anti egfr  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    anti EGFR
    Description:

    Catalog Number:
    PA5-14616
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher anti egfr
    Untagged Endogenous RAS Proteins Are Degraded with HaloPROTAC-E in Cells Expressing FLAG-Halo-aHRAS (A) Schematic representation of FLAG-Halo-aHRAS HaloPROTAC L-AdPROM system. (B) A549 FLAG-empty, FLAG-aHRAS, and FLAG-Halo-aHRAS-expressing cells were lysed and subjected to IP with anti-FLAG M2 resin. F.T., post-IP flow-through extract. (C) A549 FLAG-Halo-aHRAS-expressing cells were treated with increasing concentrations of HaloPROTAC-E (0–10 μM) for 24 h. (D) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0–48 h). (E) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E and 20 μM proteasome inhibitor MG132 for 24 h. (F) A549 FLAG-aHRAS and FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0, 3, 6, and 24 h). For (B–F), extracts and IPs were resolved by SDS-PAGE and transferred on to PVDF membranes, which were subjected to immunoblotting with indicated antibodies. (G–K) Quantification from (F) of relative (G) panRAS normalized to GAPDH protein levels (n = 6 ± SD), (H) BRAF normalized to GAPDH protein levels (n = 3 ± SD), (I) <t>p-Y1068</t> <t>EGFR</t> normalized to total EGFR protein levels (n = 6 ± SD), (J) p-T202/Y204 ERK1/2 normalized to total ERK1/2 protein levels (n = 6 ± SD), and (K) p-S473 Akt normalized to total Akt protein levels (n = 6 ± SD) in the absence or presence of HaloPROTAC-E (500 nM, 24 h). Statistical analyses were carried out by one-way analysis of variance using Tukey's post-test.

    https://www.bioz.com/result/anti egfr/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti egfr - by Bioz Stars, 2021-05
    94/100 stars

    Images

    1) Product Images from "Inducible Degradation of Target Proteins through a Tractable Affinity-Directed Protein Missile System"

    Article Title: Inducible Degradation of Target Proteins through a Tractable Affinity-Directed Protein Missile System

    Journal: Cell Chemical Biology

    doi: 10.1016/j.chembiol.2020.06.013

    Untagged Endogenous RAS Proteins Are Degraded with HaloPROTAC-E in Cells Expressing FLAG-Halo-aHRAS (A) Schematic representation of FLAG-Halo-aHRAS HaloPROTAC L-AdPROM system. (B) A549 FLAG-empty, FLAG-aHRAS, and FLAG-Halo-aHRAS-expressing cells were lysed and subjected to IP with anti-FLAG M2 resin. F.T., post-IP flow-through extract. (C) A549 FLAG-Halo-aHRAS-expressing cells were treated with increasing concentrations of HaloPROTAC-E (0–10 μM) for 24 h. (D) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0–48 h). (E) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E and 20 μM proteasome inhibitor MG132 for 24 h. (F) A549 FLAG-aHRAS and FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0, 3, 6, and 24 h). For (B–F), extracts and IPs were resolved by SDS-PAGE and transferred on to PVDF membranes, which were subjected to immunoblotting with indicated antibodies. (G–K) Quantification from (F) of relative (G) panRAS normalized to GAPDH protein levels (n = 6 ± SD), (H) BRAF normalized to GAPDH protein levels (n = 3 ± SD), (I) p-Y1068 EGFR normalized to total EGFR protein levels (n = 6 ± SD), (J) p-T202/Y204 ERK1/2 normalized to total ERK1/2 protein levels (n = 6 ± SD), and (K) p-S473 Akt normalized to total Akt protein levels (n = 6 ± SD) in the absence or presence of HaloPROTAC-E (500 nM, 24 h). Statistical analyses were carried out by one-way analysis of variance using Tukey's post-test.
    Figure Legend Snippet: Untagged Endogenous RAS Proteins Are Degraded with HaloPROTAC-E in Cells Expressing FLAG-Halo-aHRAS (A) Schematic representation of FLAG-Halo-aHRAS HaloPROTAC L-AdPROM system. (B) A549 FLAG-empty, FLAG-aHRAS, and FLAG-Halo-aHRAS-expressing cells were lysed and subjected to IP with anti-FLAG M2 resin. F.T., post-IP flow-through extract. (C) A549 FLAG-Halo-aHRAS-expressing cells were treated with increasing concentrations of HaloPROTAC-E (0–10 μM) for 24 h. (D) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0–48 h). (E) A549 FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E and 20 μM proteasome inhibitor MG132 for 24 h. (F) A549 FLAG-aHRAS and FLAG-Halo-aHRAS-expressing cells were treated with 500 nM HaloPROTAC-E for indicated times (0, 3, 6, and 24 h). For (B–F), extracts and IPs were resolved by SDS-PAGE and transferred on to PVDF membranes, which were subjected to immunoblotting with indicated antibodies. (G–K) Quantification from (F) of relative (G) panRAS normalized to GAPDH protein levels (n = 6 ± SD), (H) BRAF normalized to GAPDH protein levels (n = 3 ± SD), (I) p-Y1068 EGFR normalized to total EGFR protein levels (n = 6 ± SD), (J) p-T202/Y204 ERK1/2 normalized to total ERK1/2 protein levels (n = 6 ± SD), and (K) p-S473 Akt normalized to total Akt protein levels (n = 6 ± SD) in the absence or presence of HaloPROTAC-E (500 nM, 24 h). Statistical analyses were carried out by one-way analysis of variance using Tukey's post-test.

    Techniques Used: Expressing, SDS Page

    2) Product Images from "A dedicated microarray for in-depth analysis of pre-mRNA splicing events: application to the study of genes involved in the response to targeted anticancer therapies"

    Article Title: A dedicated microarray for in-depth analysis of pre-mRNA splicing events: application to the study of genes involved in the response to targeted anticancer therapies

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-13-9

    Western blot analysis of HER1/EGFR expression. HER1/EGFR and P-HER1/EGFR (Tyr1068) protein levels were analyzed in H358/Tet-On/SRSF2 inducible H358 clone by western blotting. Tubulin was used as a loading control.
    Figure Legend Snippet: Western blot analysis of HER1/EGFR expression. HER1/EGFR and P-HER1/EGFR (Tyr1068) protein levels were analyzed in H358/Tet-On/SRSF2 inducible H358 clone by western blotting. Tubulin was used as a loading control.

    Techniques Used: Western Blot, Expressing

    Alternative splicing events induced by SRSF2 over-expression in H358 lung adenocarcinoma cells. The AKT3 -derived mRNAs in the exon 6–9 region, the HIF1A -derived mRNAs in the exon 8–11 region, and the various last exons for HER1/EGFR and VEGFA are depicted. The arrows show the position of the primers designed and used for validation of the splicing events detected by the 15 k custom gene chip.
    Figure Legend Snippet: Alternative splicing events induced by SRSF2 over-expression in H358 lung adenocarcinoma cells. The AKT3 -derived mRNAs in the exon 6–9 region, the HIF1A -derived mRNAs in the exon 8–11 region, and the various last exons for HER1/EGFR and VEGFA are depicted. The arrows show the position of the primers designed and used for validation of the splicing events detected by the 15 k custom gene chip.

    Techniques Used: Over Expression, Derivative Assay, Chromatin Immunoprecipitation

    3) Product Images from "Epigallocatechin-3-gallate and 6-OH-11-O-Hydroxyphenanthrene Limit BE(2)-C Neuroblastoma Cell Growth and Neurosphere Formation In Vitro"

    Article Title: Epigallocatechin-3-gallate and 6-OH-11-O-Hydroxyphenanthrene Limit BE(2)-C Neuroblastoma Cell Growth and Neurosphere Formation In Vitro

    Journal: Nutrients

    doi: 10.3390/nu10091141

    Downregulation of EGFR and p1068EGFR expression by EGCG and IIF treatments in BE(2)-C neuroblastoma cells. Cells were treated with 20 μg/mL EGCG and 10 μM IIF, individually and in combination for 24 h. ( A ) Proteins (50 μg) from total cell lysate were subjected to SDS–PAGE and Western blot analysis of EGFR and p1068EGFR expression after 24 h treatments. Actin was used as a loading control. RT-PCR analysis of EGFR ( B ) and NDRG1 ( C ) in control and treated cells. β-actin was used as a control. The values were normalized to the untreated controls. The results are expressed as the average ± SE of three independent experiments. * p
    Figure Legend Snippet: Downregulation of EGFR and p1068EGFR expression by EGCG and IIF treatments in BE(2)-C neuroblastoma cells. Cells were treated with 20 μg/mL EGCG and 10 μM IIF, individually and in combination for 24 h. ( A ) Proteins (50 μg) from total cell lysate were subjected to SDS–PAGE and Western blot analysis of EGFR and p1068EGFR expression after 24 h treatments. Actin was used as a loading control. RT-PCR analysis of EGFR ( B ) and NDRG1 ( C ) in control and treated cells. β-actin was used as a control. The values were normalized to the untreated controls. The results are expressed as the average ± SE of three independent experiments. * p

    Techniques Used: Expressing, SDS Page, Western Blot, Reverse Transcription Polymerase Chain Reaction

    4) Product Images from "Epigallocatechin-3-gallate and 6-OH-11-O-Hydroxyphenanthrene Limit BE(2)-C Neuroblastoma Cell Growth and Neurosphere Formation In Vitro"

    Article Title: Epigallocatechin-3-gallate and 6-OH-11-O-Hydroxyphenanthrene Limit BE(2)-C Neuroblastoma Cell Growth and Neurosphere Formation In Vitro

    Journal: Nutrients

    doi: 10.3390/nu10091141

    Downregulation of EGFR and p1068EGFR expression by EGCG and IIF treatments in BE(2)-C neuroblastoma cells. Cells were treated with 20 μg/mL EGCG and 10 μM IIF, individually and in combination for 24 h. ( A ) Proteins (50 μg) from total cell lysate were subjected to SDS–PAGE and Western blot analysis of EGFR and p1068EGFR expression after 24 h treatments. Actin was used as a loading control. RT-PCR analysis of EGFR ( B ) and NDRG1 ( C ) in control and treated cells. β-actin was used as a control. The values were normalized to the untreated controls. The results are expressed as the average ± SE of three independent experiments. * p
    Figure Legend Snippet: Downregulation of EGFR and p1068EGFR expression by EGCG and IIF treatments in BE(2)-C neuroblastoma cells. Cells were treated with 20 μg/mL EGCG and 10 μM IIF, individually and in combination for 24 h. ( A ) Proteins (50 μg) from total cell lysate were subjected to SDS–PAGE and Western blot analysis of EGFR and p1068EGFR expression after 24 h treatments. Actin was used as a loading control. RT-PCR analysis of EGFR ( B ) and NDRG1 ( C ) in control and treated cells. β-actin was used as a control. The values were normalized to the untreated controls. The results are expressed as the average ± SE of three independent experiments. * p

    Techniques Used: Expressing, SDS Page, Western Blot, Reverse Transcription Polymerase Chain Reaction

    5) Product Images from "Occludin is regulated by epidermal growth factor receptor activation in brain endothelial cells and brains of mice with acute liver failure"

    Article Title: Occludin is regulated by epidermal growth factor receptor activation in brain endothelial cells and brains of mice with acute liver failure

    Journal: Hepatology (Baltimore, Md.)

    doi: 10.1002/hep.24161

    EGFR activation in bEnd3 cells that were treated with human recombinant MMP-9 (100 ng/ml for 6 hours) in the presence or absence of the MMP-9 inhibitor GM6001 (100nM). (A) Cell lysates were immunoprecipitated with anti-EGFR antibody and analyzed by immunoblotting with anti-p-TyrEGFR and anti-EGFR antibodies. (B) Densitometric analysis of the p-TyrEGFR, ** P
    Figure Legend Snippet: EGFR activation in bEnd3 cells that were treated with human recombinant MMP-9 (100 ng/ml for 6 hours) in the presence or absence of the MMP-9 inhibitor GM6001 (100nM). (A) Cell lysates were immunoprecipitated with anti-EGFR antibody and analyzed by immunoblotting with anti-p-TyrEGFR and anti-EGFR antibodies. (B) Densitometric analysis of the p-TyrEGFR, ** P

    Techniques Used: Activation Assay, Recombinant, Immunoprecipitation

    6) Product Images from "LncRNA-TUSC7/miR-224 affected chemotherapy resistance of esophageal squamous cell carcinoma by competitively regulating DESC1"

    Article Title: LncRNA-TUSC7/miR-224 affected chemotherapy resistance of esophageal squamous cell carcinoma by competitively regulating DESC1

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-018-0724-4

    miR-224 targetedly regulated DESC1 expression. a predicted there was potential binding site between miR-224 and 3’UTR of DESC1. b Luciferase reporter gene vector containing DESC1 3’UTR WT or DESC1 3’UTR MUT, miR-224 mimic or pre-NC or miR-224 inhibitor or NC were co-transfected into HEK293T cells. Dual-luciferase reporter gene assay showed that miR-224 mimic or miR-224 inhibitor decreased or increased the activity of DESC1 WT, and did not significantly change the activity of DESC1 MUT. c-e EC9706 or KYSE30 cells were transfected with miR-224 mimic or miR-224 inhibitor or controls. qRT-PCR and Western blot showed that miR-224 mimic or miR-224 inhibitor significantly decreased or increased mRNA level ( c ) and protein level ( d ) of DESC1, and increased or decreased protein level of EGFR and p-AKT ( e ). f mRNA level of DESC1 was downregulated in ESCC tissues
    Figure Legend Snippet: miR-224 targetedly regulated DESC1 expression. a predicted there was potential binding site between miR-224 and 3’UTR of DESC1. b Luciferase reporter gene vector containing DESC1 3’UTR WT or DESC1 3’UTR MUT, miR-224 mimic or pre-NC or miR-224 inhibitor or NC were co-transfected into HEK293T cells. Dual-luciferase reporter gene assay showed that miR-224 mimic or miR-224 inhibitor decreased or increased the activity of DESC1 WT, and did not significantly change the activity of DESC1 MUT. c-e EC9706 or KYSE30 cells were transfected with miR-224 mimic or miR-224 inhibitor or controls. qRT-PCR and Western blot showed that miR-224 mimic or miR-224 inhibitor significantly decreased or increased mRNA level ( c ) and protein level ( d ) of DESC1, and increased or decreased protein level of EGFR and p-AKT ( e ). f mRNA level of DESC1 was downregulated in ESCC tissues

    Techniques Used: Expressing, Binding Assay, Luciferase, Plasmid Preparation, Transfection, Reporter Gene Assay, Activity Assay, Quantitative RT-PCR, Western Blot

    TUSC7 inhibited cell proliferation and chemotherapy resistance via miR-224/DESC1. EC9706 or KYSE30 cells were divided into four groups: pcDNA, pcDNA-TUSC7, pcDNA-TUSC7 + NC, and pcDNA-TUSC7 + miR-224 mimic groups. a MTT assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on cell proliferation. b Colony formation assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on colony formation. c Flow cytometry showed that miR-224 mimic reversed the promotion effect of pcDNA-TUSC7 on cell apoptosis. d After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. e After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. f pcDNA-TUSC7 increased protein level of DESC1 and decreased the expression of EGFR and p-AKT, while miR-224 mimic reversed these effects
    Figure Legend Snippet: TUSC7 inhibited cell proliferation and chemotherapy resistance via miR-224/DESC1. EC9706 or KYSE30 cells were divided into four groups: pcDNA, pcDNA-TUSC7, pcDNA-TUSC7 + NC, and pcDNA-TUSC7 + miR-224 mimic groups. a MTT assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on cell proliferation. b Colony formation assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on colony formation. c Flow cytometry showed that miR-224 mimic reversed the promotion effect of pcDNA-TUSC7 on cell apoptosis. d After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. e After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. f pcDNA-TUSC7 increased protein level of DESC1 and decreased the expression of EGFR and p-AKT, while miR-224 mimic reversed these effects

    Techniques Used: MTT Assay, Inhibition, Colony Assay, Flow Cytometry, Cytometry, Expressing

    DESC1 inhibited chemotherapy resistance of ESCC cells via EGFR/AKT. EC9706 or KYSE30 cells were divided into four groups: si-NC, si-DESC1, si- DESC1 + DMSO, and si-DESC1 + AST1306 (EGFR inhibitor, 1 μM,24 h) groups. a After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. b After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. c si-DESC1 upregulated the expressions of EGFR and p-AKT, while AST1306 reversed this effect
    Figure Legend Snippet: DESC1 inhibited chemotherapy resistance of ESCC cells via EGFR/AKT. EC9706 or KYSE30 cells were divided into four groups: si-NC, si-DESC1, si- DESC1 + DMSO, and si-DESC1 + AST1306 (EGFR inhibitor, 1 μM,24 h) groups. a After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. b After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. c si-DESC1 upregulated the expressions of EGFR and p-AKT, while AST1306 reversed this effect

    Techniques Used:

    7) Product Images from "Interleukin-13 receptor alpha 2 cooperates with EGFRvIII signaling to promote glioblastoma multiforme"

    Article Title: Interleukin-13 receptor alpha 2 cooperates with EGFRvIII signaling to promote glioblastoma multiforme

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01392-9

    Deletion of the cytoplasmic domain of IL-13Rα2 resulted in a loss of physical interaction with EGFRvIII and enhanced proliferation is abolished. a Whole-cell lysates prepared from stable cell line Gli36.IL-13Rα2/EGFRvIII cells were used for immunoprecipitation with anti-IL-13Rα2 antibody, then immunoprobed with an anti-EGFR antibody. IgG served as control while unprecipitated extracts serve as input. b Similar cell lysates were reverse immunoprecipitated with anti-EGFR antibody, then immunoprobed with an anti-IL13Rα2antibody. Lysates from Gli36.EGFRvIII served as additional control c Gli36.IL-13Rα2/EGFRvIII cell lysates were immunoprecipitated with anti-EGFR antibody, then immunoprobed with anti-Grb antibody. To further examine the domains of interaction, IL-13Rα2 and EGFR mutants were used. Gli36.EGFRvIII cells were first transfected with pIRESneo2 (Vector), IL-13Rα2 full length (Wild-type) and IL-13Rα2 Cyt tail deleted constructs (Mutant) and then analyzed by d cell proliferation assay at the indicated time points, f co-immunoprecipitation, and h PLA assays. Findings were validated using Gli36.IL-13Rα2 cells transiently transfected with vector (CTRL), full length/wild-type EGFRvIII, DK, and DY3 mutants. e proliferation outputs, g co-immunoprecipitation, i and PLA assay were performed. j represent the corresponding positive and negative controls
    Figure Legend Snippet: Deletion of the cytoplasmic domain of IL-13Rα2 resulted in a loss of physical interaction with EGFRvIII and enhanced proliferation is abolished. a Whole-cell lysates prepared from stable cell line Gli36.IL-13Rα2/EGFRvIII cells were used for immunoprecipitation with anti-IL-13Rα2 antibody, then immunoprobed with an anti-EGFR antibody. IgG served as control while unprecipitated extracts serve as input. b Similar cell lysates were reverse immunoprecipitated with anti-EGFR antibody, then immunoprobed with an anti-IL13Rα2antibody. Lysates from Gli36.EGFRvIII served as additional control c Gli36.IL-13Rα2/EGFRvIII cell lysates were immunoprecipitated with anti-EGFR antibody, then immunoprobed with anti-Grb antibody. To further examine the domains of interaction, IL-13Rα2 and EGFR mutants were used. Gli36.EGFRvIII cells were first transfected with pIRESneo2 (Vector), IL-13Rα2 full length (Wild-type) and IL-13Rα2 Cyt tail deleted constructs (Mutant) and then analyzed by d cell proliferation assay at the indicated time points, f co-immunoprecipitation, and h PLA assays. Findings were validated using Gli36.IL-13Rα2 cells transiently transfected with vector (CTRL), full length/wild-type EGFRvIII, DK, and DY3 mutants. e proliferation outputs, g co-immunoprecipitation, i and PLA assay were performed. j represent the corresponding positive and negative controls

    Techniques Used: Stable Transfection, Immunoprecipitation, Transfection, Plasmid Preparation, Construct, Mutagenesis, Proliferation Assay, Proximity Ligation Assay

    Enhanced cellular proliferation mediated by IL-13Rα2 is specific to EGFRvIII, and not WT EGFR. a U251-E6 or c U251-E18 cells were treated with or without tetracycline (Tet). At indicated time points, immunoblot analysis was carried out. Gli36, Gli36.EGFRvIII cell lysates were included as negative or positive controls for EGFRvIII, respectively. Growth kinetics of b U251-E6 and d U251-E18 was determined by CCK-8 assay. Percent cell viability was normalized to day 1 (without induction). All data are represented as mean ± SEM. Unpaired t -test *** p
    Figure Legend Snippet: Enhanced cellular proliferation mediated by IL-13Rα2 is specific to EGFRvIII, and not WT EGFR. a U251-E6 or c U251-E18 cells were treated with or without tetracycline (Tet). At indicated time points, immunoblot analysis was carried out. Gli36, Gli36.EGFRvIII cell lysates were included as negative or positive controls for EGFRvIII, respectively. Growth kinetics of b U251-E6 and d U251-E18 was determined by CCK-8 assay. Percent cell viability was normalized to day 1 (without induction). All data are represented as mean ± SEM. Unpaired t -test *** p

    Techniques Used: CCK-8 Assay

    IL-13Rα2 mediate greater tumorigenic potential with EGFRvIII, and not WT EGFR. a Tumor volume b and tumor weight of tetracycline regulatable U251 gliomas (U251-E6 and U251-E18 was examined in vivo. Bars depict the mean values and error bars represent 95% confidence intervals. P -values were calculated using ANOVA with Tukey’s multiple comparison test * p
    Figure Legend Snippet: IL-13Rα2 mediate greater tumorigenic potential with EGFRvIII, and not WT EGFR. a Tumor volume b and tumor weight of tetracycline regulatable U251 gliomas (U251-E6 and U251-E18 was examined in vivo. Bars depict the mean values and error bars represent 95% confidence intervals. P -values were calculated using ANOVA with Tukey’s multiple comparison test * p

    Techniques Used: In Vivo

    GBM patients co-expressing EGFR and IL-13Rα2 correlate to poor survival where the overexpression of IL-13Rα2 alone leads to enhance cell migration but not proliferation. Kaplan−Meier survival analysis of a all gliomas patients; b GBM patients from REMBRANDT database from National Cancer Institute (USA). Patients overexpressing EGFR mRNA by 2-fold (blue) with high (red), intermediate (yellow) and low (green) levels of IL-13Rα2 expression were shown. The log-rank p -values were indicated. c Kaplan−Meier survival plots for patients expressing high YKL-40 mRNA levels TCGA. High IL-13Rα2 expression group (red) and low IL-13Rα2 expression group (blue) were determined by aggregating all patients whose z -score normalized expression was above or below 0, respectively (Log-rank test p -value = 0.0374). Immunoblotting analysis showed the expression of EGFR and IL-13Rα2 protein levels were determined from d a panel of 10 patient-derived GBM e and the isogenic cell lines generated from Gli36 glioma cells. Pan-actin or β tubulin served as internal loading controls. f Cell proliferation and g Cell cycle analysis were performed with Gli36 and Gli36.IL-13Rα2 cells h Soft agar colony formation assay was performed, Gli36.EGFRvIII was used as a positive control. i In vitro migration and j invasion assays were determined in Gli36 and Gli36.IL-13Rα2 cells. All data are represented as mean ± SEM, unpaired t -test ** p
    Figure Legend Snippet: GBM patients co-expressing EGFR and IL-13Rα2 correlate to poor survival where the overexpression of IL-13Rα2 alone leads to enhance cell migration but not proliferation. Kaplan−Meier survival analysis of a all gliomas patients; b GBM patients from REMBRANDT database from National Cancer Institute (USA). Patients overexpressing EGFR mRNA by 2-fold (blue) with high (red), intermediate (yellow) and low (green) levels of IL-13Rα2 expression were shown. The log-rank p -values were indicated. c Kaplan−Meier survival plots for patients expressing high YKL-40 mRNA levels TCGA. High IL-13Rα2 expression group (red) and low IL-13Rα2 expression group (blue) were determined by aggregating all patients whose z -score normalized expression was above or below 0, respectively (Log-rank test p -value = 0.0374). Immunoblotting analysis showed the expression of EGFR and IL-13Rα2 protein levels were determined from d a panel of 10 patient-derived GBM e and the isogenic cell lines generated from Gli36 glioma cells. Pan-actin or β tubulin served as internal loading controls. f Cell proliferation and g Cell cycle analysis were performed with Gli36 and Gli36.IL-13Rα2 cells h Soft agar colony formation assay was performed, Gli36.EGFRvIII was used as a positive control. i In vitro migration and j invasion assays were determined in Gli36 and Gli36.IL-13Rα2 cells. All data are represented as mean ± SEM, unpaired t -test ** p

    Techniques Used: Expressing, Over Expression, Migration, Derivative Assay, Generated, Cell Cycle Assay, Soft Agar Assay, Positive Control, In Vitro

    8) Product Images from "Nuclear EGFR Suppresses Ribonuclease Activity of Polynucleotide Phosphorylase through DNAPK-mediated Phosphorylation at Serine 776 *"

    Article Title: Nuclear EGFR Suppresses Ribonuclease Activity of Polynucleotide Phosphorylase through DNAPK-mediated Phosphorylation at Serine 776 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.358077

    The proposed model of EGFR in the regulation of PNPase. A schematic illustrating the regulation of PNPase activity toward c-MYC mRNA by EGFR and DNAPK. Left : in normal condition, PNPase actively regulates the homeostasis of c-MYC mRNA. Right : Exposure to IR increases translocation of EGFR into the nucleus and increases its association with DNAPK and PNPase. EGFR then activates the serine kinase activity of DNAPK toward Ser-776 of PNPase to suppress its ribonuclease activity, leading to increase of c-MYC mRNA. The elevated c-MYC contributes to cell survival and radioresistance.
    Figure Legend Snippet: The proposed model of EGFR in the regulation of PNPase. A schematic illustrating the regulation of PNPase activity toward c-MYC mRNA by EGFR and DNAPK. Left : in normal condition, PNPase actively regulates the homeostasis of c-MYC mRNA. Right : Exposure to IR increases translocation of EGFR into the nucleus and increases its association with DNAPK and PNPase. EGFR then activates the serine kinase activity of DNAPK toward Ser-776 of PNPase to suppress its ribonuclease activity, leading to increase of c-MYC mRNA. The elevated c-MYC contributes to cell survival and radioresistance.

    Techniques Used: Activity Assay, Translocation Assay

    9) Product Images from "Desmoglein 1-dependent suppression of EGFR signaling promotes epidermal differentiation and morphogenesis"

    Article Title: Desmoglein 1-dependent suppression of EGFR signaling promotes epidermal differentiation and morphogenesis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200809044

    Dsg1 is required for the suppression of EGFR–Erk1/2 signaling during epidermal differentiation. (A) IHC analysis of Dsg1 (left) and EGFR phosphorylated at Y1068 (p-EGFR; right) revealed a basally restricted p-EGFR staining pattern largely absent from Dsg1-positive suprabasal layers in control (miR Lmn) cultures, whereas Dsg1-deficient cultures (miR DG1) demonstrated a gross disorganization of p-EGFR, which was present throughout the basal and suprabasal layers. The dotted lines indicate the boundary between keratinocytes and the collagen matrix. (B) Western blot analysis of keratinocytes transduced with miR Lmn or miR DG1 and induced to undergo differentiation for 2 d as submerged cultures in the presence or absence of 10 µM of the EGFR–erbB2 inhibitor PKI166 (PKI). A significant increase in p-EGFR, p-erbB2, and p-Erk1/2 levels was detectable in keratinocytes upon Dsg1 silencing (Dsg1 KD) along with decreased K10/Dsc1. Blocking EGFR signaling using PKI166 suppressed p-EGFR, p-erbB2, and p-Erk levels in addition to restoring the capacity of Dsg1-deficient keratinocytes to differentiate. Ratios of p-EGFR to total EGFR or p-Erk1/2 to total Erk1/2 are indicated above the blots. Tx, treatment. (C) Dual-label indirect immunofluorescence and Apotome optical sectioning of Dsg1-Flag and EGFR after 4 h in high Ca 2+ revealed areas of overlap in discrete regions of cell–cell contact (zoom) but not throughout the cell. The boxed area is magnified in the right panel. (D) Keratinocytes were transduced with EGFP, WT Dsg1-Flag (DG1-WT), or a soluble, truncated Dsg1 mutant (ΔN-DG1) and switched into high Ca 2+ before being harvested in RIPA buffer. The insoluble pellet was resuspended in buffered SDS and run in parallel with equal protein amounts from the RIPA-soluble fraction. The ratio of insoluble/total erbB2, EGFR, E-cadherin (E-cad), and K14 is presented in the bar graph and is representative of three experiments. Full-length but not the truncated Dsg1 recruits EGFR–erbB2 into a more insoluble fraction where keratins are concentrated. Under these detergent conditions, the vast majority of E-cadherin remains in the soluble fraction. (E) Activation of EGFR-Ras-Raf-Erk signaling effectors as well as the EGFR–Erk1/2 gene target, EphA2, were elevated by Dsg1 knockdown but not chronic ETA treatment in rafts. Ratios of p-Erk to total Erk are indicated above the blots. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Bars: (A) 50 µm; (C) 20 µm.
    Figure Legend Snippet: Dsg1 is required for the suppression of EGFR–Erk1/2 signaling during epidermal differentiation. (A) IHC analysis of Dsg1 (left) and EGFR phosphorylated at Y1068 (p-EGFR; right) revealed a basally restricted p-EGFR staining pattern largely absent from Dsg1-positive suprabasal layers in control (miR Lmn) cultures, whereas Dsg1-deficient cultures (miR DG1) demonstrated a gross disorganization of p-EGFR, which was present throughout the basal and suprabasal layers. The dotted lines indicate the boundary between keratinocytes and the collagen matrix. (B) Western blot analysis of keratinocytes transduced with miR Lmn or miR DG1 and induced to undergo differentiation for 2 d as submerged cultures in the presence or absence of 10 µM of the EGFR–erbB2 inhibitor PKI166 (PKI). A significant increase in p-EGFR, p-erbB2, and p-Erk1/2 levels was detectable in keratinocytes upon Dsg1 silencing (Dsg1 KD) along with decreased K10/Dsc1. Blocking EGFR signaling using PKI166 suppressed p-EGFR, p-erbB2, and p-Erk levels in addition to restoring the capacity of Dsg1-deficient keratinocytes to differentiate. Ratios of p-EGFR to total EGFR or p-Erk1/2 to total Erk1/2 are indicated above the blots. Tx, treatment. (C) Dual-label indirect immunofluorescence and Apotome optical sectioning of Dsg1-Flag and EGFR after 4 h in high Ca 2+ revealed areas of overlap in discrete regions of cell–cell contact (zoom) but not throughout the cell. The boxed area is magnified in the right panel. (D) Keratinocytes were transduced with EGFP, WT Dsg1-Flag (DG1-WT), or a soluble, truncated Dsg1 mutant (ΔN-DG1) and switched into high Ca 2+ before being harvested in RIPA buffer. The insoluble pellet was resuspended in buffered SDS and run in parallel with equal protein amounts from the RIPA-soluble fraction. The ratio of insoluble/total erbB2, EGFR, E-cadherin (E-cad), and K14 is presented in the bar graph and is representative of three experiments. Full-length but not the truncated Dsg1 recruits EGFR–erbB2 into a more insoluble fraction where keratins are concentrated. Under these detergent conditions, the vast majority of E-cadherin remains in the soluble fraction. (E) Activation of EGFR-Ras-Raf-Erk signaling effectors as well as the EGFR–Erk1/2 gene target, EphA2, were elevated by Dsg1 knockdown but not chronic ETA treatment in rafts. Ratios of p-Erk to total Erk are indicated above the blots. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Bars: (A) 50 µm; (C) 20 µm.

    Techniques Used: Immunohistochemistry, Staining, Western Blot, Transduction, Blocking Assay, Immunofluorescence, Mutagenesis, Activation Assay

    10) Product Images from "Screening and discovery of nitro-benzoxadiazole compounds activating epidermal growth factor receptor (EGFR) in cancer cells"

    Article Title: Screening and discovery of nitro-benzoxadiazole compounds activating epidermal growth factor receptor (EGFR) in cancer cells

    Journal: Scientific Reports

    doi: 10.1038/srep03977

    EGFR tyrosine kinase inhibitors prevent tyrosine phosphorylation of the receptor (a) and protein phosphorylation in downstream signaling pathways (b) in cancer cells exposed to compounds NSC 228155 or CN 009543V. MDA MB468 cells serum-starved overnight were pre-incubated (or not) with 10 μM AG1478 or 2 μM PD 153035 for 90 min and then, where indicated, incubated with 100 μM NSC 228155 or CN 009543V or 150 ng/ml EGF or vehicle (0.2% DMSO) for 15 min.Proteins were blotted to nitrocellulose membrane and analyzed with biotinylated anti-pTyr P100, anti-pEGFR Y1068 and anti-EGFR (epitope in cytoplasmic region) antibodies. The phospho-specific antibodies were anti-phospho-Shc (Tyr239/240), anti-phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204), anti-phospho-c-CBL (Tyr774), and anti-Gab1 (Tyr627). The signal intensity of the α-tubulin band was quantitatively evaluated and used as the loading control of protein samples.
    Figure Legend Snippet: EGFR tyrosine kinase inhibitors prevent tyrosine phosphorylation of the receptor (a) and protein phosphorylation in downstream signaling pathways (b) in cancer cells exposed to compounds NSC 228155 or CN 009543V. MDA MB468 cells serum-starved overnight were pre-incubated (or not) with 10 μM AG1478 or 2 μM PD 153035 for 90 min and then, where indicated, incubated with 100 μM NSC 228155 or CN 009543V or 150 ng/ml EGF or vehicle (0.2% DMSO) for 15 min.Proteins were blotted to nitrocellulose membrane and analyzed with biotinylated anti-pTyr P100, anti-pEGFR Y1068 and anti-EGFR (epitope in cytoplasmic region) antibodies. The phospho-specific antibodies were anti-phospho-Shc (Tyr239/240), anti-phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204), anti-phospho-c-CBL (Tyr774), and anti-Gab1 (Tyr627). The signal intensity of the α-tubulin band was quantitatively evaluated and used as the loading control of protein samples.

    Techniques Used: Multiple Displacement Amplification, Incubation

    Inhibition of PTP-1B phosphatase is associated with tyrosine auto-phosphorylation of EGFR in cancer cells exposed to NBD-compounds. Histograms of PTP-1B (a) and total phosphatase (b) activities, and images of monomeric and dimeric forms of EGFR detected with Western blot (c). MDA MB468 cells were pre-incubated with a vehicle (0,2% DMSO) or 2 μM PD 153035 for 2 h, and then incubated with a vehicle or 500 ng/ml EGF or 100 μM of each of NSC 228155 or CN 009543V for 15 min at 37°C. Buffer-exchanged extracts were used for assays. Protein tyrosine phosphatase activity was measured by dephosphorylation of phosphopeptide substrate. Total phosphatase activity was measured by hydrolysis of para -nitrophenyl phosphate (pNPP), and expressed in % of the enzyme activity in extracts of the cells incubated with a vehicle (taken as 100%). Levels of PTP-1B and total phosphatase activities were normalized to total protein concentration in the extracts to be assayed. Detection of EGFR was carried out with anti-EGFR antibody recognizing the cytoplasmic domain ((c), upper image) and anti-pEGFR Y1068 antibody ((c), lower image). Electrophoretic migration of proteins was carried out in different gels; it was longer for Western blotting with anti-pEGFR Y1068 antibody.
    Figure Legend Snippet: Inhibition of PTP-1B phosphatase is associated with tyrosine auto-phosphorylation of EGFR in cancer cells exposed to NBD-compounds. Histograms of PTP-1B (a) and total phosphatase (b) activities, and images of monomeric and dimeric forms of EGFR detected with Western blot (c). MDA MB468 cells were pre-incubated with a vehicle (0,2% DMSO) or 2 μM PD 153035 for 2 h, and then incubated with a vehicle or 500 ng/ml EGF or 100 μM of each of NSC 228155 or CN 009543V for 15 min at 37°C. Buffer-exchanged extracts were used for assays. Protein tyrosine phosphatase activity was measured by dephosphorylation of phosphopeptide substrate. Total phosphatase activity was measured by hydrolysis of para -nitrophenyl phosphate (pNPP), and expressed in % of the enzyme activity in extracts of the cells incubated with a vehicle (taken as 100%). Levels of PTP-1B and total phosphatase activities were normalized to total protein concentration in the extracts to be assayed. Detection of EGFR was carried out with anti-EGFR antibody recognizing the cytoplasmic domain ((c), upper image) and anti-pEGFR Y1068 antibody ((c), lower image). Electrophoretic migration of proteins was carried out in different gels; it was longer for Western blotting with anti-pEGFR Y1068 antibody.

    Techniques Used: Inhibition, Western Blot, Multiple Displacement Amplification, Incubation, Activity Assay, De-Phosphorylation Assay, Protein Concentration, Migration

    Schema of compound library screening with microarrays and identification of small molecules enhancing protein tyrosine phosphorylation of EGFR. The structure of the sEGFR is shown in a tethered conformation of four domains: I (yellow), II (green), III (gray) and IV (red). The histogram shows competitive assay data obtained for three selected compounds (for NSC 228155 - column 1). The signal monitored from binding of each molecule to sEGFR (gray column) was used as 100% to assess the binding efficiency to sEGFR in competition with DII/sEGFR (brown column). Protein tyrosine phosphorylation was assessed in MDA MB468 cells exposed to the compounds at 20 μM final concentration for 60 min at 37°C. The proteins were analyzed with anti-pTyr P100 antibody. Lane 1: cells exposed to NSC 228155; lanes 2 and 3: cells exposed to two other selected compounds; lane 4: untreated cells; lane 5: cells treated with 150 ng/ml EGF for 10 min; MM: molecular mass markers, kDa.
    Figure Legend Snippet: Schema of compound library screening with microarrays and identification of small molecules enhancing protein tyrosine phosphorylation of EGFR. The structure of the sEGFR is shown in a tethered conformation of four domains: I (yellow), II (green), III (gray) and IV (red). The histogram shows competitive assay data obtained for three selected compounds (for NSC 228155 - column 1). The signal monitored from binding of each molecule to sEGFR (gray column) was used as 100% to assess the binding efficiency to sEGFR in competition with DII/sEGFR (brown column). Protein tyrosine phosphorylation was assessed in MDA MB468 cells exposed to the compounds at 20 μM final concentration for 60 min at 37°C. The proteins were analyzed with anti-pTyr P100 antibody. Lane 1: cells exposed to NSC 228155; lanes 2 and 3: cells exposed to two other selected compounds; lane 4: untreated cells; lane 5: cells treated with 150 ng/ml EGF for 10 min; MM: molecular mass markers, kDa.

    Techniques Used: Library Screening, Binding Assay, Multiple Displacement Amplification, Concentration Assay

    11) Product Images from "Multiplexed molecular imaging of fresh tissue surfaces enabled by convection-enhanced topical staining with SERS-coded nanoparticles"

    Article Title: Multiplexed molecular imaging of fresh tissue surfaces enabled by convection-enhanced topical staining with SERS-coded nanoparticles

    Journal: Small (Weinheim an der Bergstrasse, Germany)

    doi: 10.1002/smll.201601829

    Multiplexed molecular imaging of a A431 tumor xenograft through automated DMV staining with a 4-flavor NP mixture (EGFR-NPs, HER2-NPs, CD44-NPs and isotype-NPs). a) Flow cytometry validation of conjugated NPs with cultured cells. EGFR-NPs, HER2-NPs, CD44-NPs
    Figure Legend Snippet: Multiplexed molecular imaging of a A431 tumor xenograft through automated DMV staining with a 4-flavor NP mixture (EGFR-NPs, HER2-NPs, CD44-NPs and isotype-NPs). a) Flow cytometry validation of conjugated NPs with cultured cells. EGFR-NPs, HER2-NPs, CD44-NPs

    Techniques Used: Imaging, Staining, Flow Cytometry, Cytometry, Cell Culture

    Multiplexed molecular imaging of freshly excised breast tissues with REMI, in which automated DMV staining of a 5-flavor mixture of NPs is employed. Each tissue specimen is stained with an equimolar mixture of HER2-NPs, EGFR-NPs, CD44-NPs, CD24-NPs and
    Figure Legend Snippet: Multiplexed molecular imaging of freshly excised breast tissues with REMI, in which automated DMV staining of a 5-flavor mixture of NPs is employed. Each tissue specimen is stained with an equimolar mixture of HER2-NPs, EGFR-NPs, CD44-NPs, CD24-NPs and

    Techniques Used: Imaging, Staining

    12) Product Images from "Acidic Mammalian Chitinase Is Secreted via an ADAM17/Epidermal Growth Factor Receptor-dependent Pathway and Stimulates Chemokine Production by Pulmonary Epithelial Cells *"

    Article Title: Acidic Mammalian Chitinase Is Secreted via an ADAM17/Epidermal Growth Factor Receptor-dependent Pathway and Stimulates Chemokine Production by Pulmonary Epithelial Cells *

    Journal:

    doi: 10.1074/jbc.M805574200

    ADAM17 and Ras modulate AMCase secretion. a , A549 cells were transfected with empty vector ( AMCase -) or AMCase ( AMCase +) and were treated with the EGFR inhibitors PD153035 (1 μ m ) or AG1478 (1 μ m ), the ADAM17 inhibitors TAPI-1 (25
    Figure Legend Snippet: ADAM17 and Ras modulate AMCase secretion. a , A549 cells were transfected with empty vector ( AMCase -) or AMCase ( AMCase +) and were treated with the EGFR inhibitors PD153035 (1 μ m ) or AG1478 (1 μ m ), the ADAM17 inhibitors TAPI-1 (25

    Techniques Used: Transfection, Plasmid Preparation

    Physical interaction of EGFR and AMCase. A549 cells were transfected with empty vector, the indicated AMCase or EGFR expression plasmids, or both. In rows 1 and 3 (from the top ), cell lysates (200 μg of protein) were subjected to immunoprecipitation
    Figure Legend Snippet: Physical interaction of EGFR and AMCase. A549 cells were transfected with empty vector, the indicated AMCase or EGFR expression plasmids, or both. In rows 1 and 3 (from the top ), cell lysates (200 μg of protein) were subjected to immunoprecipitation

    Techniques Used: Transfection, Plasmid Preparation, Expressing, Immunoprecipitation

    AMCase, EGFR, and ADAM17 colocalize in lung epithelial cells. AMCase, EGFR, and ADAM17 expression were quantified within CD45 - CD31 - cytokeratin + cells in IL-13-overexpressing transgenic mice. a and b show AMCase coexpression with EGFR ( a ) and ADAM17
    Figure Legend Snippet: AMCase, EGFR, and ADAM17 colocalize in lung epithelial cells. AMCase, EGFR, and ADAM17 expression were quantified within CD45 - CD31 - cytokeratin + cells in IL-13-overexpressing transgenic mice. a and b show AMCase coexpression with EGFR ( a ) and ADAM17

    Techniques Used: Expressing, Transgenic Assay, Mouse Assay

    Functional interactions of EGFR and AMCase. a , cultured A549 cells were transfected with empty vector, the indicated quantity of AMCase or EGFR expression plasmid, or both. The amount of EGFR that was transfected is expressed in relation to the amount
    Figure Legend Snippet: Functional interactions of EGFR and AMCase. a , cultured A549 cells were transfected with empty vector, the indicated quantity of AMCase or EGFR expression plasmid, or both. The amount of EGFR that was transfected is expressed in relation to the amount

    Techniques Used: Functional Assay, Cell Culture, Transfection, Plasmid Preparation, Expressing

    13) Product Images from "A Novel Antibody Engineering Strategy for Making Monovalent Bispecific Heterodimeric IgG Antibodies by Electrostatic Steering Mechanism *"

    Article Title: A Novel Antibody Engineering Strategy for Making Monovalent Bispecific Heterodimeric IgG Antibodies by Electrostatic Steering Mechanism *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.620260

    rhuHER2 and rhuEGFR Bind Simultaneously to Anti-HER2 × EGFR Hetero-IgG1 Antibodies with Comparable Affinity as the Parental Antibodies
    Figure Legend Snippet: rhuHER2 and rhuEGFR Bind Simultaneously to Anti-HER2 × EGFR Hetero-IgG1 Antibodies with Comparable Affinity as the Parental Antibodies

    Techniques Used:

    Stable expression of anti-HER2 × EGFR and anti-HER2 × HER2 hetero-IgG1 variants in CHO-K1 cells. A, Western blotting of purified proteins from transient transfection and crude supernatants from stably transfected CHO-K1 cells in SDS-PAGE
    Figure Legend Snippet: Stable expression of anti-HER2 × EGFR and anti-HER2 × HER2 hetero-IgG1 variants in CHO-K1 cells. A, Western blotting of purified proteins from transient transfection and crude supernatants from stably transfected CHO-K1 cells in SDS-PAGE

    Techniques Used: Expressing, Western Blot, Purification, Transfection, Stable Transfection, SDS Page

    In vitro stability of anti-HER2 × EGFR and anti-HER2 × HER2 hetero-IgG1 bsAbs in human serum. A, retention of the parent anti-EGFR E7.6.3 IgG1 and anti-HER2 × EGFR hetero-IgG1 V23 when binding to the captured biotin-EGFR. B, retention
    Figure Legend Snippet: In vitro stability of anti-HER2 × EGFR and anti-HER2 × HER2 hetero-IgG1 bsAbs in human serum. A, retention of the parent anti-EGFR E7.6.3 IgG1 and anti-HER2 × EGFR hetero-IgG1 V23 when binding to the captured biotin-EGFR. B, retention

    Techniques Used: In Vitro, Binding Assay

    Anti-HER2 × EGFR hetero-IgG1 antibodies from stably transfected CHO-K1 cells have comparable binding affinity as parental antibodies. Representative SPR sensorgrams of triplicate injections of 75 n m monomeric rhuEGFR injected at time 0 s followed
    Figure Legend Snippet: Anti-HER2 × EGFR hetero-IgG1 antibodies from stably transfected CHO-K1 cells have comparable binding affinity as parental antibodies. Representative SPR sensorgrams of triplicate injections of 75 n m monomeric rhuEGFR injected at time 0 s followed

    Techniques Used: Stable Transfection, Transfection, Binding Assay, SPR Assay, Injection

    Proof-of-concept studies to validate the feasibility of hetero-IgG format. Anti-HER2 × EGFR hetero-IgG1 variants in which an Fn3 tag was attached to the N terminus of anti-EGFR HC2 and an Fn3-FLAG-His 6 tag was attached to the C terminus of anti-EGFR
    Figure Legend Snippet: Proof-of-concept studies to validate the feasibility of hetero-IgG format. Anti-HER2 × EGFR hetero-IgG1 variants in which an Fn3 tag was attached to the N terminus of anti-EGFR HC2 and an Fn3-FLAG-His 6 tag was attached to the C terminus of anti-EGFR

    Techniques Used:

    Hetero-IgG1 variant 2B05 in the presence of Fn3 and Fn3-FLAG - His 6 tags has the predicted mass and correct LC-HC pairings by mass spectrometry analysis. A, intact hetero-IgG1 after deglycosylation by PNGase F. B, anti-HER2 LC1. C, anti-EGFR LC2 tagged
    Figure Legend Snippet: Hetero-IgG1 variant 2B05 in the presence of Fn3 and Fn3-FLAG - His 6 tags has the predicted mass and correct LC-HC pairings by mass spectrometry analysis. A, intact hetero-IgG1 after deglycosylation by PNGase F. B, anti-HER2 LC1. C, anti-EGFR LC2 tagged

    Techniques Used: Variant Assay, Mass Spectrometry

    Thermal stability analysis of parental antibodies and anti-HER2 × EGFR hetero-IgG1 variants by differential scanning calorimetry. All antibodies were produced in 2936E cells by transient transfection, purified by protein A, and polished by Superdex
    Figure Legend Snippet: Thermal stability analysis of parental antibodies and anti-HER2 × EGFR hetero-IgG1 variants by differential scanning calorimetry. All antibodies were produced in 2936E cells by transient transfection, purified by protein A, and polished by Superdex

    Techniques Used: Produced, Transfection, Purification

    14) Product Images from "Rapid ratiometric biomarker detection with topically applied SERS nanoparticles"

    Article Title: Rapid ratiometric biomarker detection with topically applied SERS nanoparticles

    Journal: Technology

    doi: 10.1142/S2339547814500125

    Flow cytometry validation of conjugated NPs with cultured cells. NPs were conjugated with either anti-EGFR, anti-HER2 or isotype control monoclonal antibodies. These NPs were individually used to stain ( a ) 3T3 (−), ( b ) A431 (EGFR++, HER2+) and
    Figure Legend Snippet: Flow cytometry validation of conjugated NPs with cultured cells. NPs were conjugated with either anti-EGFR, anti-HER2 or isotype control monoclonal antibodies. These NPs were individually used to stain ( a ) 3T3 (−), ( b ) A431 (EGFR++, HER2+) and

    Techniques Used: Flow Cytometry, Cytometry, Cell Culture, Staining

    15) Product Images from "miR-200 Expression Regulates Epithelial to Mesenchymal Transition in Bladder Cancer Cells and Reverses Resistance to EGFR Therapy"

    Article Title: miR-200 Expression Regulates Epithelial to Mesenchymal Transition in Bladder Cancer Cells and Reverses Resistance to EGFR Therapy

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    doi: 10.1158/1078-0432.CCR-08-2245

    The miR-200c expression reverses EGFR resistance in UMUC3 cells A) Confocal microscopy analysis of the UMUC3 series costained for ERRFI-1 (red pixels) and EGFR (green pixels) and a DNA dye, showing the nucleus (blue pixels). Note the yellow pixels (left panel) as a result of red and green pixels co-localization. B) Immunoblot of autophosphorylated EGFR, total EGFR, and total ERRFI-1 in cells transduced with miR-200c from the experiment above. In this experiment, actin served as the internal control. C) Upper panels , Immunoblot of phosphorylated MAPKinase, total MAPKinase and total EGFR of the UMUC3 series. Cells grown in 2% serum-supplemented MEM were left untreated or were treated with increased concentrations of cetuximab (C225) for 3 hours. Lower panel , OD relative values expressed as ratios between EGFR (internal control) and pMAPKinase. D) Cell proliferation measurement of the UMUC3 series using radioactive thymidine incorporation. Each experiment was done in at least two different triplicates.
    Figure Legend Snippet: The miR-200c expression reverses EGFR resistance in UMUC3 cells A) Confocal microscopy analysis of the UMUC3 series costained for ERRFI-1 (red pixels) and EGFR (green pixels) and a DNA dye, showing the nucleus (blue pixels). Note the yellow pixels (left panel) as a result of red and green pixels co-localization. B) Immunoblot of autophosphorylated EGFR, total EGFR, and total ERRFI-1 in cells transduced with miR-200c from the experiment above. In this experiment, actin served as the internal control. C) Upper panels , Immunoblot of phosphorylated MAPKinase, total MAPKinase and total EGFR of the UMUC3 series. Cells grown in 2% serum-supplemented MEM were left untreated or were treated with increased concentrations of cetuximab (C225) for 3 hours. Lower panel , OD relative values expressed as ratios between EGFR (internal control) and pMAPKinase. D) Cell proliferation measurement of the UMUC3 series using radioactive thymidine incorporation. Each experiment was done in at least two different triplicates.

    Techniques Used: Expressing, Confocal Microscopy, Transduction

    Relation between the differentially expressed ERRFI-1 and TGF-α and cell sensitivity to EGFR-targeted therapy A) Measurement by real-time westernblot of ERRFI-1 and E-cadherin. B) Measurement by real-time RT-PCR of mRNA relative levels of TGF-α. The data are means of measurements from triplicate experiments. C) Cell proliferation measurement (DNA index) of 9 bladder cancer cell lines in the absence or presence of different cetuximab (C225) concentrations. Data are means of at least 3 triplicate experiments.
    Figure Legend Snippet: Relation between the differentially expressed ERRFI-1 and TGF-α and cell sensitivity to EGFR-targeted therapy A) Measurement by real-time westernblot of ERRFI-1 and E-cadherin. B) Measurement by real-time RT-PCR of mRNA relative levels of TGF-α. The data are means of measurements from triplicate experiments. C) Cell proliferation measurement (DNA index) of 9 bladder cancer cell lines in the absence or presence of different cetuximab (C225) concentrations. Data are means of at least 3 triplicate experiments.

    Techniques Used: Quantitative RT-PCR

    16) Product Images from "High Affinity Chimeric Antigen Receptor with Cross-Reactive scFv to Clinically Relevant EGFR Oncogenic Isoforms"

    Article Title: High Affinity Chimeric Antigen Receptor with Cross-Reactive scFv to Clinically Relevant EGFR Oncogenic Isoforms

    Journal: bioRxiv

    doi: 10.1101/2021.02.04.429797

    806 CAR T activity in heterogenous GBOs highlights cross-reactivity of 806 binder against oncogenic EGFRs. CAR T co-culture with GBOs was used to demonstrate anti-EGFR activity. (A) EGFR alterations identified in each GBO line. (B) Immunofluorescence images of CAR T cells engrafted GBOs, for 4 organoids per condition, 9057 (left) and 9066 (right). Blue=DAPI; Red=CD3 + ; White=Cleaved caspase 3 + (CC3 + ), scale bar = 100 µm. (C) Quantification of CD3 + cells (left) and CC3 + cells (right) showing anti-tumor activity from the 806 CAR T cells. (D) Immunofluorescence images of CAR T cell targets in GBOs, for 9057 (left) and 9066 (right). Blue=DAPI; Red=EGFR + ; White=EGFRvIII + , scale bar = 100 µm. (E) Quantification of EGFR + (left) and EGFRvIII + signals (right) showing anti-tumor activity from the 806 CAR T cells. Error bars are ± standard error.
    Figure Legend Snippet: 806 CAR T activity in heterogenous GBOs highlights cross-reactivity of 806 binder against oncogenic EGFRs. CAR T co-culture with GBOs was used to demonstrate anti-EGFR activity. (A) EGFR alterations identified in each GBO line. (B) Immunofluorescence images of CAR T cells engrafted GBOs, for 4 organoids per condition, 9057 (left) and 9066 (right). Blue=DAPI; Red=CD3 + ; White=Cleaved caspase 3 + (CC3 + ), scale bar = 100 µm. (C) Quantification of CD3 + cells (left) and CC3 + cells (right) showing anti-tumor activity from the 806 CAR T cells. (D) Immunofluorescence images of CAR T cell targets in GBOs, for 9057 (left) and 9066 (right). Blue=DAPI; Red=EGFR + ; White=EGFRvIII + , scale bar = 100 µm. (E) Quantification of EGFR + (left) and EGFRvIII + signals (right) showing anti-tumor activity from the 806 CAR T cells. Error bars are ± standard error.

    Techniques Used: Activity Assay, Co-Culture Assay, Immunofluorescence

    In vivo anti-tumor effect of 806 CAR T cells in NSG mice bearing U87MG-EGFR/EGFRvIII + xenografts. Seven days after 250,000 U87MG-EGFR/EGFRvIII cells were subcutaneously implanted into mice, 3×10 6 T cells were injected intravenously with indicated CAR constructs. (A) Survival based on time to endpoint was plotted using a Kaplan-Meier curve and statistically significant differences between CAR groups were determined using log-rank Mantel-Cox test. Tumor burden was assessed by bioluminescent imaging. Bars indicate means ± SD (n = 7 mice per group). Tumor burden was quantified as total flux (B) and in individual mice (C) in units of photons/second. Bars indicate means + SD (n = 7 mice). P = photons.
    Figure Legend Snippet: In vivo anti-tumor effect of 806 CAR T cells in NSG mice bearing U87MG-EGFR/EGFRvIII + xenografts. Seven days after 250,000 U87MG-EGFR/EGFRvIII cells were subcutaneously implanted into mice, 3×10 6 T cells were injected intravenously with indicated CAR constructs. (A) Survival based on time to endpoint was plotted using a Kaplan-Meier curve and statistically significant differences between CAR groups were determined using log-rank Mantel-Cox test. Tumor burden was assessed by bioluminescent imaging. Bars indicate means ± SD (n = 7 mice per group). Tumor burden was quantified as total flux (B) and in individual mice (C) in units of photons/second. Bars indicate means + SD (n = 7 mice). P = photons.

    Techniques Used: In Vivo, Mouse Assay, Injection, Construct, Imaging

    Construction and expression of 806 CAR and EGFR mutant cell lines. (A) Schematic diagram of vector map of 806 CAR containing the 4-1BB co-stimulatory domain. (B) CAR surface expression in primary human CD4 + and CD8 + T cells. Human T cells were simulated for 24 hours with anti-CD3/anti-CD28 T-cell activating beads and transduced with CAR transgenes and CAR expression was analyzed by flow cytometry using biotinylated goat-anti-mouse (806, C225, and CD19 CARs) and goat-anti human F(ab)2 fragment specific antibodies (2173 CARs) followed by secondary staining with streptavidin-APC. (C) Schematic showing targeted missense mutations in extracellular domain of EGFR, EGFR R108K/G , EGFR A289D/T/V , EGFR G598V and splice variant EGFRvIII. (D) Schematic of lentiviral vector co-expressing CFP and wtEGFR or EGFR mutant. (E) Flow based analysis of endogenous and ectopically expressed EGFR in U87MG, GSC5077, and K562 cell lines using the cetuximab antibody. (F) U87MG, U87MG-EGFR and GSC5077-EGFR expression of EGFRvIII. (G) U87MG-EGFR, GSC5077-EGFR, and K562 cell lines were transduced with a lentiviral vector co-expressing CFP and indicated EGFR missense mutations and sorted by CFP expression using fluorescent activated cell sorting.
    Figure Legend Snippet: Construction and expression of 806 CAR and EGFR mutant cell lines. (A) Schematic diagram of vector map of 806 CAR containing the 4-1BB co-stimulatory domain. (B) CAR surface expression in primary human CD4 + and CD8 + T cells. Human T cells were simulated for 24 hours with anti-CD3/anti-CD28 T-cell activating beads and transduced with CAR transgenes and CAR expression was analyzed by flow cytometry using biotinylated goat-anti-mouse (806, C225, and CD19 CARs) and goat-anti human F(ab)2 fragment specific antibodies (2173 CARs) followed by secondary staining with streptavidin-APC. (C) Schematic showing targeted missense mutations in extracellular domain of EGFR, EGFR R108K/G , EGFR A289D/T/V , EGFR G598V and splice variant EGFRvIII. (D) Schematic of lentiviral vector co-expressing CFP and wtEGFR or EGFR mutant. (E) Flow based analysis of endogenous and ectopically expressed EGFR in U87MG, GSC5077, and K562 cell lines using the cetuximab antibody. (F) U87MG, U87MG-EGFR and GSC5077-EGFR expression of EGFRvIII. (G) U87MG-EGFR, GSC5077-EGFR, and K562 cell lines were transduced with a lentiviral vector co-expressing CFP and indicated EGFR missense mutations and sorted by CFP expression using fluorescent activated cell sorting.

    Techniques Used: Expressing, Mutagenesis, Plasmid Preparation, Transduction, Flow Cytometry, Staining, Variant Assay, FACS

    in vitro characterization of 806 EGFR CAR T cells. Antigen specific cytolytic activity of 806 and 2173 CAR T cells against cell lines expressing EGFR and its variants. (A) U87MG-EGFR and GSC5077-EGFR cell lines expressing EGFRvIII, EGFR R108K/G , EGFR A289D/T/V , and EGFR G598V mutant variants were stably transduced with Click Beetle Green (CBG) and co-cultured with CAR T cells at indicated effector to target ratios for 24 hours. One representative experiment from 3 normal donors is shown. Samples were performed in triplicates in 3 replicative experiments. C225-BB-ζ CAR and CD19-BB-ζ CAR were used as positive and negative controls, respectively. (B) Antigen specific cytolytic activity of 806 and 2173 CAR T cells in EGFR and its variants expressed in K562 cells in a 4-hour chromium release assay at indicated effector to target ratios. (C) K562 cells expressing wtEGFR, EGFRvIII, or EGFR-mutants were co-cultured with 806 CART cells for 48 hours. IFN-γ, TNF-α, and IL2 secretion was measured in the supernatant by ELISA. Bar charts represent results from single experiment and values represent the average + SD of triplicates. (D) CD107a upregulation on CAR T cells stimulated with K562 cells expressing wtEGFR, EGFRvIII, or EGFR-mutants for 4 hours. The percentage of CD107a expression was quantified on CD3 cells (values represent the average of + SD of 2 repeated experiments).
    Figure Legend Snippet: in vitro characterization of 806 EGFR CAR T cells. Antigen specific cytolytic activity of 806 and 2173 CAR T cells against cell lines expressing EGFR and its variants. (A) U87MG-EGFR and GSC5077-EGFR cell lines expressing EGFRvIII, EGFR R108K/G , EGFR A289D/T/V , and EGFR G598V mutant variants were stably transduced with Click Beetle Green (CBG) and co-cultured with CAR T cells at indicated effector to target ratios for 24 hours. One representative experiment from 3 normal donors is shown. Samples were performed in triplicates in 3 replicative experiments. C225-BB-ζ CAR and CD19-BB-ζ CAR were used as positive and negative controls, respectively. (B) Antigen specific cytolytic activity of 806 and 2173 CAR T cells in EGFR and its variants expressed in K562 cells in a 4-hour chromium release assay at indicated effector to target ratios. (C) K562 cells expressing wtEGFR, EGFRvIII, or EGFR-mutants were co-cultured with 806 CART cells for 48 hours. IFN-γ, TNF-α, and IL2 secretion was measured in the supernatant by ELISA. Bar charts represent results from single experiment and values represent the average + SD of triplicates. (D) CD107a upregulation on CAR T cells stimulated with K562 cells expressing wtEGFR, EGFRvIII, or EGFR-mutants for 4 hours. The percentage of CD107a expression was quantified on CD3 cells (values represent the average of + SD of 2 repeated experiments).

    Techniques Used: In Vitro, Activity Assay, Expressing, Mutagenesis, Stable Transfection, Transduction, Cell Culture, Release Assay, Enzyme-linked Immunosorbent Assay

    17) Product Images from "Identification of Piperazinylbenzenesulfonamides as New Inhibitors of Claudin-1 Trafficking and Hepatitis C Virus Entry"

    Article Title: Identification of Piperazinylbenzenesulfonamides as New Inhibitors of Claudin-1 Trafficking and Hepatitis C Virus Entry

    Journal: Journal of Virology

    doi: 10.1128/JVI.01982-17

    An increase of CLDN1 localization at the cell surface is not sufficient to increase HCV entry upon either CD81 overexpression or EGF stimulation. (A) Huh-7 cells were transfected with pcDNA, HA–5-HT6, or CD81-YFP alone or in combination, as indicated. At 48 h posttransfection, cells were infected with HCVcc JFH1. At 30 h postinfection, cells were fixed and the infection rate was determined by IFA. (B) After 2 h of starvation, Huh-7 cells were kept nonstimulated or stimulated for 1 h with EGF (1 μg/ml). Western blotting was performed to verify the activation of EGFR through phosphorylation. β-Tubulin was used as a loading control. (C) Huh-7 cells transfected for 48 h with pcDNA, HA–5-HT6, or CD81-YFP, alone or in combination, after 2 h of starvation were treated for 1 h with EGF (1 μg/ml) and infected for 2 h with HCVcc JFH1 concomitantly with EGF (1 μg/ml). At 30 h postinfection, cells were fixed and the infection rate was determined by IFA. Results are presented as means ± SEM ( n = 2 [A and C]). One-way (A) or two-way (C) ANOVA followed by the Dunnett or Bonferroni posttest was performed for statistical analysis. ns, nonsignificant.
    Figure Legend Snippet: An increase of CLDN1 localization at the cell surface is not sufficient to increase HCV entry upon either CD81 overexpression or EGF stimulation. (A) Huh-7 cells were transfected with pcDNA, HA–5-HT6, or CD81-YFP alone or in combination, as indicated. At 48 h posttransfection, cells were infected with HCVcc JFH1. At 30 h postinfection, cells were fixed and the infection rate was determined by IFA. (B) After 2 h of starvation, Huh-7 cells were kept nonstimulated or stimulated for 1 h with EGF (1 μg/ml). Western blotting was performed to verify the activation of EGFR through phosphorylation. β-Tubulin was used as a loading control. (C) Huh-7 cells transfected for 48 h with pcDNA, HA–5-HT6, or CD81-YFP, alone or in combination, after 2 h of starvation were treated for 1 h with EGF (1 μg/ml) and infected for 2 h with HCVcc JFH1 concomitantly with EGF (1 μg/ml). At 30 h postinfection, cells were fixed and the infection rate was determined by IFA. Results are presented as means ± SEM ( n = 2 [A and C]). One-way (A) or two-way (C) ANOVA followed by the Dunnett or Bonferroni posttest was performed for statistical analysis. ns, nonsignificant.

    Techniques Used: Over Expression, Transfection, Infection, Immunofluorescence, Western Blot, Activation Assay

    SB258585 does not alter surface localization of the other main HCV entry factors. (A) Huh-7 cells were treated for 2 h with DMSO or increasing concentrations of SB258585. Surface biotinylation followed by biotin immunoprecipitation was performed, and a representative Western blot for OCLN is shown. The quantity of biotinylated OCLN was determined from Western blots by use of Fiji ( n = 3). (B to E) Huh-7 cells were treated for 2 h with DMSO or increasing concentrations of SB258585. CD81 (B), EGFR (C), SRB1 (D), and E-cadherin (E) expression levels were analyzed by flow cytometry. Curves from a representative experiment are shown. Mean fluorescence intensities relative to those for the DMSO-treated condition are presented. All results are presented as means ± SEM ( n = 3). One-way ANOVA followed by the Dunnett posttest was performed for statistical analysis. ns, nonsignificant.
    Figure Legend Snippet: SB258585 does not alter surface localization of the other main HCV entry factors. (A) Huh-7 cells were treated for 2 h with DMSO or increasing concentrations of SB258585. Surface biotinylation followed by biotin immunoprecipitation was performed, and a representative Western blot for OCLN is shown. The quantity of biotinylated OCLN was determined from Western blots by use of Fiji ( n = 3). (B to E) Huh-7 cells were treated for 2 h with DMSO or increasing concentrations of SB258585. CD81 (B), EGFR (C), SRB1 (D), and E-cadherin (E) expression levels were analyzed by flow cytometry. Curves from a representative experiment are shown. Mean fluorescence intensities relative to those for the DMSO-treated condition are presented. All results are presented as means ± SEM ( n = 3). One-way ANOVA followed by the Dunnett posttest was performed for statistical analysis. ns, nonsignificant.

    Techniques Used: Immunoprecipitation, Western Blot, Expressing, Flow Cytometry, Cytometry, Fluorescence

    18) Product Images from "HER-2 Signaling, Acquisition of Growth Factor Independence, and Regulation of Biological Networks Associated with Cell Transformation"

    Article Title: HER-2 Signaling, Acquisition of Growth Factor Independence, and Regulation of Biological Networks Associated with Cell Transformation

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-10-1529

    The progressive acquisition of HER-2–mediated transforming activity results in dramatic changes in downstream gene regulation affecting many different biological processes. Ingenuity Pathway Analysis was performed on the genes regulated by EGFR/HER-2
    Figure Legend Snippet: The progressive acquisition of HER-2–mediated transforming activity results in dramatic changes in downstream gene regulation affecting many different biological processes. Ingenuity Pathway Analysis was performed on the genes regulated by EGFR/HER-2

    Techniques Used: Activity Assay

    HER-2 tyrosine phosphorylation is dependent on EGFR in the EGF-dependent MCF-10HER2 cells, but independent of EGFR in the EGF-independent cell lines. A, MCF-10HER2, MCF-10AHER2/E7, SUM-190, and SUM-225 cells were cultured in the presence of 0.5 µmol/L
    Figure Legend Snippet: HER-2 tyrosine phosphorylation is dependent on EGFR in the EGF-dependent MCF-10HER2 cells, but independent of EGFR in the EGF-independent cell lines. A, MCF-10HER2, MCF-10AHER2/E7, SUM-190, and SUM-225 cells were cultured in the presence of 0.5 µmol/L

    Techniques Used: Cell Culture

    Regulation of gene expression by EGFR/HER-2 signaling in the MCF-10A isogenic cell line series. Cells were cultured in the presence of either gefitinib or CP724,714 and harvested every 3 h for 45 h for RNA isolation and whole-genome expression profiling.
    Figure Legend Snippet: Regulation of gene expression by EGFR/HER-2 signaling in the MCF-10A isogenic cell line series. Cells were cultured in the presence of either gefitinib or CP724,714 and harvested every 3 h for 45 h for RNA isolation and whole-genome expression profiling.

    Techniques Used: Expressing, Cell Culture, Isolation

    The transition to EGF independence results in the acquisition of dominant signaling activity by HER-2. A, MCF-10AHER2, MCF-10HER2/E7, or SUM-225 cells were exposed to CP724,714 for 1 to 6 h, followed by EGFR immunoprecipitation (IP) and phosphotyrosine
    Figure Legend Snippet: The transition to EGF independence results in the acquisition of dominant signaling activity by HER-2. A, MCF-10AHER2, MCF-10HER2/E7, or SUM-225 cells were exposed to CP724,714 for 1 to 6 h, followed by EGFR immunoprecipitation (IP) and phosphotyrosine

    Techniques Used: Activity Assay, Immunoprecipitation

    19) Product Images from "LncRNA-TUSC7/miR-224 affected chemotherapy resistance of esophageal squamous cell carcinoma by competitively regulating DESC1"

    Article Title: LncRNA-TUSC7/miR-224 affected chemotherapy resistance of esophageal squamous cell carcinoma by competitively regulating DESC1

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-018-0724-4

    miR-224 targetedly regulated DESC1 expression. a Online bioinformatics software microrna.org predicted there was potential binding site between miR-224 and 3’UTR of DESC1. b Luciferase reporter gene vector containing DESC1 3’UTR WT or DESC1 3’UTR MUT, miR-224 mimic or pre-NC or miR-224 inhibitor or NC were co-transfected into HEK293T cells. Dual-luciferase reporter gene assay showed that miR-224 mimic or miR-224 inhibitor decreased or increased the activity of DESC1 WT, and did not significantly change the activity of DESC1 MUT. c-e EC9706 or KYSE30 cells were transfected with miR-224 mimic or miR-224 inhibitor or controls. qRT-PCR and Western blot showed that miR-224 mimic or miR-224 inhibitor significantly decreased or increased mRNA level ( c ) and protein level ( d ) of DESC1, and increased or decreased protein level of EGFR and p-AKT ( e ). f mRNA level of DESC1 was downregulated in ESCC tissues
    Figure Legend Snippet: miR-224 targetedly regulated DESC1 expression. a Online bioinformatics software microrna.org predicted there was potential binding site between miR-224 and 3’UTR of DESC1. b Luciferase reporter gene vector containing DESC1 3’UTR WT or DESC1 3’UTR MUT, miR-224 mimic or pre-NC or miR-224 inhibitor or NC were co-transfected into HEK293T cells. Dual-luciferase reporter gene assay showed that miR-224 mimic or miR-224 inhibitor decreased or increased the activity of DESC1 WT, and did not significantly change the activity of DESC1 MUT. c-e EC9706 or KYSE30 cells were transfected with miR-224 mimic or miR-224 inhibitor or controls. qRT-PCR and Western blot showed that miR-224 mimic or miR-224 inhibitor significantly decreased or increased mRNA level ( c ) and protein level ( d ) of DESC1, and increased or decreased protein level of EGFR and p-AKT ( e ). f mRNA level of DESC1 was downregulated in ESCC tissues

    Techniques Used: Expressing, Software, Binding Assay, Luciferase, Plasmid Preparation, Transfection, Reporter Gene Assay, Activity Assay, Quantitative RT-PCR, Western Blot

    TUSC7 inhibited cell proliferation and chemotherapy resistance via miR-224/DESC1. EC9706 or KYSE30 cells were divided into four groups: pcDNA, pcDNA-TUSC7, pcDNA-TUSC7 + NC, and pcDNA-TUSC7 + miR-224 mimic groups. a MTT assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on cell proliferation. b Colony formation assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on colony formation. c Flow cytometry showed that miR-224 mimic reversed the promotion effect of pcDNA-TUSC7 on cell apoptosis. d After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. e After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. f pcDNA-TUSC7 increased protein level of DESC1 and decreased the expression of EGFR and p-AKT, while miR-224 mimic reversed these effects
    Figure Legend Snippet: TUSC7 inhibited cell proliferation and chemotherapy resistance via miR-224/DESC1. EC9706 or KYSE30 cells were divided into four groups: pcDNA, pcDNA-TUSC7, pcDNA-TUSC7 + NC, and pcDNA-TUSC7 + miR-224 mimic groups. a MTT assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on cell proliferation. b Colony formation assay showed that miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on colony formation. c Flow cytometry showed that miR-224 mimic reversed the promotion effect of pcDNA-TUSC7 on cell apoptosis. d After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. e After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, miR-224 mimic reversed the inhibition effect of pcDNA-TUSC7 on chemotherapy resistance. f pcDNA-TUSC7 increased protein level of DESC1 and decreased the expression of EGFR and p-AKT, while miR-224 mimic reversed these effects

    Techniques Used: MTT Assay, Inhibition, Colony Assay, Flow Cytometry, Cytometry, Expressing

    DESC1 inhibited chemotherapy resistance of ESCC cells via EGFR/AKT. EC9706 or KYSE30 cells were divided into four groups: si-NC, si-DESC1, si- DESC1 + DMSO, and si-DESC1 + AST1306 (EGFR inhibitor, 1 μM,24 h) groups. a After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. b After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. c si-DESC1 upregulated the expressions of EGFR and p-AKT, while AST1306 reversed this effect
    Figure Legend Snippet: DESC1 inhibited chemotherapy resistance of ESCC cells via EGFR/AKT. EC9706 or KYSE30 cells were divided into four groups: si-NC, si-DESC1, si- DESC1 + DMSO, and si-DESC1 + AST1306 (EGFR inhibitor, 1 μM,24 h) groups. a After the treatment of cisplatin (0, 1, 2, 4, 8, 16 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. b After the treatment of 5-Fu (0, 1, 4, 16, 32, 64 μM) for 48 h, si-DESC1 promoted chemotherapy resistance of ESCC cells, while AST1306 reversed this effect. c si-DESC1 upregulated the expressions of EGFR and p-AKT, while AST1306 reversed this effect

    Techniques Used:

    Related Articles

    Labeling:

    Article Title: Enhancement of Immune Effector Functions by Modulating IgG’s Intrinsic Affinity for Target Antigen
    Article Snippet: Receptor density analysis Receptor density studies were performed by flow cytometry on a MACSQuant VYB (Miltenyl Biotec) essentially as described [ ]. .. Briefly, anti-CD4 (ibalizumab), anti-EGFR (GA201) and anti-HER2 (B1D2) IgGs were first labeled with Alexa Fluor 647 labeling kit (Invitrogen) according to the manufacturer’s instructions. .. Antibody concentration and fluorochrome to protein (F:P) ratio were calculated by a ND-1000 spectrophotomer (NanoDrop).

    Immunohistochemistry:

    Article Title: Phosphorylated Epidermal Growth Factor Receptor on Tumor-Associated Endothelial Cells Is a Primary Target for Therapy with Tyrosine Kinase Inhibitors 1
    Article Snippet: Irinotecan (Camptozar; Pharmacia, Kalamazoo, MI) was kept at room temperature and dissolved in 0.9% NaCl on the day of intraperitoneal (i.p.) injection. .. Primary antibodies used were as follows: rabbit anti-phosphorylated EGFR (pEGFR; Tyr1173 ; Biosource, Camarillo, CA); mouse anti-EGFR (Zymed, San Francisco, CA); mouse anti-TGF-α (Oncogene, Boston, MA) rabbit anti-EGF (Santa Cruz Biotechnology); rat anti-mouse CD31 (BD PharMingen, San Diego, CA); and rabbit anti-Ki-67 antigen (Vector Laboratories, Burlingame, CA) for immunohistochemistry, and rabbit anti-EGFR (SC03; Santa Cruz Biotechnology) for Western blot analysis. .. The following secondary antibodies were used for colorimetric immunohistochemistry: peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA); peroxidase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories); and peroxidase-conjugated goat anti-rat IgG (Jackson ImmunoResearch Laboratories).

    Western Blot:

    Article Title: Phosphorylated Epidermal Growth Factor Receptor on Tumor-Associated Endothelial Cells Is a Primary Target for Therapy with Tyrosine Kinase Inhibitors 1
    Article Snippet: Irinotecan (Camptozar; Pharmacia, Kalamazoo, MI) was kept at room temperature and dissolved in 0.9% NaCl on the day of intraperitoneal (i.p.) injection. .. Primary antibodies used were as follows: rabbit anti-phosphorylated EGFR (pEGFR; Tyr1173 ; Biosource, Camarillo, CA); mouse anti-EGFR (Zymed, San Francisco, CA); mouse anti-TGF-α (Oncogene, Boston, MA) rabbit anti-EGF (Santa Cruz Biotechnology); rat anti-mouse CD31 (BD PharMingen, San Diego, CA); and rabbit anti-Ki-67 antigen (Vector Laboratories, Burlingame, CA) for immunohistochemistry, and rabbit anti-EGFR (SC03; Santa Cruz Biotechnology) for Western blot analysis. .. The following secondary antibodies were used for colorimetric immunohistochemistry: peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA); peroxidase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories); and peroxidase-conjugated goat anti-rat IgG (Jackson ImmunoResearch Laboratories).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher monoclonal egfr mouse antibody
    Immunohistochemical stain of lung adenocarcinoma. Control pan-cytokeratin antibody stains all tissue samples regardless of <t>EGFR</t> mutation status. Case 1 . A sample with wild-type EGFR was not stained with total EGFR, L858R and delE746-A750 antibodies. Case 2 . A sample with delE746-A750 was stained with both total EGFR and delE746-A750 specific antibody. Case 3. A sample with L858R was stained with both total EGFR and L858R specific antibody. Case 4. A sample with wild-type EGFR was stained with moderate intensity of total EGFR and mild intensity of L858R specific antibody.
    Monoclonal Egfr Mouse Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/monoclonal egfr mouse antibody/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    monoclonal egfr mouse antibody - by Bioz Stars, 2021-05
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher biotin conjugated egfr antibody
    Comparison of equilibrium dissociation constants of <t>EGFR</t> and β2-AR homodimerization under ligand treatment and cholesterol sequestration. K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; <t>SNAP,</t> SNAP-tag.
    Biotin Conjugated Egfr Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotin conjugated egfr antibody/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    biotin conjugated egfr antibody - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher anti egfr antibody
    Baculovirus-expressing <t>EGFR</t> production. A , Map of the EGFR baculovirus using the flashBACULTRA system with a FLAG epitope placed between the leader sequence peptide (Lrig1 SS) and the full-length mammalian EGFR sequence (EGFR). B , Sf9 insect cells were infected with a MOI of 10 of control baculovirus (C) or EGFR baculovirus (E) for 48 hours followed by collection of total cell lysate and Western Blotting to detect EGFR expression. A set of these cells was treated with 10 ng/ml EGF in order to detect ligand-induced receptor phosphorylation. C , Sf9 insect cells were seeded on glass coverslips and infected with an MOI of 10 of control (C) or EGFR (E) baculovirus for 48 hours. Cells were fixed in 4% paraformaldehyde followed by immunostaining with anti-EGFR antibody (in red) with (+P) or without (-P) permeabilization in 100% methanol. The brightfield image shows cell morphology. Cells incubated with secondary antibody in the absence of EGFR antibody (no primary) were used as a negative control. D , FLAG-EGFR is readily purified from Sf9 insect cells as shown by a representative image of anti-EGFR immunoblot of FLAG EGFR purification and E , a Coomassie-stained SDS-PAGE gel. Bovine serum albumin (BSA) was loaded as a protein of known concentration. Total insect cell lysate starting material (SM), purification washes 1, 3 (W1, W3), and elution (E) were loaded to show efficiency of the FLAG-purification.
    Anti Egfr Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti egfr antibody/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti egfr antibody - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher mouse anti egfr
    Colocalization of H2-I with <t>EGFR.</t> W12 cells (a) were processed for immunofluorescence as described in Materials and Methods and incubated with (b) H2-I antibody (in green) and (c) anti-EGFR antibody (in red). Merged images (d) show the colocalization of <t>HPV-16</t> E5 and EGFR (in yellow).
    Mouse Anti Egfr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti egfr/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse anti egfr - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Immunohistochemical stain of lung adenocarcinoma. Control pan-cytokeratin antibody stains all tissue samples regardless of EGFR mutation status. Case 1 . A sample with wild-type EGFR was not stained with total EGFR, L858R and delE746-A750 antibodies. Case 2 . A sample with delE746-A750 was stained with both total EGFR and delE746-A750 specific antibody. Case 3. A sample with L858R was stained with both total EGFR and L858R specific antibody. Case 4. A sample with wild-type EGFR was stained with moderate intensity of total EGFR and mild intensity of L858R specific antibody.

    Journal: PLoS ONE

    Article Title: Including Total EGFR Staining in Scoring Improves EGFR Mutations Detection by Mutation-Specific Antibodies and EGFR TKIs Response Prediction

    doi: 10.1371/journal.pone.0023303

    Figure Lengend Snippet: Immunohistochemical stain of lung adenocarcinoma. Control pan-cytokeratin antibody stains all tissue samples regardless of EGFR mutation status. Case 1 . A sample with wild-type EGFR was not stained with total EGFR, L858R and delE746-A750 antibodies. Case 2 . A sample with delE746-A750 was stained with both total EGFR and delE746-A750 specific antibody. Case 3. A sample with L858R was stained with both total EGFR and L858R specific antibody. Case 4. A sample with wild-type EGFR was stained with moderate intensity of total EGFR and mild intensity of L858R specific antibody.

    Article Snippet: We also performed IHC staining for total EGFR protein using the monoclonal EGFR mouse antibody (clone 31G7, dilution 1∶150, Invitrogen, CA).

    Techniques: Immunohistochemistry, Staining, Mutagenesis

    Receiver–operator characteristic (ROC) curve of EGFR mutation-specific antibodies IHC in predicting L858R or E746-A750. (A) AUC for the logistic regression model based on L858R Q score and total EGFR expression Q score was higher than that for L858R intensity only (0.891 vs. 0.853; p = 0.036). (B) the logistic regression model based on delE746-A750 Q score and total EGFR expression intensity had a trend of higher AUC than that for delE746-A750 intensity only (0.969 vs. 0.958; p = 0.087). AUC: area under the ROC curve.

    Journal: PLoS ONE

    Article Title: Including Total EGFR Staining in Scoring Improves EGFR Mutations Detection by Mutation-Specific Antibodies and EGFR TKIs Response Prediction

    doi: 10.1371/journal.pone.0023303

    Figure Lengend Snippet: Receiver–operator characteristic (ROC) curve of EGFR mutation-specific antibodies IHC in predicting L858R or E746-A750. (A) AUC for the logistic regression model based on L858R Q score and total EGFR expression Q score was higher than that for L858R intensity only (0.891 vs. 0.853; p = 0.036). (B) the logistic regression model based on delE746-A750 Q score and total EGFR expression intensity had a trend of higher AUC than that for delE746-A750 intensity only (0.969 vs. 0.958; p = 0.087). AUC: area under the ROC curve.

    Article Snippet: We also performed IHC staining for total EGFR protein using the monoclonal EGFR mouse antibody (clone 31G7, dilution 1∶150, Invitrogen, CA).

    Techniques: Mutagenesis, Immunohistochemistry, Expressing

    Comparison of equilibrium dissociation constants of EGFR and β2-AR homodimerization under ligand treatment and cholesterol sequestration. K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

    Journal: PLoS Biology

    Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

    doi: 10.1371/journal.pbio.2006660

    Figure Lengend Snippet: Comparison of equilibrium dissociation constants of EGFR and β2-AR homodimerization under ligand treatment and cholesterol sequestration. K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

    Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

    Techniques:

    Equilibrium dissociation constant of EGFR pre-dimerization is determined using Co-II. (A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p

    Journal: PLoS Biology

    Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

    doi: 10.1371/journal.pbio.2006660

    Figure Lengend Snippet: Equilibrium dissociation constant of EGFR pre-dimerization is determined using Co-II. (A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p

    Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

    Techniques: Labeling, Diffusion-based Assay, Fluorescence, Expressing, Binding Assay

    Membrane protein interactions are directly visualized using co-immunoimmobilization (Co-II). (A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

    Journal: PLoS Biology

    Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

    doi: 10.1371/journal.pbio.2006660

    Figure Lengend Snippet: Membrane protein interactions are directly visualized using co-immunoimmobilization (Co-II). (A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

    Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

    Techniques: Ii Assay, Labeling, Produced, Expressing, Fluorescence, Förster Resonance Energy Transfer, Variant Assay, Single-particle Tracking, Microscopy

    Baculovirus-expressing EGFR production. A , Map of the EGFR baculovirus using the flashBACULTRA system with a FLAG epitope placed between the leader sequence peptide (Lrig1 SS) and the full-length mammalian EGFR sequence (EGFR). B , Sf9 insect cells were infected with a MOI of 10 of control baculovirus (C) or EGFR baculovirus (E) for 48 hours followed by collection of total cell lysate and Western Blotting to detect EGFR expression. A set of these cells was treated with 10 ng/ml EGF in order to detect ligand-induced receptor phosphorylation. C , Sf9 insect cells were seeded on glass coverslips and infected with an MOI of 10 of control (C) or EGFR (E) baculovirus for 48 hours. Cells were fixed in 4% paraformaldehyde followed by immunostaining with anti-EGFR antibody (in red) with (+P) or without (-P) permeabilization in 100% methanol. The brightfield image shows cell morphology. Cells incubated with secondary antibody in the absence of EGFR antibody (no primary) were used as a negative control. D , FLAG-EGFR is readily purified from Sf9 insect cells as shown by a representative image of anti-EGFR immunoblot of FLAG EGFR purification and E , a Coomassie-stained SDS-PAGE gel. Bovine serum albumin (BSA) was loaded as a protein of known concentration. Total insect cell lysate starting material (SM), purification washes 1, 3 (W1, W3), and elution (E) were loaded to show efficiency of the FLAG-purification.

    Journal: PLoS ONE

    Article Title: Synthesis and biochemical characterization of EGF receptor in a water-soluble membrane model system

    doi: 10.1371/journal.pone.0177761

    Figure Lengend Snippet: Baculovirus-expressing EGFR production. A , Map of the EGFR baculovirus using the flashBACULTRA system with a FLAG epitope placed between the leader sequence peptide (Lrig1 SS) and the full-length mammalian EGFR sequence (EGFR). B , Sf9 insect cells were infected with a MOI of 10 of control baculovirus (C) or EGFR baculovirus (E) for 48 hours followed by collection of total cell lysate and Western Blotting to detect EGFR expression. A set of these cells was treated with 10 ng/ml EGF in order to detect ligand-induced receptor phosphorylation. C , Sf9 insect cells were seeded on glass coverslips and infected with an MOI of 10 of control (C) or EGFR (E) baculovirus for 48 hours. Cells were fixed in 4% paraformaldehyde followed by immunostaining with anti-EGFR antibody (in red) with (+P) or without (-P) permeabilization in 100% methanol. The brightfield image shows cell morphology. Cells incubated with secondary antibody in the absence of EGFR antibody (no primary) were used as a negative control. D , FLAG-EGFR is readily purified from Sf9 insect cells as shown by a representative image of anti-EGFR immunoblot of FLAG EGFR purification and E , a Coomassie-stained SDS-PAGE gel. Bovine serum albumin (BSA) was loaded as a protein of known concentration. Total insect cell lysate starting material (SM), purification washes 1, 3 (W1, W3), and elution (E) were loaded to show efficiency of the FLAG-purification.

    Article Snippet: Cells were washed in PBS, blocked in 5% BSA, incubated with anti-EGFR antibody followed by anti-rabbit Alexa Flour 555 antibody (Thermo Fisher), mounted with fluoromount G (SouthernBiotech), and imaged.

    Techniques: Expressing, FLAG-tag, Sequencing, Infection, Western Blot, Immunostaining, Incubation, Negative Control, Purification, Staining, SDS Page, Concentration Assay

    EGFR incorporation in self-assembled NLPs. A , P1 and P2 SEC fractions were collected and spotted onto nitrocellulose membrane followed by immunoblotting with anti-ApoA1 and anti-EGFR antibodies showing that the majority of EGFR is incorporated into the higher molecular weight NLPs of the P1 fraction. B , Indicated NLPs were separated by denaturing SDS-PAGE and analyzed with anti-pEGFR, anti-EGFR, and anti-ApoA1 antibodies. Numbers indicate band intensity relative to EGFR-NLP normalized to ApoA1 signal. C , Purified Empty and EGFR-NLPs were separated by NativePAGE gels and immunostained with anti-pY20 and anti-EGFR antibodies showing EGFR expression in the higher molecular weight ranges above 480 kDa. D , Bar graph of determination of EGFR insertion into NLP. Total amount of EGFR in the NLP assembly mixture and purified EGFR-NLPs were determined by ELISA and EGFR insertion rate indicated. The values represent the mean ± standard error of the mean (SEM) for two technical replicates. E , EGFR-NLPs were extracted with PBS (control) or sodium carbonate (Na 2 CO 3 ), centrifuged to separate the supernatant containing NLPs (S) and pellet containing insoluble free protein (P), separated by denaturing SDS-PAGE, and analyzed with anti-EGFR antibody showing that EGFR is not susceptible to carbonate extraction.

    Journal: PLoS ONE

    Article Title: Synthesis and biochemical characterization of EGF receptor in a water-soluble membrane model system

    doi: 10.1371/journal.pone.0177761

    Figure Lengend Snippet: EGFR incorporation in self-assembled NLPs. A , P1 and P2 SEC fractions were collected and spotted onto nitrocellulose membrane followed by immunoblotting with anti-ApoA1 and anti-EGFR antibodies showing that the majority of EGFR is incorporated into the higher molecular weight NLPs of the P1 fraction. B , Indicated NLPs were separated by denaturing SDS-PAGE and analyzed with anti-pEGFR, anti-EGFR, and anti-ApoA1 antibodies. Numbers indicate band intensity relative to EGFR-NLP normalized to ApoA1 signal. C , Purified Empty and EGFR-NLPs were separated by NativePAGE gels and immunostained with anti-pY20 and anti-EGFR antibodies showing EGFR expression in the higher molecular weight ranges above 480 kDa. D , Bar graph of determination of EGFR insertion into NLP. Total amount of EGFR in the NLP assembly mixture and purified EGFR-NLPs were determined by ELISA and EGFR insertion rate indicated. The values represent the mean ± standard error of the mean (SEM) for two technical replicates. E , EGFR-NLPs were extracted with PBS (control) or sodium carbonate (Na 2 CO 3 ), centrifuged to separate the supernatant containing NLPs (S) and pellet containing insoluble free protein (P), separated by denaturing SDS-PAGE, and analyzed with anti-EGFR antibody showing that EGFR is not susceptible to carbonate extraction.

    Article Snippet: Cells were washed in PBS, blocked in 5% BSA, incubated with anti-EGFR antibody followed by anti-rabbit Alexa Flour 555 antibody (Thermo Fisher), mounted with fluoromount G (SouthernBiotech), and imaged.

    Techniques: Size-exclusion Chromatography, Molecular Weight, SDS Page, Purification, Expressing, Enzyme-linked Immunosorbent Assay

    Colocalization of H2-I with EGFR. W12 cells (a) were processed for immunofluorescence as described in Materials and Methods and incubated with (b) H2-I antibody (in green) and (c) anti-EGFR antibody (in red). Merged images (d) show the colocalization of HPV-16 E5 and EGFR (in yellow).

    Journal: BioMed Research International

    Article Title: Development of Novel Single-Chain Antibodies against the Hydrophobic HPV-16 E5 Protein

    doi: 10.1155/2018/5809028

    Figure Lengend Snippet: Colocalization of H2-I with EGFR. W12 cells (a) were processed for immunofluorescence as described in Materials and Methods and incubated with (b) H2-I antibody (in green) and (c) anti-EGFR antibody (in red). Merged images (d) show the colocalization of HPV-16 E5 and EGFR (in yellow).

    Article Snippet: This labeling was performed after the immunostaining of HPV-16 E5 by incubating the coverslip with mouse anti-EGFR (dilution 1:100, ThermoFisher) and following the same procedure as described in .

    Techniques: Immunofluorescence, Incubation