antarctic phosphatase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Antarctic Phosphatase
    Description:
    Antarctic Phosphatase 5 000 units
    Catalog Number:
    M0289L
    Price:
    289
    Category:
    Alkaline Phosphatases
    Size:
    5 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs antarctic phosphatase
    Antarctic Phosphatase
    Antarctic Phosphatase 5 000 units
    https://www.bioz.com/result/antarctic phosphatase/product/New England Biolabs
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antarctic phosphatase - by Bioz Stars, 2021-07
    98/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: The dynamic N1-methyladenosine methylome in eukaryotic messenger RNA
    Article Snippet: .. Subsequently, 5 units (1 μl) of Antarctic Phosphatase (New England Biolabs) and 1 × Antarctic Phosphatase reaction buffer were added and the sample was incubated for another 2 h at 37 °C. ..

    Plasmid Preparation:

    Article Title: A platform for discovery of functional cell-penetrating peptides for efficient multi-cargo intracellular delivery
    Article Snippet: T7mid-EBD-HA-Avi vector was produced with a Lambda DNA Purification Kit (Agilent) and T7Select Phage Display System (Novagen). .. The vector was prepared for cloning by digestion with EcoR I-HF (NEB, 10 U/μg) for 2 h at 37 °C, heat inactivated at 65 °C for 5 min; dephosphorylated with Antarctic Phosphatase (NEB, 2 U/μg) for 20 min at 37 °C, and heat inactivated at 65 °C for 20 min. .. The T12 viral sequences were created from selected viral proteins and synthesized in pUC57-Kan (Genscript), codon optimizing for both expression in E . coli and removal of BamH I and Mfe I restriction sites.

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Clone Assay:

    Article Title: A platform for discovery of functional cell-penetrating peptides for efficient multi-cargo intracellular delivery
    Article Snippet: T7mid-EBD-HA-Avi vector was produced with a Lambda DNA Purification Kit (Agilent) and T7Select Phage Display System (Novagen). .. The vector was prepared for cloning by digestion with EcoR I-HF (NEB, 10 U/μg) for 2 h at 37 °C, heat inactivated at 65 °C for 5 min; dephosphorylated with Antarctic Phosphatase (NEB, 2 U/μg) for 20 min at 37 °C, and heat inactivated at 65 °C for 20 min. .. The T12 viral sequences were created from selected viral proteins and synthesized in pUC57-Kan (Genscript), codon optimizing for both expression in E . coli and removal of BamH I and Mfe I restriction sites.

    Synthesized:

    Article Title: Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense
    Article Snippet: The cDNA was synthesized from the total RNA with SuperScript Double-Stranded cDNA Synthesis Kit (11917-010, Invitrogen, Carlsbad, CA, USA). .. The synthesized cDNA was phosphorylated using T4 Polynucleotide Kinase. pRSET-TriEX was digested with SmaI and dephosphorylated with Antarctic Phosphatase (New England Biolabs Inc.). .. The phosphorylated cDNA and linear dephosphorylated pRSET-TriEX were ligated and subjected to JM109(DE3) transformation.

    Purification:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Agarose Gel Electrophoresis:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Polymerase Chain Reaction:

    Article Title: Fluorescence detection of DNA mismatch repair in human cells
    Article Snippet: The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively). .. Aliquots of these solutions (1 μl and 3 μl, respectively) were mixed, and after the addition of DNA ligation mix (Takara Bio, 4 μl), the mixture was incubated at room temperature for 30 min. Escherichia coli DH5α competent cells (Takara Bio, 50 μl) were mixed with the ligation mixture (4 μl) on ice, and cultured on Luria-Bertani (LB) agar plates with ampicillin overnight.

    Non-Homologous End Joining:

    Article Title: Dissection of DNA double-strand break repair using novel single-molecule forceps
    Article Snippet: Restriction enzyme was heat inactivated as per manufacturer recommendation, and construct was diluted 30-fold to a nominal DNA concentration of 100 pM and stored at −20°C. .. For experiments conducted using dephosphorylated DNA as a substrate for NHEJ, we dephosphorylated the construct by combining into a 10 μl reaction volume 2 units of antarctic phosphatase (New England Biolabs) and 0.6 fmoles of the ligation product obtained in the previous paragraph. .. For assembly onto the microscope, the ligation reaction was first diluted sixty-fold to 50 pM nominal concentration of DNA in Tris buffer (10 mM TrisCl pH 8).

    Construct:

    Article Title: Dissection of DNA double-strand break repair using novel single-molecule forceps
    Article Snippet: Restriction enzyme was heat inactivated as per manufacturer recommendation, and construct was diluted 30-fold to a nominal DNA concentration of 100 pM and stored at −20°C. .. For experiments conducted using dephosphorylated DNA as a substrate for NHEJ, we dephosphorylated the construct by combining into a 10 μl reaction volume 2 units of antarctic phosphatase (New England Biolabs) and 0.6 fmoles of the ligation product obtained in the previous paragraph. .. For assembly onto the microscope, the ligation reaction was first diluted sixty-fold to 50 pM nominal concentration of DNA in Tris buffer (10 mM TrisCl pH 8).

    Ligation:

    Article Title: Dissection of DNA double-strand break repair using novel single-molecule forceps
    Article Snippet: Restriction enzyme was heat inactivated as per manufacturer recommendation, and construct was diluted 30-fold to a nominal DNA concentration of 100 pM and stored at −20°C. .. For experiments conducted using dephosphorylated DNA as a substrate for NHEJ, we dephosphorylated the construct by combining into a 10 μl reaction volume 2 units of antarctic phosphatase (New England Biolabs) and 0.6 fmoles of the ligation product obtained in the previous paragraph. .. For assembly onto the microscope, the ligation reaction was first diluted sixty-fold to 50 pM nominal concentration of DNA in Tris buffer (10 mM TrisCl pH 8).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs vector pil253
    Western hybridization using the NsoA1 leader antibody to detect pre-peptide production in UKLc10. Comparison of L. lactis TCA-precipitated culture supernatant extracts (lanes 1–5) or cell extracts (lanes 6–11) from UKLc10 (lanes 1, 2, 4–8, 10 and 11) or MG1614 (lanes 3 and 9) containing plasmids p nsoA Δ A (lanes 1 and 11), p nsoA (lanes 2, 6 and 10), p nsoA Δ A , pTG nsoA3-nsoA4 (lanes 3 and 9), <t>pIL253</t> (lanes 4 and 8) and p nsoA pTG nsoA3-nsoA4 (lanes 5 and 7). Samples were induced with nisin for 3 h, except for lane 6 (2 h). M, marker.
    Vector Pil253, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector pil253/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vector pil253 - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs antarctic phosphatase
    Western hybridization using the NsoA1 leader antibody to detect pre-peptide production in UKLc10. Comparison of L. lactis TCA-precipitated culture supernatant extracts (lanes 1–5) or cell extracts (lanes 6–11) from UKLc10 (lanes 1, 2, 4–8, 10 and 11) or MG1614 (lanes 3 and 9) containing plasmids p nsoA Δ A (lanes 1 and 11), p nsoA (lanes 2, 6 and 10), p nsoA Δ A , pTG nsoA3-nsoA4 (lanes 3 and 9), <t>pIL253</t> (lanes 4 and 8) and p nsoA pTG nsoA3-nsoA4 (lanes 5 and 7). Samples were induced with nisin for 3 h, except for lane 6 (2 h). M, marker.
    Antarctic Phosphatase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antarctic phosphatase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antarctic phosphatase - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Western hybridization using the NsoA1 leader antibody to detect pre-peptide production in UKLc10. Comparison of L. lactis TCA-precipitated culture supernatant extracts (lanes 1–5) or cell extracts (lanes 6–11) from UKLc10 (lanes 1, 2, 4–8, 10 and 11) or MG1614 (lanes 3 and 9) containing plasmids p nsoA Δ A (lanes 1 and 11), p nsoA (lanes 2, 6 and 10), p nsoA Δ A , pTG nsoA3-nsoA4 (lanes 3 and 9), pIL253 (lanes 4 and 8) and p nsoA pTG nsoA3-nsoA4 (lanes 5 and 7). Samples were induced with nisin for 3 h, except for lane 6 (2 h). M, marker.

    Journal: Microbiology

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract

    doi: 10.1099/mic.0.000515

    Figure Lengend Snippet: Western hybridization using the NsoA1 leader antibody to detect pre-peptide production in UKLc10. Comparison of L. lactis TCA-precipitated culture supernatant extracts (lanes 1–5) or cell extracts (lanes 6–11) from UKLc10 (lanes 1, 2, 4–8, 10 and 11) or MG1614 (lanes 3 and 9) containing plasmids p nsoA Δ A (lanes 1 and 11), p nsoA (lanes 2, 6 and 10), p nsoA Δ A , pTG nsoA3-nsoA4 (lanes 3 and 9), pIL253 (lanes 4 and 8) and p nsoA pTG nsoA3-nsoA4 (lanes 5 and 7). Samples were induced with nisin for 3 h, except for lane 6 (2 h). M, marker.

    Article Snippet: A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso.

    Techniques: Western Blot, Hybridization, Marker

    RNA 3 ′ -terminal phosphate modifications with MthRnl. A , gel shift analysis of archaeal RNA ligase (MthRnl) reaction products of either FAM-RNA17p ( column I ) or FAM-RNA17(OMe)p ( column II ) followed by phosphatase treatment with either AnP or PNK.

    Journal: The Journal of Biological Chemistry

    Article Title: Polynucleotide 3′-terminal Phosphate Modifications by RNA and DNA Ligases

    doi: 10.1074/jbc.M114.612929

    Figure Lengend Snippet: RNA 3 ′ -terminal phosphate modifications with MthRnl. A , gel shift analysis of archaeal RNA ligase (MthRnl) reaction products of either FAM-RNA17p ( column I ) or FAM-RNA17(OMe)p ( column II ) followed by phosphatase treatment with either AnP or PNK.

    Article Snippet: Antarctic phosphatase (AnP), T4 PNK, and yeast 5′Deadenylase were from New England Biolabs.

    Techniques: Electrophoretic Mobility Shift Assay, Aqueous Normal-phase Chromatography