indicated proteins is shown on the left. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids and the retinoid dependent Luciferase reporter, β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or the indicated concentrations of ATRA for an extra 24 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates. D . COS-7 cells were transfected as in ( C ). Sixteen hours following transfection, cells were treated with vehicle (DMSO) or ATRA (1 μM ) for 16 hours and vehicle or MG132 (40 μM) for an extra 8 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates.
Figure Legend Snippet: Expression, ATRA-dependent proteolytic degradation and transcriptional activity of PML-RAR, RARα2 and RARα1 A . NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 48 hours. Total RNA was extracted and subjected to RT-PCR analysis using Taqman assays for the indicated mRNAs. The results are expressed as the mean±SD of 3 replicates. B . Upper: NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 40 hours before addition of the proteasome inhibitor, MG132 (40 μM) for 8 hours. Total protein extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. Actin was used as a loading control. Lower: NB4 cells were treated as above with vehicle (DMSO), ATRA (0.1 μM), the proteasome inhibitor, MG132 (20 and 40 μM) or ATRA+MG132. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to protein G-sepharose beads (IP = immuno-precipitation) and the immuno-precipitates were subjected to Western blot analysis with the same anti-RARα antibody used in the Upper panel. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). COS-7 = Total extracts of COS-7 cells transfected with a pcDNA3-RARα2 plasmid. The calculated molecular weight (M.W.) of the indicated proteins is shown on the left. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids and the retinoid dependent Luciferase reporter, β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or the indicated concentrations of ATRA for an extra 24 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates. D . COS-7 cells were transfected as in ( C ). Sixteen hours following transfection, cells were treated with vehicle (DMSO) or ATRA (1 μM ) for 16 hours and vehicle or MG132 (40 μM) for an extra 8 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates.

Techniques Used: Expressing, Activity Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation, Transfection, Plasmid Preparation, Molecular Weight, Luciferase

15) Product Images from "Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells"

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0096512

RA enhances GM-CSF-induced Aldh1a2 expression via the RARα/RXRα heterodimer bound to the RARE half-site. ( A ) Localization of the putative RARE half-sites ( underlined ) in Probe C and their mutants, Probe C(RARE-h mt1) and Probe C(RARE-h mt2), are shown. COS-7 cells were transfected with the 0.5 µg of pSG5-RARα and/or pSG5-RXRα. One day after transfection, cell lysates were subjected to DNAP assay using the biotinylated DNA probes. The precipitates were analyzed by Western blotting using anti-RARα( upper panel ) and RXRα ( lower panel ) Abs. ( B ) Flt3L-generated BM-DCs were cultured with 10 ng/ml GM-CSF for 16 h in the presence or absence of 100 nM RA. LE540 (1 µM) was added to the indicated cultures. After the culture, Aldh1a2 mRNA expression was assessed by real-time PCR. The Aldh1a2 mRNA expression level in the cells incubated with medium alone for 16 h was set to 1. ( C ) BM-DCs were cultured with ( closed circle ) or without ( open circle ) 10 ng/ml GM-CSF for 16 h in the presence of graded concentrations of RA. After the culture, Aldh1a2 mRNA expression was assessed by real-time PCR. Relative expression levels were calculated by defining the Aldh1a2 mRNA expression level in the cells incubated with medium alone for 16 h was set to 1. Asterisks indicate a significant difference (*** p
Figure Legend Snippet: RA enhances GM-CSF-induced Aldh1a2 expression via the RARα/RXRα heterodimer bound to the RARE half-site. ( A ) Localization of the putative RARE half-sites ( underlined ) in Probe C and their mutants, Probe C(RARE-h mt1) and Probe C(RARE-h mt2), are shown. COS-7 cells were transfected with the 0.5 µg of pSG5-RARα and/or pSG5-RXRα. One day after transfection, cell lysates were subjected to DNAP assay using the biotinylated DNA probes. The precipitates were analyzed by Western blotting using anti-RARα( upper panel ) and RXRα ( lower panel ) Abs. ( B ) Flt3L-generated BM-DCs were cultured with 10 ng/ml GM-CSF for 16 h in the presence or absence of 100 nM RA. LE540 (1 µM) was added to the indicated cultures. After the culture, Aldh1a2 mRNA expression was assessed by real-time PCR. The Aldh1a2 mRNA expression level in the cells incubated with medium alone for 16 h was set to 1. ( C ) BM-DCs were cultured with ( closed circle ) or without ( open circle ) 10 ng/ml GM-CSF for 16 h in the presence of graded concentrations of RA. After the culture, Aldh1a2 mRNA expression was assessed by real-time PCR. Relative expression levels were calculated by defining the Aldh1a2 mRNA expression level in the cells incubated with medium alone for 16 h was set to 1. Asterisks indicate a significant difference (*** p

Techniques Used: Expressing, Transfection, Western Blot, Generated, Cell Culture, Real-time Polymerase Chain Reaction, Incubation

Sp1 and RARα/RXRα enhance each other's binding to the Aldh1a2 promoter and cooperatively enhance its activity. ( A ) COS-7 cells were transfected with the 0.5 µg of pCMV-Myc-Sp1, the combination of pSG5-RARα and pSG5-RXRα, or the three. One day after transfection, cell lysates were subjected to DNAP assay using anti-Myc Ab, anti-RARα Ab, or anti-RXRα Ab, and biotinylated DNA Probe C whose sequence is shown in Figure 3 . ( B ) COS-7 cells were transfected in triplicate with the 1.25 µg of pGL4-RALDH2 (−873) reporter vector and the 0.5 µg of expression vectors, pCMV-Myc-Sp1, pCMV-Myc-Sp1db, pSG5-RARα, and pSG5-RXRα, or control empty vectors. One day after transfection, cells were stimulated with or without 100 nM RA for 16 h. Then luciferase activities were measured. Relative promoter activities were calculated by arbitrarily defining the activity of pGL4-RALDH2 (−873) alone without RA as 1. ( C ) Flt3L-generated BM-DCs were cultured with or without 10 ng/ml GM-CSF or 10 nM RA. These cells were subjected to ChIP assay with anti-Sp1 or anti-RARα Ab or control IgG1. Binding of Sp1 and RARα proteins to the Aldh1a2 promoter site was estimated by real-time PCR. Data in (B and C) are presented as mean + SD of triplicate cultures. Statistical significance between two groups was determined by the Student's t test (* p
Figure Legend Snippet: Sp1 and RARα/RXRα enhance each other's binding to the Aldh1a2 promoter and cooperatively enhance its activity. ( A ) COS-7 cells were transfected with the 0.5 µg of pCMV-Myc-Sp1, the combination of pSG5-RARα and pSG5-RXRα, or the three. One day after transfection, cell lysates were subjected to DNAP assay using anti-Myc Ab, anti-RARα Ab, or anti-RXRα Ab, and biotinylated DNA Probe C whose sequence is shown in Figure 3 . ( B ) COS-7 cells were transfected in triplicate with the 1.25 µg of pGL4-RALDH2 (−873) reporter vector and the 0.5 µg of expression vectors, pCMV-Myc-Sp1, pCMV-Myc-Sp1db, pSG5-RARα, and pSG5-RXRα, or control empty vectors. One day after transfection, cells were stimulated with or without 100 nM RA for 16 h. Then luciferase activities were measured. Relative promoter activities were calculated by arbitrarily defining the activity of pGL4-RALDH2 (−873) alone without RA as 1. ( C ) Flt3L-generated BM-DCs were cultured with or without 10 ng/ml GM-CSF or 10 nM RA. These cells were subjected to ChIP assay with anti-Sp1 or anti-RARα Ab or control IgG1. Binding of Sp1 and RARα proteins to the Aldh1a2 promoter site was estimated by real-time PCR. Data in (B and C) are presented as mean + SD of triplicate cultures. Statistical significance between two groups was determined by the Student's t test (* p

Techniques Used: Binding Assay, Activity Assay, Transfection, Sequencing, Plasmid Preparation, Expressing, Luciferase, Generated, Cell Culture, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

16) Product Images from "Inhibition of long non-coding RNA NEAT1 impairs myeloid differentiation in acute promyelocytic leukemia cells"

Article Title: Inhibition of long non-coding RNA NEAT1 impairs myeloid differentiation in acute promyelocytic leukemia cells

Journal: BMC Cancer

doi: 10.1186/1471-2407-14-693

lncRNA NEAT1 is repressed in cells expressing PML-RARα and upregulated in response to ATRA. (A) qRT–PCR analysis of NEAT1 in U937-PR9 cells treated with 100 μM ZnSO 4 at the indicated time points. A time series of induction for the PML-RARα protein by ZnSO 4 is shown in Additional file 2 : Figure S2A. (B) qRT–PCR analysis of NEAT1 after knocking down PML-RARα. (C) NB4 and NB4-R2 cells were treated with 1 μM ATRA. NEAT1 was measured by qRT-PCR and normalized to the housekeeping gene ACTB . The panels show the mean ± SD of a representative experiment performed in triplicate.
Figure Legend Snippet: lncRNA NEAT1 is repressed in cells expressing PML-RARα and upregulated in response to ATRA. (A) qRT–PCR analysis of NEAT1 in U937-PR9 cells treated with 100 μM ZnSO 4 at the indicated time points. A time series of induction for the PML-RARα protein by ZnSO 4 is shown in Additional file 2 : Figure S2A. (B) qRT–PCR analysis of NEAT1 after knocking down PML-RARα. (C) NB4 and NB4-R2 cells were treated with 1 μM ATRA. NEAT1 was measured by qRT-PCR and normalized to the housekeeping gene ACTB . The panels show the mean ± SD of a representative experiment performed in triplicate.

Techniques Used: Expressing, Quantitative RT-PCR

17) Product Images from "Targeting Expression of the Leukemogenic PML-RAR? Fusion Protein by Lentiviral Vector-Mediated Small Interfering RNA Results in Leukemic Cell Differentiation and Apoptosis"

Article Title: Targeting Expression of the Leukemogenic PML-RAR? Fusion Protein by Lentiviral Vector-Mediated Small Interfering RNA Results in Leukemic Cell Differentiation and Apoptosis

Journal:

doi: 10.1089/hum.2011.079

Sequences of small interfering RNA (siRNA) specifically targeting the long and short isoforms of PML-RARα. Sequences at the breakpoint region are shown, with sequences contributed by PML and RARα indicated at the top . siRNA sequences are boxed. The breakpoint junction is indicated by the gap in the sequences; differences between siRNA sequences are underlined.
Figure Legend Snippet: Sequences of small interfering RNA (siRNA) specifically targeting the long and short isoforms of PML-RARα. Sequences at the breakpoint region are shown, with sequences contributed by PML and RARα indicated at the top . siRNA sequences are boxed. The breakpoint junction is indicated by the gap in the sequences; differences between siRNA sequences are underlined.

Techniques Used: Small Interfering RNA

18) Product Images from "Targeting the Acute Promyelocytic Leukemia-Associated Fusion Proteins PML/RAR? and PLZF/RAR? with Interfering Peptides"

Article Title: Targeting the Acute Promyelocytic Leukemia-Associated Fusion Proteins PML/RAR? and PLZF/RAR? with Interfering Peptides

Journal: PLoS ONE

doi: 10.1371/journal.pone.0048636

PCC and POZ reverse the proliferation capacity of PML/RARα- and PLZF/RARα-positive murine hematopoietic stem cells. A , Schematic diagram of the experimental conditions. Sca1 + /lin − bone marrow cells were isolated and infected with retroviral vectors containing PML/RARα or PLZF/RARα and GFP or PCC/POZ-GFP. Infected cells were plated in methylcellulose on day 3. Colony counts and replating were measured every 10 days. B and C , Colony count of Sca1 + /lin − bone marrow cells infected with PML/RARα ( B ) or PLZF/RARα ( C ) and GFP or PCC/POZ-GFP cultured in methylcellulose. Mock: empty vector.
Figure Legend Snippet: PCC and POZ reverse the proliferation capacity of PML/RARα- and PLZF/RARα-positive murine hematopoietic stem cells. A , Schematic diagram of the experimental conditions. Sca1 + /lin − bone marrow cells were isolated and infected with retroviral vectors containing PML/RARα or PLZF/RARα and GFP or PCC/POZ-GFP. Infected cells were plated in methylcellulose on day 3. Colony counts and replating were measured every 10 days. B and C , Colony count of Sca1 + /lin − bone marrow cells infected with PML/RARα ( B ) or PLZF/RARα ( C ) and GFP or PCC/POZ-GFP cultured in methylcellulose. Mock: empty vector.

Techniques Used: Periodic Counter-current Chromatography, Isolation, Infection, Cell Culture, Plasmid Preparation

PCC and POZ influences on the HMW complex formation of PML/RARα and PLZF/RARα, respectively. A and B , Size-exclusion chromatography fractions of in vitro translated PML/RARα ( A ) or PLZF/RARα ( B ) and HA-tagged peptide. Fractions were analyzed by western blot (on the right) and probed against RARα. The densitometric analysis of the western blot is shown on the left side as a percentage of the entire signal. C and D , Size-exclusion chromatography of the Phoenix whole cell lysates overexpressing PML/RARα ( C ) or PLZF/RARα ( D ) and GFP-tagged peptide. Fractions were analyzed by western blot (WB) and probed against RARα (α-RARα) (lower part). The densitometric analysis of the western blot is shown in the upper part as a percentage of the entire signal. HA-mock: control empty vector. Input (I), eluted fractions 14 to 29. The numbers above the arrows represent the molecular weight (KD) of the proteins used for the MW calibration: 136 KD for the BSA dimer, 440 KD for Ferritin, and 670 KD for Thyroglobulin.
Figure Legend Snippet: PCC and POZ influences on the HMW complex formation of PML/RARα and PLZF/RARα, respectively. A and B , Size-exclusion chromatography fractions of in vitro translated PML/RARα ( A ) or PLZF/RARα ( B ) and HA-tagged peptide. Fractions were analyzed by western blot (on the right) and probed against RARα. The densitometric analysis of the western blot is shown on the left side as a percentage of the entire signal. C and D , Size-exclusion chromatography of the Phoenix whole cell lysates overexpressing PML/RARα ( C ) or PLZF/RARα ( D ) and GFP-tagged peptide. Fractions were analyzed by western blot (WB) and probed against RARα (α-RARα) (lower part). The densitometric analysis of the western blot is shown in the upper part as a percentage of the entire signal. HA-mock: control empty vector. Input (I), eluted fractions 14 to 29. The numbers above the arrows represent the molecular weight (KD) of the proteins used for the MW calibration: 136 KD for the BSA dimer, 440 KD for Ferritin, and 670 KD for Thyroglobulin.

Techniques Used: Periodic Counter-current Chromatography, Size-exclusion Chromatography, In Vitro, Hemagglutination Assay, Western Blot, Plasmid Preparation, Molecular Weight

PCC and POZ bind to PML/RARα and PLZF/RARα, respectively. A , Theory for the peptide binding to X-RARα, as exemplified by POZ and PLZF/RARα. By binding the oligomerization domain of PLZF/RARα, POZ disables the self-oligomerization and the high-molecular-weight complex formation. B , C , HA-tagged peptides were co-expressed with PML/RARα or PLZF/RARα in the 293 cells through the transfection of the corresponding combination of pCDNA3 vectors with calcium phosphate. An HA-empty plasmid and an HA-tagged BCC (coiled-coil domain of BCR) were used as a specificity control. In B , PCC was transfected at two different concentrations, 5 and 10 µG DNA (first and second BCC lane, respectively). Immunoprecipitation (IP) was performed with an anti-HA matrix. Western blots were probed with α-HA and α-RARα antibodies.
Figure Legend Snippet: PCC and POZ bind to PML/RARα and PLZF/RARα, respectively. A , Theory for the peptide binding to X-RARα, as exemplified by POZ and PLZF/RARα. By binding the oligomerization domain of PLZF/RARα, POZ disables the self-oligomerization and the high-molecular-weight complex formation. B , C , HA-tagged peptides were co-expressed with PML/RARα or PLZF/RARα in the 293 cells through the transfection of the corresponding combination of pCDNA3 vectors with calcium phosphate. An HA-empty plasmid and an HA-tagged BCC (coiled-coil domain of BCR) were used as a specificity control. In B , PCC was transfected at two different concentrations, 5 and 10 µG DNA (first and second BCC lane, respectively). Immunoprecipitation (IP) was performed with an anti-HA matrix. Western blots were probed with α-HA and α-RARα antibodies.

Techniques Used: Periodic Counter-current Chromatography, Binding Assay, Molecular Weight, Hemagglutination Assay, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot

PCC and POZ reverse the differentiation block of PML/RARα- and PLZF/RARα-positive murine hematopoietic stem cells. A , Schematic diagram of the experiment conditions. Sca1 + /lin - murine bone marrow cells were isolated and infected with retroviral vectors containing PML/RARα or PLZF/RARα and GFP or PCC/POZ-GFP and then analyzed for differentiation. B , The infection efficiency, measured as the percentage of the GFP-positive cells to the retrovirally infected cells. C , Reverse transcriptase-PCR of the retrovirus-infected Sca + /lin − bone marrow cells for PML/RARα and PLZF/RARα. Control: β-Actin. D , GIEMSA staining of Sca + /lin − bone marrow cells seven days after infection with retroviral vectors. E , FACS analysis of the Sca1 + /lin − bone marrow cells infected with PML/RARα and GFP or PCC/POZ-GFP. Mock: empty vector. F , FACS analysis of the Sca1 + /lin − bone marrow cells infected with PLZF/RARα and GFP or PCC/POZ-GFP. Mock: empty vector.
Figure Legend Snippet: PCC and POZ reverse the differentiation block of PML/RARα- and PLZF/RARα-positive murine hematopoietic stem cells. A , Schematic diagram of the experiment conditions. Sca1 + /lin - murine bone marrow cells were isolated and infected with retroviral vectors containing PML/RARα or PLZF/RARα and GFP or PCC/POZ-GFP and then analyzed for differentiation. B , The infection efficiency, measured as the percentage of the GFP-positive cells to the retrovirally infected cells. C , Reverse transcriptase-PCR of the retrovirus-infected Sca + /lin − bone marrow cells for PML/RARα and PLZF/RARα. Control: β-Actin. D , GIEMSA staining of Sca + /lin − bone marrow cells seven days after infection with retroviral vectors. E , FACS analysis of the Sca1 + /lin − bone marrow cells infected with PML/RARα and GFP or PCC/POZ-GFP. Mock: empty vector. F , FACS analysis of the Sca1 + /lin − bone marrow cells infected with PLZF/RARα and GFP or PCC/POZ-GFP. Mock: empty vector.

Techniques Used: Periodic Counter-current Chromatography, Blocking Assay, Isolation, Infection, Polymerase Chain Reaction, Staining, FACS, Plasmid Preparation

PM/RARα and PLZF/RARα, degrade in the presence of PCC and POZ, respectively. A and B , Western blot of the whole cell lysates of PML/RARα- ( A ) or PLZF/RARα ( B )-positive Phoenix and BA/F3 cells probed against RARα (α-RARα) and GFP (α-GFP). C and D , BA/F3 cells were treated with 10 µM MG132 or 20 µM Calpain I for 16 h. Control: empty vector; tubulin: loading control. E . BA/F3 cells were treated with 500 nM Lactacystin for 24 h. Control: empty vector; GAPDH: loading control. F , The infection efficiency, measured as the percentage of GFP-positive cells, of the Ba/F3 cells after infection with PINCO (control) or PIDE carrying PLZF/RARα alone or in combination with GFP, GFP-POZ or GFP-PCC or PML/RARα alone or in combination with GFP, GFP-POZ or GFP-PCC peptides, as indicated. G , Western blot of the Phoenix whole cell lysate expressing PML/RARα or a sumoylation-deficient mutant (PML3-160/RARα) PCC-GFP or GFP, probed with α-GFP, α-RARα and α-GPADH as a loading control. The image shown is a representative of three separate experiments.
Figure Legend Snippet: PM/RARα and PLZF/RARα, degrade in the presence of PCC and POZ, respectively. A and B , Western blot of the whole cell lysates of PML/RARα- ( A ) or PLZF/RARα ( B )-positive Phoenix and BA/F3 cells probed against RARα (α-RARα) and GFP (α-GFP). C and D , BA/F3 cells were treated with 10 µM MG132 or 20 µM Calpain I for 16 h. Control: empty vector; tubulin: loading control. E . BA/F3 cells were treated with 500 nM Lactacystin for 24 h. Control: empty vector; GAPDH: loading control. F , The infection efficiency, measured as the percentage of GFP-positive cells, of the Ba/F3 cells after infection with PINCO (control) or PIDE carrying PLZF/RARα alone or in combination with GFP, GFP-POZ or GFP-PCC or PML/RARα alone or in combination with GFP, GFP-POZ or GFP-PCC peptides, as indicated. G , Western blot of the Phoenix whole cell lysate expressing PML/RARα or a sumoylation-deficient mutant (PML3-160/RARα) PCC-GFP or GFP, probed with α-GFP, α-RARα and α-GPADH as a loading control. The image shown is a representative of three separate experiments.

Techniques Used: Periodic Counter-current Chromatography, Western Blot, Plasmid Preparation, Infection, Expressing, Mutagenesis

19) Product Images from "BATF is required for normal expression of gut-homing receptors by T helper cells in response to retinoic acid"

Article Title: BATF is required for normal expression of gut-homing receptors by T helper cells in response to retinoic acid

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20121088

RARα fails to bind the 5′ regulatory regions of the mouse CCR9 and Itg-α4 genes in BATF deficiency. WT or BATF KO CD4 + T cells were activated for 4–5 d with concanavalin A, IL-2, and RA. (A) Expression of nuclear RAR genes in BATF KO CD4 + T cells was examined by quantitative RT-PCR. Normalized values to β-actin levels are shown. (B and C) The binding of RARα and BATF and histone H4 acetylation on the CCR9 gene (B) or the Itg-α4 gene (C) were assessed by ChIP assay. Representative PCR data with duplicated measurements are shown. (D) WT or BATF KO CD4 + T cells were activated for 4–5 d with anti-CD3/CD28 in the presence of IL-2 and 10 nM RA and transfected with pGL4-5′-Itg-α4. The cells were reactivated with anti-CD3/28 + IL2 in the presence of 20 nM RA for 16 h, and luciferase activity was normalized to control Renilla luciferase activity. (E) Naive WT or BATF KO CD4 + T cells were activated with anti-CD3/CD28 or concanavalin A for 4–5 d in the presence of IL-2 and 10 nM RA and the indicated HDAC inhibitors (TSA, BML-210, or EX-527), and the expression of CCR9 and α4β7 was measured by flow cytometry. Graphs show the percentage of cells expressing CCR9 or α4β7. All of the experiments were performed at least three times, and pooled (A, D, and E) or representative (B and C) data are shown. Error bars are SEM obtained from pooled data (A, D, and E) or differences between duplicated measurements (B and C). Significant differences from the KO control group are shown (*, P
Figure Legend Snippet: RARα fails to bind the 5′ regulatory regions of the mouse CCR9 and Itg-α4 genes in BATF deficiency. WT or BATF KO CD4 + T cells were activated for 4–5 d with concanavalin A, IL-2, and RA. (A) Expression of nuclear RAR genes in BATF KO CD4 + T cells was examined by quantitative RT-PCR. Normalized values to β-actin levels are shown. (B and C) The binding of RARα and BATF and histone H4 acetylation on the CCR9 gene (B) or the Itg-α4 gene (C) were assessed by ChIP assay. Representative PCR data with duplicated measurements are shown. (D) WT or BATF KO CD4 + T cells were activated for 4–5 d with anti-CD3/CD28 in the presence of IL-2 and 10 nM RA and transfected with pGL4-5′-Itg-α4. The cells were reactivated with anti-CD3/28 + IL2 in the presence of 20 nM RA for 16 h, and luciferase activity was normalized to control Renilla luciferase activity. (E) Naive WT or BATF KO CD4 + T cells were activated with anti-CD3/CD28 or concanavalin A for 4–5 d in the presence of IL-2 and 10 nM RA and the indicated HDAC inhibitors (TSA, BML-210, or EX-527), and the expression of CCR9 and α4β7 was measured by flow cytometry. Graphs show the percentage of cells expressing CCR9 or α4β7. All of the experiments were performed at least three times, and pooled (A, D, and E) or representative (B and C) data are shown. Error bars are SEM obtained from pooled data (A, D, and E) or differences between duplicated measurements (B and C). Significant differences from the KO control group are shown (*, P

Techniques Used: Gene Knockout, Expressing, Quantitative RT-PCR, Binding Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Transfection, Luciferase, Activity Assay, Flow Cytometry, Cytometry

20) Product Images from "Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation"

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation

Journal:

doi: 10.1128/MCB.01360-05

BTG2 takes part in the RARα transcriptional complex on the RARβ promoter. (A) Anti-PRMT1, anti-BTG2, anti-Sin3A, and anti-RARα ChIP experiments on HL60 cells infected with a control empty vector (C) or with a BTG2 vector (B) treated
Figure Legend Snippet: BTG2 takes part in the RARα transcriptional complex on the RARβ promoter. (A) Anti-PRMT1, anti-BTG2, anti-Sin3A, and anti-RARα ChIP experiments on HL60 cells infected with a control empty vector (C) or with a BTG2 vector (B) treated

Techniques Used: Chromatin Immunoprecipitation, Infection, Plasmid Preparation

BTG2 expression increases RARα transcriptional activity. (A) Transcriptional activity of a luciferase-linked β-RARE responsive element cotransfected in HL60 cells with the indicated amounts of vector DNA (V) or a BTG2 expression vector.
Figure Legend Snippet: BTG2 expression increases RARα transcriptional activity. (A) Transcriptional activity of a luciferase-linked β-RARE responsive element cotransfected in HL60 cells with the indicated amounts of vector DNA (V) or a BTG2 expression vector.

Techniques Used: Expressing, Activity Assay, Luciferase, Plasmid Preparation

BTG2 interacts with the RARα transcriptional complex. Coimmunoprecipitation experiments from lysates of HL60 cells. Cells were treated with 10 −6 M RA for the indicated times. Lysates were immunoprecipitated with the antibodies shown on
Figure Legend Snippet: BTG2 interacts with the RARα transcriptional complex. Coimmunoprecipitation experiments from lysates of HL60 cells. Cells were treated with 10 −6 M RA for the indicated times. Lysates were immunoprecipitated with the antibodies shown on

Techniques Used: Immunoprecipitation

Related Articles

Clone Assay:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. Primers used following RARα immunoprecipitation were (forward and reverse, respectively): GluR1, 5′-AGTCGAAGCGGATGAAGGG-3′, 5′-GTTGTGGTGGTTGGAGGC-3′; GluR2, 5′-TTCTAACAGCATACAGATAGG-3′, 5′-AAGCATTGGTGACTGCGAAAC-3′; CaMKII α 5′-ATCGCCTATATCCGCATCAC-3′, 5′-GGACAAAGAGCGGATCTCTG-3′; laminin B1, 5′-CATTGAGAACGTGGTCACCAC-3′, 5′-GAACGAGCTCTCACAGTCGTAG-3′; and RARα, 5′-TCACAGACCTTCGGAGCATC-3′, 5′-CCAGTTCTGTCTGAGAGGAC-3′.

Centrifugation:

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation
Article Snippet: Lysates were clarified by high-speed centrifugation and quantified by using a Bradford reagent. .. Immunoprecipitates were analyzed by Western blotting by standard methods with the antibodies anti-BTG2 , anti-PRMT1 (Abcam), anti-RARα (c-20; Santa Cruz), anti-α-tubulin (Sigma clone B-5-1-2), anti-RARβ (c-19; Santa Cruz), and anti-mSin3A as described above.

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: Cell debris was removed by centrifugation (20,000×g ) for 10 min. Lysates were first incubated with Streptavidin-Sepharose beads (GE Healthcare) for 30 min to eliminate nonspecific binding and then incubated with 1.5 µg of poly(dI-dC) and 2 µg of biotinylated DNA probe for 1 h at 4°C. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Luciferase:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: FL and Renilla luciferase activities were measured with luciferase systems (Promega). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Mass Spectrometry:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Liquid chromatography/tandem mass spectrometry data were submitted to Mascot for analyses. .. RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen).

Immunostaining:

Article Title:
Article Snippet: For immunostaining, anti-HA (Sc7392; Santa Cruz Biotechnology), and anti-FLAG (F7425; Sigma) antibodies were used. .. Anti-RARα (Sc-20), anti-HDAC1, and anti-GAPDH antibodies were purchased from Santa Cruz Biotechnologies.

Real-time Polymerase Chain Reaction:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz). .. IgG was used as a negative control for the qChIP assays.

Article Title: SP1 and RARα regulate AGAP2 expression in cancer
Article Snippet: Afterwards, crosslinked proteins of interest were immunoprecipitated with 2 μg of either anti-RARα (C-20), anti-RXRα (D-20) (both from Santa Cruz Biotechnology), anti-PCAF (C14G9, Cell Signaling), or 1 μg of anti-SP1 (D4C3, Cell Signalling). .. Anti-Pol II (N-20, Santa Cruz Biotechnology) was used as positive control and rabbit IgG (Invitrogen) as negative control.

Incubation:

Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system
Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry. .. Borg decloaker solution was used for antigen retrieval prior anti-Lysozyme antibody incubation (Thermo Ab-1 RB-372-A1, 1:2000) for Paneth cells detection.

Article Title: Kr?ppel-like Factor 4 Inhibits Proliferation by Platelet-derived Growth Factor Receptor ?-mediated, Not by Retinoic Acid Receptor ?-mediated, Phosphatidylinositol 3-Kinase and ERK Signaling in Vascular Smooth Muscle Cells
Article Snippet: Total protein (70 μg) from each sample was separated by 8% SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Millipore). .. The membranes were blocked with 5% milk in TTBS for 2 h at room temperature and incubated overnight at 4 °C using the following primary antibodies: 1:500 rabbit anti-Klf4 (Santa Cruz), 1:500 mouse anti-ERK1/2 (Santa Cruz), 1:500 mouse antiphospho-ERK1/2 (Santa Cruz), 1:1000 rabbit anti-MEK1/2 (Cell Signaling), 1:1000 rabbit antiphospho-MEK1/2 (Cell Signaling), 1:1000 rabbit anti-p38 (Cell Signaling), 1:500 rabbit anti-PDGFR (Santa Cruz), 1:200 antiphospho-PDGFRβ (Santa Cruz), 1:500 anti-RARα (Santa Cruz), 1:500 anti-retinoic X receptor (RXRα) (Santa Cruz), and 1:1000 mouse anti-β-actin (Santa Cruz). .. The membranes were then incubated for 1 h at room temperature with a 1:5000 dilution of anti-rabbit/horseradish peroxidase or anti-mouse/horseradish peroxidase (Santa Cruz) and developed with the Chemiluminescence Plus Western blot analysis kit (Santa Cruz).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: Streptavidin-Sepharose beads were then added and incubated with these mixtures for an additional 30 min at 4°C. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Amplification:

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Briefly, 5 × 106 cells were crosslinked in vivo, lysed, and immediately sonicated. .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. VEGF (FWD) 5′AAAGACCCAACTCAAGTATCATCTSSAGT3′, and VEGF (REV) 5′CACTCACTGTGTGTGGCCTTAGGTTATTCAAC3′.

Expressing:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: HEK293, HCT116 p53+/+ , HCT116 p53−/− , and HL-60 cells were transfected with increasing amounts of pSG5-PLZF-RARα expression vector. .. The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. An N-terminal Myc tag was included in PCR primers.

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: COS-7 cells were transfected with 1 µg of expression vectors using LipofectAmine 2000 (Invitrogen), according to the manufacturer's instructions. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells
Article Snippet: ChIP assays ( ) were performed with anti-RARα (sc-551x), anti-ERα (sc-542x), and anti-CYP1A1 (sc-20772) irrelevant antibodies (Santa Cruz Biotechnology). .. In vitro mutagenesis was performed with the QuikChange site-directed mutagenesis kit (Stratagene, Cedar Creek, TX).

Western Blot:

Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?
Article Snippet: Paragraph title: Western blotting ... The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000). .. For solubilization, COS cells (3 × 106 ) transfected 24 h with pcDNA-FL-MS2BS and MS2-EGFP or MS2-RARα or domains-EGFP were lysed in 200 μl of buffer C (0.25 m sucrose, 10 m m Tris, pH 7.4, 25 m m KCl, 5 m m MgCl2 , 2 m m dithiothreitol, 30 units/ml RNaseOUT) with digitonin (50 mg/ml; Sigma) on ice for 15 min.

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells
Article Snippet: Paragraph title: FACS analysis, antibodies, immuno-precipitation and WB analyses ... The other anti-RARα (SC551), anti-β-actin, cEBPβ, and anti-STAT-1 antibodies were from Santa-Cruz-Biotechnology.

Article Title: Targeting the Acute Promyelocytic Leukemia-Associated Fusion Proteins PML/RAR? and PLZF/RAR? with Interfering Peptides
Article Snippet: The cells were treated for 16 h with 10 µM MG132 and 20 µM calpain I or for 24 h with 500 nM lactacystin. .. Western blot analysis was performed using the anti-RARα (C-20 - Santa Cruz Biotechnology, Santa Cruz, USA), anti-GFP (FL - St. Cruz), anti-c-ABL (24-11, St. Cruz Biotechnology, Santa Cruz, USA) and anti-phospho-ABL (Tyr245, Millipore, Billerica, USA), anti-GAPDH (FL-335 - St. Cruz), and anti-tubulin (Ab-4, NeoMarkers, Thermo Scientific Inc., Kalamazoo, USA) antibodies. .. The membranes were blocked in 5% low-fat milk and washed in TBS/0.1% Tween20 (TBS-T).

Article Title: The Ski protein can inhibit ligand induced RAR? and HDAC3 degradation in the Retinoic acid signaling pathway
Article Snippet: All cloning procedures were verified by DNA sequencing. .. Co-immunoprecipitation and western blot were performed as described [ ] Antibodies used were anti-Myc (9E10, Santa Cruz Biotechnology, CA, USA), anti-Flag mouse monoclonal antibody (Sigma), anti-T7 mouse monoclonal antibodies (Novagen, Madison, WI, USA), anti-Ski (H-329, Santa Cruz Biotechnology), anti-HDAC3 (3G6, Upstate, Charlottesville, VA, USA), anti-Ski (G8, Cascade Bioscience, Winchester, MA, USA), anti-RARα (Santa Cruz Biotechnology), anti-β-Actin (Sigma), and anti-α-Tubulin (Sigma). .. Proteins were detected by chemiluminescence (Perkin Elmer, Shelton, CT, USA).

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation
Article Snippet: Then, 4 mg of protein lysate was precleared with protein A-Sepharose and immunoprecipitated with the antibodies anti-Sin3A (sc-767; Santa Cruz Biologicals, Santa Cruz, CA), anti-PRMT1 (ChIP-Grade; Abcam, Cambridge, United Kingdom), anti-RAR (M-454; Santa Cruz), and anti-BTG2 ( ). .. Immunoprecipitates were analyzed by Western blotting by standard methods with the antibodies anti-BTG2 , anti-PRMT1 (Abcam), anti-RARα (c-20; Santa Cruz), anti-α-tubulin (Sigma clone B-5-1-2), anti-RARβ (c-19; Santa Cruz), and anti-mSin3A as described above. .. Filters were treated with anti-mouse or anti-rabbit horseradish peroxidase-conjugated antibody and detected by using the ECL System (Amersham, Madison, WI).

Article Title: Kr?ppel-like Factor 4 Inhibits Proliferation by Platelet-derived Growth Factor Receptor ?-mediated, Not by Retinoic Acid Receptor ?-mediated, Phosphatidylinositol 3-Kinase and ERK Signaling in Vascular Smooth Muscle Cells
Article Snippet: Paragraph title: Western Blot Analysis ... The membranes were blocked with 5% milk in TTBS for 2 h at room temperature and incubated overnight at 4 °C using the following primary antibodies: 1:500 rabbit anti-Klf4 (Santa Cruz), 1:500 mouse anti-ERK1/2 (Santa Cruz), 1:500 mouse antiphospho-ERK1/2 (Santa Cruz), 1:1000 rabbit anti-MEK1/2 (Cell Signaling), 1:1000 rabbit antiphospho-MEK1/2 (Cell Signaling), 1:1000 rabbit anti-p38 (Cell Signaling), 1:500 rabbit anti-PDGFR (Santa Cruz), 1:200 antiphospho-PDGFRβ (Santa Cruz), 1:500 anti-RARα (Santa Cruz), 1:500 anti-retinoic X receptor (RXRα) (Santa Cruz), and 1:1000 mouse anti-β-actin (Santa Cruz).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: After washing the beads three times in DNAP binding buffer, precipitated proteins were eluted in SDS-PAGE sample buffer. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs. .. COS-7 cells were maintained in complete DMEM medium.

Immunohistochemistry:

Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system
Article Snippet: 4μm sections were de-waxed and rehydrated prior to heat-mediated antigen retrieval in citrate buffer (ph 6). .. Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry. .. Borg decloaker solution was used for antigen retrieval prior anti-Lysozyme antibody incubation (Thermo Ab-1 RB-372-A1, 1:2000) for Paneth cells detection.

Chromatography:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Liquid chromatography/tandem mass spectrometry data were submitted to Mascot for analyses. .. RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen).

Protease Inhibitor:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Article Title: Kr?ppel-like Factor 4 Inhibits Proliferation by Platelet-derived Growth Factor Receptor ?-mediated, Not by Retinoic Acid Receptor ?-mediated, Phosphatidylinositol 3-Kinase and ERK Signaling in Vascular Smooth Muscle Cells
Article Snippet: The cells were lysed with 150 m m NaCl, 50 m m Tris-HCl (pH 7.5), 1% Nonidet P-40, 0.5% sodium deoxycholic acid, and Complete protease inhibitor mixture tablets (Roche Applied Science), and the protein was then isolated ( , ). .. The membranes were blocked with 5% milk in TTBS for 2 h at room temperature and incubated overnight at 4 °C using the following primary antibodies: 1:500 rabbit anti-Klf4 (Santa Cruz), 1:500 mouse anti-ERK1/2 (Santa Cruz), 1:500 mouse antiphospho-ERK1/2 (Santa Cruz), 1:1000 rabbit anti-MEK1/2 (Cell Signaling), 1:1000 rabbit antiphospho-MEK1/2 (Cell Signaling), 1:1000 rabbit anti-p38 (Cell Signaling), 1:500 rabbit anti-PDGFR (Santa Cruz), 1:200 antiphospho-PDGFRβ (Santa Cruz), 1:500 anti-RARα (Santa Cruz), 1:500 anti-retinoic X receptor (RXRα) (Santa Cruz), and 1:1000 mouse anti-β-actin (Santa Cruz).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: Transfected COS-7 cells or nuclear fractions of BM-DCs were lysed or diluted with DNAP binding buffer [25 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.25% NP-40, 1 mM DTT and Complete Protease Inhibitor Cocktail (Nacalai Tesque)], respectively. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Northern Blot:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Northern blotting was done with Northern-Max (Ambion) using psoralen-biotin-labeled FL or β-actin probes generated by in vitro transcription. .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Cell Culture:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. Primers used following RARα immunoprecipitation were (forward and reverse, respectively): GluR1, 5′-AGTCGAAGCGGATGAAGGG-3′, 5′-GTTGTGGTGGTTGGAGGC-3′; GluR2, 5′-TTCTAACAGCATACAGATAGG-3′, 5′-AAGCATTGGTGACTGCGAAAC-3′; CaMKII α 5′-ATCGCCTATATCCGCATCAC-3′, 5′-GGACAAAGAGCGGATCTCTG-3′; laminin B1, 5′-CATTGAGAACGTGGTCACCAC-3′, 5′-GAACGAGCTCTCACAGTCGTAG-3′; and RARα, 5′-TCACAGACCTTCGGAGCATC-3′, 5′-CCAGTTCTGTCTGAGAGGAC-3′.

Article Title: Targeting the Acute Promyelocytic Leukemia-Associated Fusion Proteins PML/RAR? and PLZF/RAR? with Interfering Peptides
Article Snippet: Paragraph title: Cell lines, cell culture and western blotting ... Western blot analysis was performed using the anti-RARα (C-20 - Santa Cruz Biotechnology, Santa Cruz, USA), anti-GFP (FL - St. Cruz), anti-c-ABL (24-11, St. Cruz Biotechnology, Santa Cruz, USA) and anti-phospho-ABL (Tyr245, Millipore, Billerica, USA), anti-GAPDH (FL-335 - St. Cruz), and anti-tubulin (Ab-4, NeoMarkers, Thermo Scientific Inc., Kalamazoo, USA) antibodies.

Article Title: BATF is required for normal expression of gut-homing receptors by T helper cells in response to retinoic acid
Article Snippet: CD4+ T cells (5 × 106 naive per sample), cultured in the presence of 100 U/ml IL-2, 1.5 µg/ml concanavalin A, and 10 nM RA for 4–5 d, were used for ChIP assays. .. DNA protein complexes were immunoprecipitated using 4 µg anti-BATF (rabbit polyclonal; Cell Signaling Technology), anti-RARα (rabbit polyclonal; Santa Cruz Biotechnology, Inc.), and anti–acetyl-histone H4 antibodies (EMD Millipore).

Oligonucleotide Labeling:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: Oligonucleotide labeling was performed using the Biotin 3′ End Labeling Kit (Pierce Biotechnology). .. For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ).

Generated:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Northern blotting was done with Northern-Max (Ambion) using psoralen-biotin-labeled FL or β-actin probes generated by in vitro transcription. .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. An N-terminal Myc tag was included in PCR primers.

other:

Article Title: Regulation of Sox9 activity by crosstalk with nuclear factor-?B and retinoic acid receptors
Article Snippet: Antibodies used in these studies were anti-Sox9 (H-90), anti-NF-κB p65 (C-20) and anti-RARα (C-20) from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-β-catenin (C-2206) from Sigma Aldrich; and horseradish peroxidase-conjugated goat-anti-rabbit secondary antibody from Pierce Biotechnology Inc. (Rockford, IL, USA).

Polymerase Chain Reaction:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. Primers used following RARα immunoprecipitation were (forward and reverse, respectively): GluR1, 5′-AGTCGAAGCGGATGAAGGG-3′, 5′-GTTGTGGTGGTTGGAGGC-3′; GluR2, 5′-TTCTAACAGCATACAGATAGG-3′, 5′-AAGCATTGGTGACTGCGAAAC-3′; CaMKII α 5′-ATCGCCTATATCCGCATCAC-3′, 5′-GGACAAAGAGCGGATCTCTG-3′; laminin B1, 5′-CATTGAGAACGTGGTCACCAC-3′, 5′-GAACGAGCTCTCACAGTCGTAG-3′; and RARα, 5′-TCACAGACCTTCGGAGCATC-3′, 5′-CCAGTTCTGTCTGAGAGGAC-3′.

Sonication:

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation
Article Snippet: For immunoprecipitation, cells were lysed by sonication in E1A buffer (50 mM HEPES [pH 7], 150 mM NaCl, 0.1% NP-40, 5 mM EDTA, 1 mM dithiothreitol [DTT], and protease inhibitors). .. Immunoprecipitates were analyzed by Western blotting by standard methods with the antibodies anti-BTG2 , anti-PRMT1 (Abcam), anti-RARα (c-20; Santa Cruz), anti-α-tubulin (Sigma clone B-5-1-2), anti-RARβ (c-19; Santa Cruz), and anti-mSin3A as described above.

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123).

Article Title: SP1 and RARα regulate AGAP2 expression in cancer
Article Snippet: The chromatin was sheared to 100–600 bp by sonication using an AFA Focused-Ultrasonicator (S220- Series from CovarisTM ) at 6 × 60 second on-off pulses at 4 °C. .. Afterwards, crosslinked proteins of interest were immunoprecipitated with 2 μg of either anti-RARα (C-20), anti-RXRα (D-20) (both from Santa Cruz Biotechnology), anti-PCAF (C14G9, Cell Signaling), or 1 μg of anti-SP1 (D4C3, Cell Signalling).

Binding Assay:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: The molecular interactions between PLZF-RARα and p53, Sp1, or RARα and various histone modifications within the CDKN1A proximal promoter were analyzed using a standard qChIP assay protocol as described elsewhere ( ). .. The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz). .. The level of endogenous Sp1 and p53 protein binding was analyzed using polyclonal antibodies against anti-p53 (Santa Cruz), anti-Sp1 (Santa Cruz), anti-Ac-Histone 3, anti-Ac-Histone 4, anti-Histone H3K4-Me3, and anti-Histone H3K9-Me3 (Upstate).

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: In brief, binding reactions included 1 × binding buffer, 2.5% glycerol, 5 mM MgCl2 , 50 ng/µl Poly (dI•dC), 0.05% NP-40, 4 pmol of unlabeled oligo, 5 µl nuclear extract and 20 fmol of biotin labeled oligo. .. For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: After washing the beads three times in DNAP binding buffer, precipitated proteins were eluted in SDS-PAGE sample buffer. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Staining:

Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system
Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry. .. Borg decloaker solution was used for antigen retrieval prior anti-Lysozyme antibody incubation (Thermo Ab-1 RB-372-A1, 1:2000) for Paneth cells detection.

In Vivo:

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123).

Affinity Precipitation:

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: Paragraph title: DNA affinity precipitation (DNAP) assay ... Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Fluorescence:

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells
Article Snippet: CD11b, CD11c and CD38 surface markers were determined with a Fluorescence Activated Cell Sorter (FACS, Becton and Dickinson) [ , ]. .. The other anti-RARα (SC551), anti-β-actin, cEBPβ, and anti-STAT-1 antibodies were from Santa-Cruz-Biotechnology.

Isolation:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Article Title: Kr?ppel-like Factor 4 Inhibits Proliferation by Platelet-derived Growth Factor Receptor ?-mediated, Not by Retinoic Acid Receptor ?-mediated, Phosphatidylinositol 3-Kinase and ERK Signaling in Vascular Smooth Muscle Cells
Article Snippet: The cells were lysed with 150 m m NaCl, 50 m m Tris-HCl (pH 7.5), 1% Nonidet P-40, 0.5% sodium deoxycholic acid, and Complete protease inhibitor mixture tablets (Roche Applied Science), and the protein was then isolated ( , ). .. The membranes were blocked with 5% milk in TTBS for 2 h at room temperature and incubated overnight at 4 °C using the following primary antibodies: 1:500 rabbit anti-Klf4 (Santa Cruz), 1:500 mouse anti-ERK1/2 (Santa Cruz), 1:500 mouse antiphospho-ERK1/2 (Santa Cruz), 1:1000 rabbit anti-MEK1/2 (Cell Signaling), 1:1000 rabbit antiphospho-MEK1/2 (Cell Signaling), 1:1000 rabbit anti-p38 (Cell Signaling), 1:500 rabbit anti-PDGFR (Santa Cruz), 1:200 antiphospho-PDGFRβ (Santa Cruz), 1:500 anti-RARα (Santa Cruz), 1:500 anti-retinoic X receptor (RXRα) (Santa Cruz), and 1:1000 mouse anti-β-actin (Santa Cruz).

Transfection:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: HEK293, HCT116 p53+/+ , HCT116 p53−/− , and HL-60 cells were transfected with increasing amounts of pSG5-PLZF-RARα expression vector. .. The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: Transfected COS-7 cells or nuclear fractions of BM-DCs were lysed or diluted with DNAP binding buffer [25 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.25% NP-40, 1 mM DTT and Complete Protease Inhibitor Cocktail (Nacalai Tesque)], respectively. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells
Article Snippet: Paragraph title: ChIP, Oligonucleotides, Plasmid Constructs, and Transfections ... ChIP assays ( ) were performed with anti-RARα (sc-551x), anti-ERα (sc-542x), and anti-CYP1A1 (sc-20772) irrelevant antibodies (Santa Cruz Biotechnology).

Labeling:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: In brief, binding reactions included 1 × binding buffer, 2.5% glycerol, 5 mM MgCl2 , 50 ng/µl Poly (dI•dC), 0.05% NP-40, 4 pmol of unlabeled oligo, 5 µl nuclear extract and 20 fmol of biotin labeled oligo. .. For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ). .. Binding reactions were incubated at room temperature for 40 min and then resolved on a 6% native polyacrylamide gel in 0.5× TBE in a minigel electrophoresis apparatus (dimensions 8 × 8 × 0.1 cm).

Purification:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000). .. For solubilization, COS cells (3 × 106 ) transfected 24 h with pcDNA-FL-MS2BS and MS2-EGFP or MS2-RARα or domains-EGFP were lysed in 200 μl of buffer C (0.25 m sucrose, 10 m m Tris, pH 7.4, 25 m m KCl, 5 m m MgCl2 , 2 m m dithiothreitol, 30 units/ml RNaseOUT) with digitonin (50 mg/ml; Sigma) on ice for 15 min.

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: TAP determination of RARα interacting proteins was done with a kit (Stratagene) ( ). .. RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. Primers used following RARα immunoprecipitation were (forward and reverse, respectively): GluR1, 5′-AGTCGAAGCGGATGAAGGG-3′, 5′-GTTGTGGTGGTTGGAGGC-3′; GluR2, 5′-TTCTAACAGCATACAGATAGG-3′, 5′-AAGCATTGGTGACTGCGAAAC-3′; CaMKII α 5′-ATCGCCTATATCCGCATCAC-3′, 5′-GGACAAAGAGCGGATCTCTG-3′; laminin B1, 5′-CATTGAGAACGTGGTCACCAC-3′, 5′-GAACGAGCTCTCACAGTCGTAG-3′; and RARα, 5′-TCACAGACCTTCGGAGCATC-3′, 5′-CCAGTTCTGTCTGAGAGGAC-3′.

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells
Article Snippet: Both Ab10a(A1) and Ab25a(A2) were purified on sulfoLink gel columns (Pierce Chemical) coupled to the immunizing peptide [ ]. .. The other anti-RARα (SC551), anti-β-actin, cEBPβ, and anti-STAT-1 antibodies were from Santa-Cruz-Biotechnology.

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Briefly, 5 × 106 cells were crosslinked in vivo, lysed, and immediately sonicated. .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. VEGF (FWD) 5′AAAGACCCAACTCAAGTATCATCTSSAGT3′, and VEGF (REV) 5′CACTCACTGTGTGTGGCCTTAGGTTATTCAAC3′.

Article Title: SP1 and RARα regulate AGAP2 expression in cancer
Article Snippet: Afterwards, crosslinked proteins of interest were immunoprecipitated with 2 μg of either anti-RARα (C-20), anti-RXRα (D-20) (both from Santa Cruz Biotechnology), anti-PCAF (C14G9, Cell Signaling), or 1 μg of anti-SP1 (D4C3, Cell Signalling). .. Anti-Pol II (N-20, Santa Cruz Biotechnology) was used as positive control and rabbit IgG (Invitrogen) as negative control.

Protein Extraction:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: Nuclear protein extraction was performed using 50 µl packed cell volume samples according to the manufacturer’s procedure. .. For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ).

Electrophoretic Mobility Shift Assay:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: Paragraph title: Electrophoretic mobility shift assay ... For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ).

Lysis:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Article Title: Targeting the Acute Promyelocytic Leukemia-Associated Fusion Proteins PML/RAR? and PLZF/RAR? with Interfering Peptides
Article Snippet: Cell lysates were prepared in an SDS lysis buffer (1.5 M Tris-HCl, pH 6.8, 20% SDS, 10% Glycerol). .. Western blot analysis was performed using the anti-RARα (C-20 - Santa Cruz Biotechnology, Santa Cruz, USA), anti-GFP (FL - St. Cruz), anti-c-ABL (24-11, St. Cruz Biotechnology, Santa Cruz, USA) and anti-phospho-ABL (Tyr245, Millipore, Billerica, USA), anti-GAPDH (FL-335 - St. Cruz), and anti-tubulin (Ab-4, NeoMarkers, Thermo Scientific Inc., Kalamazoo, USA) antibodies.

Mouse Assay:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Chromatin Immunoprecipitation:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: The molecular interactions between PLZF-RARα and p53, Sp1, or RARα and various histone modifications within the CDKN1A proximal promoter were analyzed using a standard qChIP assay protocol as described elsewhere ( ). .. The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz). .. The level of endogenous Sp1 and p53 protein binding was analyzed using polyclonal antibodies against anti-p53 (Santa Cruz), anti-Sp1 (Santa Cruz), anti-Ac-Histone 3, anti-Ac-Histone 4, anti-Histone H3K4-Me3, and anti-Histone H3K9-Me3 (Upstate).

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation
Article Snippet: Then, 4 mg of protein lysate was precleared with protein A-Sepharose and immunoprecipitated with the antibodies anti-Sin3A (sc-767; Santa Cruz Biologicals, Santa Cruz, CA), anti-PRMT1 (ChIP-Grade; Abcam, Cambridge, United Kingdom), anti-RAR (M-454; Santa Cruz), and anti-BTG2 ( ). .. Immunoprecipitates were analyzed by Western blotting by standard methods with the antibodies anti-BTG2 , anti-PRMT1 (Abcam), anti-RARα (c-20; Santa Cruz), anti-α-tubulin (Sigma clone B-5-1-2), anti-RARβ (c-19; Santa Cruz), and anti-mSin3A as described above.

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Paragraph title: Chromatin immunoprecipitation (ChIP) ... Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123).

Article Title: BATF is required for normal expression of gut-homing receptors by T helper cells in response to retinoic acid
Article Snippet: Paragraph title: Bioinformatics and ChIP assays. ... DNA protein complexes were immunoprecipitated using 4 µg anti-BATF (rabbit polyclonal; Cell Signaling Technology), anti-RARα (rabbit polyclonal; Santa Cruz Biotechnology, Inc.), and anti–acetyl-histone H4 antibodies (EMD Millipore).

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells
Article Snippet: Cell growth was evaluated using MTT , and senescence was determined with a β-galactosidase kit (Cell Signaling Technology, Beverly, MA) or with the EpiQuick global trimethyl histone H3-K9 quantification kit (EPIGENTEK, Brooklyn, NY). .. ChIP assays ( ) were performed with anti-RARα (sc-551x), anti-ERα (sc-542x), and anti-CYP1A1 (sc-20772) irrelevant antibodies (Santa Cruz Biotechnology). .. In vitro mutagenesis was performed with the QuikChange site-directed mutagenesis kit (Stratagene, Cedar Creek, TX).

Article Title: SP1 and RARα regulate AGAP2 expression in cancer
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Afterwards, crosslinked proteins of interest were immunoprecipitated with 2 μg of either anti-RARα (C-20), anti-RXRα (D-20) (both from Santa Cruz Biotechnology), anti-PCAF (C14G9, Cell Signaling), or 1 μg of anti-SP1 (D4C3, Cell Signalling).

Article Title: PU.1 controls the expression of long noncoding RNA HOTAIRM1 during granulocytic differentiation
Article Snippet: Paragraph title: Chromatin immunoprecipitation assay ... The following antibodies were used: anti-PU.1 (#2258; Cell Signaling Technology, Danvers, MA, USA), anti-RARα (C-20 X; Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-PML (H238 X; Santa Cruz).

SDS Page:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000). .. For solubilization, COS cells (3 × 106 ) transfected 24 h with pcDNA-FL-MS2BS and MS2-EGFP or MS2-RARα or domains-EGFP were lysed in 200 μl of buffer C (0.25 m sucrose, 10 m m Tris, pH 7.4, 25 m m KCl, 5 m m MgCl2 , 2 m m dithiothreitol, 30 units/ml RNaseOUT) with digitonin (50 mg/ml; Sigma) on ice for 15 min.

Article Title: Kr?ppel-like Factor 4 Inhibits Proliferation by Platelet-derived Growth Factor Receptor ?-mediated, Not by Retinoic Acid Receptor ?-mediated, Phosphatidylinositol 3-Kinase and ERK Signaling in Vascular Smooth Muscle Cells
Article Snippet: Total protein (70 μg) from each sample was separated by 8% SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Millipore). .. The membranes were blocked with 5% milk in TTBS for 2 h at room temperature and incubated overnight at 4 °C using the following primary antibodies: 1:500 rabbit anti-Klf4 (Santa Cruz), 1:500 mouse anti-ERK1/2 (Santa Cruz), 1:500 mouse antiphospho-ERK1/2 (Santa Cruz), 1:1000 rabbit anti-MEK1/2 (Cell Signaling), 1:1000 rabbit antiphospho-MEK1/2 (Cell Signaling), 1:1000 rabbit anti-p38 (Cell Signaling), 1:500 rabbit anti-PDGFR (Santa Cruz), 1:200 antiphospho-PDGFRβ (Santa Cruz), 1:500 anti-RARα (Santa Cruz), 1:500 anti-retinoic X receptor (RXRα) (Santa Cruz), and 1:1000 mouse anti-β-actin (Santa Cruz).

Article Title: Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells
Article Snippet: After washing the beads three times in DNAP binding buffer, precipitated proteins were eluted in SDS-PAGE sample buffer. .. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs. .. COS-7 cells were maintained in complete DMEM medium.

Plasmid Preparation:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: HEK293, HCT116 p53+/+ , HCT116 p53−/− , and HL-60 cells were transfected with increasing amounts of pSG5-PLZF-RARα expression vector. .. The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells
Article Snippet: Paragraph title: ChIP, Oligonucleotides, Plasmid Constructs, and Transfections ... ChIP assays ( ) were performed with anti-RARα (sc-551x), anti-ERα (sc-542x), and anti-CYP1A1 (sc-20772) irrelevant antibodies (Santa Cruz Biotechnology).

Software:

Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system
Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry. .. For goblet cell staining, slides were incubated in 1% Alcian Blue/3% acetic acid solution for five minutes and counterstained with nuclear fast red.

Electrophoresis:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ). .. Binding reactions were incubated at room temperature for 40 min and then resolved on a 6% native polyacrylamide gel in 0.5× TBE in a minigel electrophoresis apparatus (dimensions 8 × 8 × 0.1 cm).

Negative Control:

Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes
Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz). .. The level of endogenous Sp1 and p53 protein binding was analyzed using polyclonal antibodies against anti-p53 (Santa Cruz), anti-Sp1 (Santa Cruz), anti-Ac-Histone 3, anti-Ac-Histone 4, anti-Histone H3K4-Me3, and anti-Histone H3K9-Me3 (Upstate).

In Vitro:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: Northern blotting was done with Northern-Max (Ambion) using psoralen-biotin-labeled FL or β-actin probes generated by in vitro transcription. .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

Hot Start PCR:

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Briefly, 5 × 106 cells were crosslinked in vivo, lysed, and immediately sonicated. .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. VEGF (FWD) 5′AAAGACCCAACTCAAGTATCATCTSSAGT3′, and VEGF (REV) 5′CACTCACTGTGTGTGGCCTTAGGTTATTCAAC3′.

Immunoprecipitation:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: TAP determination of RARα interacting proteins was done with a kit (Stratagene) ( ). .. RAR α -associated mRNA —RARα was immunoprecipitated from lysates of primary hippocampus neurons (DIC14–15) with anti-RARα (Santa Cruz). mRNA was released by boiling twice (5 min each, 10 m m Tris, pH 7.5, 1 m m EDTA, 1% SDS), purified with MegaClear (Ambion), and reverse transcribed with Superscript II (Invitrogen). .. Primers used following RARα immunoprecipitation were (forward and reverse, respectively): GluR1, 5′-AGTCGAAGCGGATGAAGGG-3′, 5′-GTTGTGGTGGTTGGAGGC-3′; GluR2, 5′-TTCTAACAGCATACAGATAGG-3′, 5′-AAGCATTGGTGACTGCGAAAC-3′; CaMKII α 5′-ATCGCCTATATCCGCATCAC-3′, 5′-GGACAAAGAGCGGATCTCTG-3′; laminin B1, 5′-CATTGAGAACGTGGTCACCAC-3′, 5′-GAACGAGCTCTCACAGTCGTAG-3′; and RARα, 5′-TCACAGACCTTCGGAGCATC-3′, 5′-CCAGTTCTGTCTGAGAGGAC-3′.

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells
Article Snippet: Paragraph title: FACS analysis, antibodies, immuno-precipitation and WB analyses ... The other anti-RARα (SC551), anti-β-actin, cEBPβ, and anti-STAT-1 antibodies were from Santa-Cruz-Biotechnology.

Article Title: Btg2 Enhances Retinoic Acid-Induced Differentiation by Modulating Histone H4 Methylation and Acetylation
Article Snippet: Paragraph title: Immunoprecipitation and Western blotting. ... Immunoprecipitates were analyzed by Western blotting by standard methods with the antibodies anti-BTG2 , anti-PRMT1 (Abcam), anti-RARα (c-20; Santa Cruz), anti-α-tubulin (Sigma clone B-5-1-2), anti-RARβ (c-19; Santa Cruz), and anti-mSin3A as described above.

Article Title:
Article Snippet: For immunoprecipitation assays, anti-HA-conjugated anti-horseradish peroxidase (Roche Applied Science) and anti-FLAG (Sigma-Aldrich) antibodies were used. .. Anti-RARα (Sc-20), anti-HDAC1, and anti-GAPDH antibodies were purchased from Santa Cruz Biotechnologies.

Article Title: PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response
Article Snippet: Briefly, 5 × 106 cells were crosslinked in vivo, lysed, and immediately sonicated. .. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers: VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123). .. VEGF (FWD) 5′AAAGACCCAACTCAAGTATCATCTSSAGT3′, and VEGF (REV) 5′CACTCACTGTGTGTGGCCTTAGGTTATTCAAC3′.

Article Title: BATF is required for normal expression of gut-homing receptors by T helper cells in response to retinoic acid
Article Snippet: CD4+ T cells (5 × 106 naive per sample), cultured in the presence of 100 U/ml IL-2, 1.5 µg/ml concanavalin A, and 10 nM RA for 4–5 d, were used for ChIP assays. .. DNA protein complexes were immunoprecipitated using 4 µg anti-BATF (rabbit polyclonal; Cell Signaling Technology), anti-RARα (rabbit polyclonal; Santa Cruz Biotechnology, Inc.), and anti–acetyl-histone H4 antibodies (EMD Millipore). .. Real-time PCR detection using the primers described in Table S3 was conducted with a 7500 Sequence Detection System using the SYBR green Master Mix (Applied Biosystems).

Article Title: SP1 and RARα regulate AGAP2 expression in cancer
Article Snippet: The chromatin was sheared to 100–600 bp by sonication using an AFA Focused-Ultrasonicator (S220- Series from CovarisTM ) at 6 × 60 second on-off pulses at 4 °C. .. Afterwards, crosslinked proteins of interest were immunoprecipitated with 2 μg of either anti-RARα (C-20), anti-RXRα (D-20) (both from Santa Cruz Biotechnology), anti-PCAF (C14G9, Cell Signaling), or 1 μg of anti-SP1 (D4C3, Cell Signalling). .. Anti-Pol II (N-20, Santa Cruz Biotechnology) was used as positive control and rabbit IgG (Invitrogen) as negative control.

Article Title: Ubiquitin-dependent Degradation of p73 Is Inhibited by PML
Article Snippet: Chang [The University of Texas, Houston, TX]), anti-HA (Covance), anti-GFP (CLONTECH Laboratories, Inc.), anti-Flag (M2; Sigma-Aldrich), anti-p27 (BD Biosciences), anti–Cul-2 (Zymed Laboratories), anti–acetyl-lysine (Cell Signaling), anti-PML (PG-M3), anti-Lamin A/C, anti-Bax, anti-p21, anti-p300, anti-p38, and anti-RARα (Santa Cruz Biotechnology, Inc.). .. Chang [The University of Texas, Houston, TX]), anti-HA (Covance), anti-GFP (CLONTECH Laboratories, Inc.), anti-Flag (M2; Sigma-Aldrich), anti-p27 (BD Biosciences), anti–Cul-2 (Zymed Laboratories), anti–acetyl-lysine (Cell Signaling), anti-PML (PG-M3), anti-Lamin A/C, anti-Bax, anti-p21, anti-p300, anti-p38, and anti-RARα (Santa Cruz Biotechnology, Inc.).

Construct:

Article Title: Induction of miR-21 by Retinoic Acid in Estrogen Receptor-positive Breast Carcinoma Cells
Article Snippet: Paragraph title: ChIP, Oligonucleotides, Plasmid Constructs, and Transfections ... ChIP assays ( ) were performed with anti-RARα (sc-551x), anti-ERα (sc-542x), and anti-CYP1A1 (sc-20772) irrelevant antibodies (Santa Cruz Biotechnology).

Fractionation:

Article Title: The Nuclear Transcription Factor RAR? Associates with Neuronal RNA Granules and Suppresses Translation
Article Snippet: The signals were developed with a Bright-Star BioDetect kit (Ambion) and quantified with Image J. Subcellular Fractionation —Brains from 1-month-old mice were homogenized in a lysis buffer of 10 m m Hepes, pH 7.5, 10 m m KCl, 1.5 m m MgCl2 , and a protease inhibitor mixture (Roche Applied Science). .. Equal amounts of protein from each fraction were loaded onto SDS-PAGE for Western analysis with anti-RARα (Santa Cruz, 1:750), anti-FMRP (Chemicon, 1:1000) and anti-S6 (Cell signaling, 1:1000).

End Labeling:

Article Title: Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription
Article Snippet: Oligonucleotide labeling was performed using the Biotin 3′ End Labeling Kit (Pierce Biotechnology). .. For the super shift reaction 1 µg of anti-RARα (C-20, Santa Cruz) or anti-RXR (F-1, Santa Cruz) antibodies were included to the reaction just before adding the Biotin labeled oligos ( Supplementary Table S2 ).

FACS:

Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells
Article Snippet: Paragraph title: FACS analysis, antibodies, immuno-precipitation and WB analyses ... The other anti-RARα (SC551), anti-β-actin, cEBPβ, and anti-STAT-1 antibodies were from Santa-Cruz-Biotechnology.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Santa Cruz Biotechnology anti rarα
    <t>PLZF-RARα</t> promotes cell proliferation but does not induce apoptosis. A, FACS analysis of HEK293 and HCT116 cells transfected with either a pcDNA3 or pSG5-PLZF-RARα plasmid. B , MTT assay of cell proliferation. HEK293 and HCT116 cells transfected
    Anti Rarα, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti rarα/product/Santa Cruz Biotechnology
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    anti rarα - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    PLZF-RARα promotes cell proliferation but does not induce apoptosis. A, FACS analysis of HEK293 and HCT116 cells transfected with either a pcDNA3 or pSG5-PLZF-RARα plasmid. B , MTT assay of cell proliferation. HEK293 and HCT116 cells transfected

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα promotes cell proliferation but does not induce apoptosis. A, FACS analysis of HEK293 and HCT116 cells transfected with either a pcDNA3 or pSG5-PLZF-RARα plasmid. B , MTT assay of cell proliferation. HEK293 and HCT116 cells transfected

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: FACS, Transfection, Plasmid Preparation, MTT Assay

    Transcription repression of CDKN1A by PLZF-RARα can be independent of p53. A , transcription assays. HCT116 p53 +/+ and p53 −/− cells were transiently co-transfected with a PLZF-RARα expression vector and a pGL2-CDKN1A-Luc

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: Transcription repression of CDKN1A by PLZF-RARα can be independent of p53. A , transcription assays. HCT116 p53 +/+ and p53 −/− cells were transiently co-transfected with a PLZF-RARα expression vector and a pGL2-CDKN1A-Luc

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Transfection, Expressing, Plasmid Preparation

    Hypothetical model for transcriptional regulation of CDKN1A and TP53 by PLZF-RARα and post-translational ubiquitination of p53. A , PLZF-RARα represses all four genes in the p53 pathway. ⊢, transcriptional repression; ↔,

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: Hypothetical model for transcriptional regulation of CDKN1A and TP53 by PLZF-RARα and post-translational ubiquitination of p53. A , PLZF-RARα represses all four genes in the p53 pathway. ⊢, transcriptional repression; ↔,

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques:

    PLZF-RARα stimulates cell proliferation and represses CDKN1A transcription in HL-60 cells through inhibitory histone modifications and DNA methylation. A , MTT assay of cell proliferation. HL-60 cells transfected with either pcDNA3 or pSG5-PLZF-RARα

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα stimulates cell proliferation and represses CDKN1A transcription in HL-60 cells through inhibitory histone modifications and DNA methylation. A , MTT assay of cell proliferation. HL-60 cells transfected with either pcDNA3 or pSG5-PLZF-RARα

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: DNA Methylation Assay, MTT Assay, Transfection

    PLZF-RARα represses CDKN1A gene transcription through binding competition with p53, TP53 transcriptional repression, and increased p53 ubiquitination. A , structure of the human CDKN1A gene promoter. The arrows at the p53 binding elements indicate

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses CDKN1A gene transcription through binding competition with p53, TP53 transcriptional repression, and increased p53 ubiquitination. A , structure of the human CDKN1A gene promoter. The arrows at the p53 binding elements indicate

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Binding Assay

    PLZF-RARα represses the transcription of p53 pathway genes in HEK293 cells. A, transient transcription assays for the ARF, MDM2, TP53 , and CDKN1A genes of the p53 pathway. The PLZF-RARα expression vector and promoter-luciferase fusion

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses the transcription of p53 pathway genes in HEK293 cells. A, transient transcription assays for the ARF, MDM2, TP53 , and CDKN1A genes of the p53 pathway. The PLZF-RARα expression vector and promoter-luciferase fusion

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Expressing, Plasmid Preparation, Luciferase

    PLZF-RARα represses the transcription of CDKN1A by binding to its RARE in vitro and in vivo . A , transcription assay for the CDKN1A promoter in the presence of PLZF-RARα and ATRA or EtOH control in HEK293 cells. Cells were transiently co-transfected

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses the transcription of CDKN1A by binding to its RARE in vitro and in vivo . A , transcription assay for the CDKN1A promoter in the presence of PLZF-RARα and ATRA or EtOH control in HEK293 cells. Cells were transiently co-transfected

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Binding Assay, In Vitro, In Vivo, Transfection

    Proliferation of HL-60 cells is increased by ectopic PLZF-RARα and decreased by TSA, 5-aza-2′-deoxycytidine, ATRA, or any combination thereof. Transcriptional repression of CDKN1A by PLZF-RARα is derepressed by the reagents. A–D

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: Proliferation of HL-60 cells is increased by ectopic PLZF-RARα and decreased by TSA, 5-aza-2′-deoxycytidine, ATRA, or any combination thereof. Transcriptional repression of CDKN1A by PLZF-RARα is derepressed by the reagents. A–D

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques:

    PLZF-RARα represses transcription of CDKN1A epigenetically by histone deacetylation and DNA methylation. A , structure of the human CDKN1A gene promoter. The arrows indicate the locations of the qChIP-PCR primer binding sites. B , qChIP assays showing

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses transcription of CDKN1A epigenetically by histone deacetylation and DNA methylation. A , structure of the human CDKN1A gene promoter. The arrows indicate the locations of the qChIP-PCR primer binding sites. B , qChIP assays showing

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: DNA Methylation Assay, Polymerase Chain Reaction, Binding Assay

    PLZF-RARα represses CDKN1A transcription by competing with Sp1 for binding to proximal promoter GC-boxes 3, 4, and 5/6, in vitro and in vivo . A , structure of the human CDKN1A promoter. The arrows indicate the binding positions of the qChIP oligonucleotide

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses CDKN1A transcription by competing with Sp1 for binding to proximal promoter GC-boxes 3, 4, and 5/6, in vitro and in vivo . A , structure of the human CDKN1A promoter. The arrows indicate the binding positions of the qChIP oligonucleotide

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Binding Assay, Gas Chromatography, In Vitro, In Vivo

    PLZF-RARα represses transcriptional activation of CDKN1A by p53. A , transient transcription assays. HCT116 cells were transiently co-transfected with a PLZF-RARα expression vector and a pGL2-CDKN1A-Luc (−2.3 kb) reporter plasmid,

    Journal:

    Article Title: Promyelocytic Leukemia Zinc Finger-Retinoic Acid Receptor α (PLZF-RARα), an Oncogenic Transcriptional Repressor of Cyclin-dependent Kinase Inhibitor 1A (p21WAF/CDKN1A) and Tumor Protein p53 (TP53) Genes

    doi: 10.1074/jbc.M113.538777

    Figure Lengend Snippet: PLZF-RARα represses transcriptional activation of CDKN1A by p53. A , transient transcription assays. HCT116 cells were transiently co-transfected with a PLZF-RARα expression vector and a pGL2-CDKN1A-Luc (−2.3 kb) reporter plasmid,

    Article Snippet: The degree of PLZF-RARα binding to p53RE-1, -2 and RARE, and Sp1-binding sites was analyzed by ChIP assays using an anti-PLZF, anti-RARα, and anti-HA tag antibody (Santa Cruz).

    Techniques: Activation Assay, Transfection, Expressing, Plasmid Preparation

    Dendritic cell numbers are decreased in RARα villin mice. Cell suspensions from small intestinal lamina propria were analyzed by FACS. ( a ) Analysis of single live CD45 + events from the flow cytometry data of SI lamina propria isolated form control or RARα villin mice using the t-distributed stochastic linear embedding (tSNE) algorithm (one representative analysis of two) ( b ) Representative dot plots showing total dendritic cells (left column) and subsets defined by CD103 and CD11b expression (middle column) as well as macrophages defined by CD64 (right column). ( c ) Quantification of the frequencies of dendritic cells (DCs) and the CD103 + subset. ( n = 4; 2 experiments) ( d ) Expression of CD11c in the small intestine was determined by immunohistochemistry. Representative images of 6 images/mouse (n = 3 mice). ( e ) Representative dot plot and quantification of RA-producing dendritic cells in the small intestine lamina propria determined by ALDEFLUOR (ALDE) ( n = 4; 2 experiments). * P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: Dendritic cell numbers are decreased in RARα villin mice. Cell suspensions from small intestinal lamina propria were analyzed by FACS. ( a ) Analysis of single live CD45 + events from the flow cytometry data of SI lamina propria isolated form control or RARα villin mice using the t-distributed stochastic linear embedding (tSNE) algorithm (one representative analysis of two) ( b ) Representative dot plots showing total dendritic cells (left column) and subsets defined by CD103 and CD11b expression (middle column) as well as macrophages defined by CD64 (right column). ( c ) Quantification of the frequencies of dendritic cells (DCs) and the CD103 + subset. ( n = 4; 2 experiments) ( d ) Expression of CD11c in the small intestine was determined by immunohistochemistry. Representative images of 6 images/mouse (n = 3 mice). ( e ) Representative dot plot and quantification of RA-producing dendritic cells in the small intestine lamina propria determined by ALDEFLUOR (ALDE) ( n = 4; 2 experiments). * P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Mouse Assay, FACS, Flow Cytometry, Cytometry, Isolation, Expressing, Immunohistochemistry

    RARα signaling on IECs regulates intestinal secretory cell differentiation and immunological fitness. Scheme showing the proposed model in which RARα expression in proliferating cells (transit amplifying progenitors) restrict secretory cell differentiation and Reg3g expression which is associated to proper microbiota composition and immune cell development.

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα signaling on IECs regulates intestinal secretory cell differentiation and immunological fitness. Scheme showing the proposed model in which RARα expression in proliferating cells (transit amplifying progenitors) restrict secretory cell differentiation and Reg3g expression which is associated to proper microbiota composition and immune cell development.

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Cell Differentiation, Expressing

    RARα deficiency in the epithelial compartment results in defective clearance of C. rodentium. ( a ) CFU from control and RARα villin mice infected with C. rodentium . ( n = 4; 2 experiments) ( b ). Bioluminescence of cultured stool samples (colon), spleen, and MLN cell suspensions. ( c ) Bioluminescence of whole animal. ( d ) Body weight loss curves from control and RARα villin mice infected with C. rodentium (2 x10 9 CFU). ( n = 5; 2 experiments *** P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα deficiency in the epithelial compartment results in defective clearance of C. rodentium. ( a ) CFU from control and RARα villin mice infected with C. rodentium . ( n = 4; 2 experiments) ( b ). Bioluminescence of cultured stool samples (colon), spleen, and MLN cell suspensions. ( c ) Bioluminescence of whole animal. ( d ) Body weight loss curves from control and RARα villin mice infected with C. rodentium (2 x10 9 CFU). ( n = 5; 2 experiments *** P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Mouse Assay, Infection, Cell Culture

    RARα controls epithelial homeostasis. ( a–b ) Mucins-containing goblet cells were stained with Alcian Blue and their number per villus determined. ( c–d ) Paneth cells were immunostained with anti-lysozyme and their number per villus and position along the crypt-villus axis determined ( n = 7–19 villus/mouse). ( e–f ) Enteroendocrine cells were immunostained with anti-Chromogranin A and their number per villus determined ( n = 7–12 villus/mouse). Data in ( a–b ) are representative of three mice/genotype. ** P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα controls epithelial homeostasis. ( a–b ) Mucins-containing goblet cells were stained with Alcian Blue and their number per villus determined. ( c–d ) Paneth cells were immunostained with anti-lysozyme and their number per villus and position along the crypt-villus axis determined ( n = 7–19 villus/mouse). ( e–f ) Enteroendocrine cells were immunostained with anti-Chromogranin A and their number per villus determined ( n = 7–12 villus/mouse). Data in ( a–b ) are representative of three mice/genotype. ** P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Staining, Mouse Assay

    RARα modulates differentiation within the secretory branch through KLF4. ( a ) Proliferative cells were identified by BrdU incorporation in parallel with lysozyme or muc-2 to detect paneth cells (left) and goblet cells (right), respectively. ( b–c ) KLF4 expression was measured in the distal small intestine ( b ) and colon ( c ) by immunohistochemistry and number of positive nuclei were counted per intestinal gland. 7–10 crypts were counted per intestine section in 2 mice per genotype. ( d ) RT-qPCR analysis of RAR target gene cyp26a1 and the transcription factor klf4 in zebrafish embryos treated with either vehicle or 1μM RA from 72 hours post-fertilization (hpf) till 108 hpf. Each dot represents a pool of 20 embryos. The mRNA expression was normalized to that of ef1α . ( e ) Whole-mount alcian blue staining of zebrafish embryos treated with either vehicle or 1μM RA from 72 hpf till 108 hpf (images). The graph represent quantification of alcian blue positive cells per intestine ( n =8 per group). * P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα modulates differentiation within the secretory branch through KLF4. ( a ) Proliferative cells were identified by BrdU incorporation in parallel with lysozyme or muc-2 to detect paneth cells (left) and goblet cells (right), respectively. ( b–c ) KLF4 expression was measured in the distal small intestine ( b ) and colon ( c ) by immunohistochemistry and number of positive nuclei were counted per intestinal gland. 7–10 crypts were counted per intestine section in 2 mice per genotype. ( d ) RT-qPCR analysis of RAR target gene cyp26a1 and the transcription factor klf4 in zebrafish embryos treated with either vehicle or 1μM RA from 72 hours post-fertilization (hpf) till 108 hpf. Each dot represents a pool of 20 embryos. The mRNA expression was normalized to that of ef1α . ( e ) Whole-mount alcian blue staining of zebrafish embryos treated with either vehicle or 1μM RA from 72 hpf till 108 hpf (images). The graph represent quantification of alcian blue positive cells per intestine ( n =8 per group). * P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: BrdU Incorporation Assay, Expressing, Immunohistochemistry, Mouse Assay, Quantitative RT-PCR, Staining

    Dysbiosis in RARα villin mice. ( a ) qPCR analysis from FACS-sorted epithelial cells (CD45 neg EpCAM + ) obtained from the proximal or distal small intestine of either control or RARα villin mice. Data shows transcript levels as arbitrary units (A.U.) respect to hprt ( n = 3 mice). ( b ) Fluorescence in situ hybridization of universal 16S ribosomal RNA in DAPI-stained ileal tissues from control and RARα villin mice. Original magnification, 10X. One representative image of 3–6 images/mouse ( n = 2 mice). ( c ) 16S rDNA mean intensities (sum of pixel intensities/number of pixels) are reported. Scale bar, 10 μm. ( d ) qPCR analysis shows arbitrary units (A.U.) of lactobacillus, enterobacterae (entero), bacteroides, clostridia and segmented filamentous bacteria (SFB) relative to universal 16S levels. Bacterial DNA was isolated from luminal stool obtained from the small intestine (SI) or colon ( n = 3; 2 experiments). * P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: Dysbiosis in RARα villin mice. ( a ) qPCR analysis from FACS-sorted epithelial cells (CD45 neg EpCAM + ) obtained from the proximal or distal small intestine of either control or RARα villin mice. Data shows transcript levels as arbitrary units (A.U.) respect to hprt ( n = 3 mice). ( b ) Fluorescence in situ hybridization of universal 16S ribosomal RNA in DAPI-stained ileal tissues from control and RARα villin mice. Original magnification, 10X. One representative image of 3–6 images/mouse ( n = 2 mice). ( c ) 16S rDNA mean intensities (sum of pixel intensities/number of pixels) are reported. Scale bar, 10 μm. ( d ) qPCR analysis shows arbitrary units (A.U.) of lactobacillus, enterobacterae (entero), bacteroides, clostridia and segmented filamentous bacteria (SFB) relative to universal 16S levels. Bacterial DNA was isolated from luminal stool obtained from the small intestine (SI) or colon ( n = 3; 2 experiments). * P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Mouse Assay, Real-time Polymerase Chain Reaction, FACS, Fluorescence, In Situ Hybridization, Staining, Isolation

    RARα deficiency results in altered intestinal immune development. ( a ) Expression of CD3 in the small intestine was determined by immunohistochemistry. Representative image of 6 images/mouse (n = 3 mice). ( b–c ) Representative dot plots showing total CD90 + cells ( b ) and T cells and ILCs within the CD90 + compartment (c) ( n = 3–4; 2 experiments). ( d ) Colon Swiss rolls showing immunohistochemistry for B220 in control and RARα villin mice. Data are representative of three mice/genotype. ( e ) Colon cell suspension staining for B220 and CD11c reveals decreased B cells in RARα villin mice ( n = 3; 2 experiments). * P

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα deficiency results in altered intestinal immune development. ( a ) Expression of CD3 in the small intestine was determined by immunohistochemistry. Representative image of 6 images/mouse (n = 3 mice). ( b–c ) Representative dot plots showing total CD90 + cells ( b ) and T cells and ILCs within the CD90 + compartment (c) ( n = 3–4; 2 experiments). ( d ) Colon Swiss rolls showing immunohistochemistry for B220 in control and RARα villin mice. Data are representative of three mice/genotype. ( e ) Colon cell suspension staining for B220 and CD11c reveals decreased B cells in RARα villin mice ( n = 3; 2 experiments). * P

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Expressing, Immunohistochemistry, Mouse Assay, Staining

    RARα expression in intestinal epithelial cells from the small intestine and colon. ( a–b ) Frozen sections from the proximal, medial and distal small intestine ( a ) and proximal and distal colon ( b ) were stainied for RARα. Onsets show a digital magnification of the crypt within the respective boxes. ( c ) Cartoon showing the RARα expression pattern through the crypt-villi axis (Small intestine) or crypt (colon). One representative figure out of three experiments. ( d ) H E staining of distal small intestine sections of control and RARα villin mice. One representative figure out of three experiments. TA: transit amplifying. Scale bars 100uM

    Journal: Mucosal immunology

    Article Title: Intestinal epithelial cell-specific RARα depletion results in aberrant epithelial cell homeostasis and underdeveloped immune system

    doi: 10.1038/mi.2017.91

    Figure Lengend Snippet: RARα expression in intestinal epithelial cells from the small intestine and colon. ( a–b ) Frozen sections from the proximal, medial and distal small intestine ( a ) and proximal and distal colon ( b ) were stainied for RARα. Onsets show a digital magnification of the crypt within the respective boxes. ( c ) Cartoon showing the RARα expression pattern through the crypt-villi axis (Small intestine) or crypt (colon). One representative figure out of three experiments. ( d ) H E staining of distal small intestine sections of control and RARα villin mice. One representative figure out of three experiments. TA: transit amplifying. Scale bars 100uM

    Article Snippet: Anti-chromogranin A (Abcam ab15160, 1:3000), anti-RARα (Santa Cruz biotechnologies, 1:500), anti-Cre-recombinase (Abcam, 1:125), anti-cleaved caspase 3 (Cell signaling technologies, 1:400), anti-OLFM4 (Cell signaling technologies, 1:400), anti KLF4 (R & D Systems, 1:200) and anti-Ki67 (Biolegend, 16A8, 1:50) antibodies were used for immunohistochemistry.

    Techniques: Expressing, Staining, Mouse Assay

    Effect of SSi on the biology of X-RARα-, γ-catenin- and constitutively active β-catenin-expressing murine HSCs. ( A ) Experimental strategy. Sca1 + /lin - BM cells were infected with the indicated retroviruses and plated in semi-solid medium with the indicated growth factors to determine the serial plating potential in the presence of either 100 µM SSi or 0.02% DMSO. ( B ) Long-term serial replating (I–VII) of HSC and X-RARα-positive HSC. SSi withdrawal after plating round V for PML/RARα-positive colonies and after plating round VI for PLZF/RARα-positive colonies. ( C ) Colony morphology of plating rounds I, III, VI, and VII as well as SSi withdrawal. ( D ) Long-term serial replating (I–V) of γ-catenin- and β-catenin-S33A-positive HSC. Data are expressed as the mean of three independent experiments with SD. Control - empty vector; ↓-SSi withdrawal; I–VII: serial plating rounds.

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Effect of SSi on the biology of X-RARα-, γ-catenin- and constitutively active β-catenin-expressing murine HSCs. ( A ) Experimental strategy. Sca1 + /lin - BM cells were infected with the indicated retroviruses and plated in semi-solid medium with the indicated growth factors to determine the serial plating potential in the presence of either 100 µM SSi or 0.02% DMSO. ( B ) Long-term serial replating (I–VII) of HSC and X-RARα-positive HSC. SSi withdrawal after plating round V for PML/RARα-positive colonies and after plating round VI for PLZF/RARα-positive colonies. ( C ) Colony morphology of plating rounds I, III, VI, and VII as well as SSi withdrawal. ( D ) Long-term serial replating (I–V) of γ-catenin- and β-catenin-S33A-positive HSC. Data are expressed as the mean of three independent experiments with SD. Control - empty vector; ↓-SSi withdrawal; I–VII: serial plating rounds.

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Expressing, Infection, Plasmid Preparation

    Effect of SSi on the X-RARα-induced phenotype in murine HSCs. ( A ) Experimental strategy. Sca1+/lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. ( B ) Differentiation was assessed by the expression of Gr-1, Mac-1, c-Kit and Sca1. ( C ) Schematic representation of the proliferation competition assay (PCA). ( D ) GFP expression in X-RARα-positive HPCs assessed by FACS analysis in the presence/absence of SSi at day 2, 4, and 7. One representative result from three independent experiments is shown.

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Effect of SSi on the X-RARα-induced phenotype in murine HSCs. ( A ) Experimental strategy. Sca1+/lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. ( B ) Differentiation was assessed by the expression of Gr-1, Mac-1, c-Kit and Sca1. ( C ) Schematic representation of the proliferation competition assay (PCA). ( D ) GFP expression in X-RARα-positive HPCs assessed by FACS analysis in the presence/absence of SSi at day 2, 4, and 7. One representative result from three independent experiments is shown.

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Infection, Expressing, Competitive Binding Assay, FACS

    Effect of SSi on PML/RARα-mediated aberrant long-term stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the LT-HSC capacity of PML/RARα-expressing HSCs. Sca1 + /lin - BM cells from CD45.1 + mice were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. The cells were co-transplanted with CD45.2 + BM cells into lethally (11 Gy) irradiated CD45.2 + recipient mice. ( B ) Donor chimerism 8 months after transplantation was used to determine LT-HSC capacity in the BM and spleen. Statistical significance was determined using the Log-rank (Mantel-Cox) test (*

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Effect of SSi on PML/RARα-mediated aberrant long-term stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the LT-HSC capacity of PML/RARα-expressing HSCs. Sca1 + /lin - BM cells from CD45.1 + mice were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. The cells were co-transplanted with CD45.2 + BM cells into lethally (11 Gy) irradiated CD45.2 + recipient mice. ( B ) Donor chimerism 8 months after transplantation was used to determine LT-HSC capacity in the BM and spleen. Statistical significance was determined using the Log-rank (Mantel-Cox) test (*

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Expressing, Mouse Assay, Infection, Irradiation, Transplantation Assay

    Induction of apoptosis in patient-derived NB4 cells by Sulindac derivatives. Rate of apoptosis in patient-derived PML/RARα-positive NB4 cells was assessed by 7AAD staining upon exposure to clinically achievable concentrations (50–150 µM) of SSi and SSo. Apoptosis was measured after 72 h. Data are expressed as the mean of three independent experiments with standard deviation (SD). Statistical analysis was performed using Student's t -test (* - p

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Induction of apoptosis in patient-derived NB4 cells by Sulindac derivatives. Rate of apoptosis in patient-derived PML/RARα-positive NB4 cells was assessed by 7AAD staining upon exposure to clinically achievable concentrations (50–150 µM) of SSi and SSo. Apoptosis was measured after 72 h. Data are expressed as the mean of three independent experiments with standard deviation (SD). Statistical analysis was performed using Student's t -test (* - p

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Derivative Assay, Staining, Standard Deviation

    Effect of SSi on PML/RARα-mediated Wnt signaling pathway activation. ( A ) Transactivation assay for Wnt-signaling-related TCF/LEF-dependent transcription. Indicated expression vectors were co-transfected with either Topflash (OT) or Fopflash (OF) (the pGL3-OT promoter contains three TCF/LEF binding sites, whereas pGL3-OF contains mutated inactive binding sites and is a negative control) reporter constructs into 293 cells and exposed them to either 100 µM SSi or 0.02% DMSO. After 48 h, luciferase activity was measured and normalized to co-transfected Renilla activity. ( B ) Western blots for the expression of PML/RARα and S33A using the indicated antibodies, α-β-actin-loading control. ( C ) Effects of SSi on Wnt target genes in X-RARα-positive Sca1 + /lin - HPCs. Results are represented as 2 -ΔΔCT values. Each experiment was performed three times in triplicate, with similar results obtained each time. One representative experiment with SD is shown.

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Effect of SSi on PML/RARα-mediated Wnt signaling pathway activation. ( A ) Transactivation assay for Wnt-signaling-related TCF/LEF-dependent transcription. Indicated expression vectors were co-transfected with either Topflash (OT) or Fopflash (OF) (the pGL3-OT promoter contains three TCF/LEF binding sites, whereas pGL3-OF contains mutated inactive binding sites and is a negative control) reporter constructs into 293 cells and exposed them to either 100 µM SSi or 0.02% DMSO. After 48 h, luciferase activity was measured and normalized to co-transfected Renilla activity. ( B ) Western blots for the expression of PML/RARα and S33A using the indicated antibodies, α-β-actin-loading control. ( C ) Effects of SSi on Wnt target genes in X-RARα-positive Sca1 + /lin - HPCs. Results are represented as 2 -ΔΔCT values. Each experiment was performed three times in triplicate, with similar results obtained each time. One representative experiment with SD is shown.

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Activation Assay, Transactivation Assay, Expressing, Transfection, Binding Assay, Negative Control, Construct, Luciferase, Activity Assay, Western Blot

    The effect of Sulindac derivatives on the expression of β-catenin and γ-catenin in PML/RARα-positive leukemic cells. Protein expression of active β-catenin, total β-catenin, γ-catenin and PML/RARα was assessed by western blot analysis with the indicated antibodies. ( A ) Patient-derived PML/RARα-positive NB4 cells treated with SSo (200 µM), SSi (200 µM) or 0.02% DMSO at 24 h and 48 h. ( B ) PML/RARα-expressing KG-1 cells treated at the cell type-specific IC 50 (100 µM - SSi, 360 µM - SSo and 0.02% DMSO) at 72 h. Control - empty-vector-transfected cells; α-α-tubulin-loading control. ( C – D ) protein quantification of western blots presented in panel A and B, the bars represent the band intensity relative to the intensity of the tubulin bands reveled with a S-800 Densitometer and the Quantity One software (Bio-Rad).

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: The effect of Sulindac derivatives on the expression of β-catenin and γ-catenin in PML/RARα-positive leukemic cells. Protein expression of active β-catenin, total β-catenin, γ-catenin and PML/RARα was assessed by western blot analysis with the indicated antibodies. ( A ) Patient-derived PML/RARα-positive NB4 cells treated with SSo (200 µM), SSi (200 µM) or 0.02% DMSO at 24 h and 48 h. ( B ) PML/RARα-expressing KG-1 cells treated at the cell type-specific IC 50 (100 µM - SSi, 360 µM - SSo and 0.02% DMSO) at 72 h. Control - empty-vector-transfected cells; α-α-tubulin-loading control. ( C – D ) protein quantification of western blots presented in panel A and B, the bars represent the band intensity relative to the intensity of the tubulin bands reveled with a S-800 Densitometer and the Quantity One software (Bio-Rad).

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Expressing, Western Blot, Derivative Assay, Plasmid Preparation, Transfection, Software

    Effect of SSi on X-RARα-mediated aberrant stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the ST-HSC capacity of X-RARα-expressing HSCs (CFU-S12). Sca1 + /lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. Cells were inoculated into lethally irradiated (11Gy) recipients that were then sacrificed at day 12 after transplantation. ( B ) Photographs of all the fixed spleen are shown, the arrows indicate an example of a CFU in the fixed spleens. ( C ) Bulks represent the number of CFU-S12 expressed as the mean from three spleens with SD. Statistical analysis was performed using Student's t -test (* - p

    Journal: PLoS ONE

    Article Title: Sulindac Sulfide Reverses Aberrant Self-Renewal of Progenitor Cells Induced by the AML-Associated Fusion Proteins PML/RAR? and PLZF/RAR?

    doi: 10.1371/journal.pone.0022540

    Figure Lengend Snippet: Effect of SSi on X-RARα-mediated aberrant stem cell capacity in murine HSC. ( A ) Experimental strategy for studying the ST-HSC capacity of X-RARα-expressing HSCs (CFU-S12). Sca1 + /lin - BM cells were infected with the indicated retroviruses and maintained for one week in liquid culture with the indicated growth factors in the presence/absence of 40 µM SSi. Cells were inoculated into lethally irradiated (11Gy) recipients that were then sacrificed at day 12 after transplantation. ( B ) Photographs of all the fixed spleen are shown, the arrows indicate an example of a CFU in the fixed spleens. ( C ) Bulks represent the number of CFU-S12 expressed as the mean from three spleens with SD. Statistical analysis was performed using Student's t -test (* - p

    Article Snippet: The antibodies used were the following: anti-RARα, anti-γ-catenin (Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-catenin (Cell Signaling, Frankfurt, Germany), anti-active β-catenin (Upstate, Charlottesville, VA, USA), anti-α-tubulin (NeoMarkers, Freemont, CA, USA), and anti-β-actin (Abcam, Cambridge, UK).

    Techniques: Expressing, Infection, Irradiation, Transplantation Assay