ampure xp beads  (Beckman Coulter)


Bioz Verified Symbol Beckman Coulter is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Beckman Coulter ampure xp beads
    Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 574 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 574 article reviews
    Price from $9.99 to $1999.99
    ampure xp beads - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Sensitive Assay:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Magnetic Beads:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Purification:

    Article Title: Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network
    Article Snippet: .. The volume of used AMPure XP beads was 46.8ul at 1st purification and 40ul at 2nd purification. ..

    Article Title: MAPS integrates overlooked regulation of actin-targeting effector SteC into the virulence control network of Salmonella small RNA PinT
    Article Snippet: .. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. .. For Illumina NextSeq sequencing, the samples were pooled in approximately equimolar amounts.

    Article Title: Esrrb is a cell cycle dependent priming factor balancing between pluripotency and differentiation
    Article Snippet: .. The ligated product was purified with 1.5x reaction volume of AMPure XP beads (Beckman Coulter, A63881) and eluted in 11.5 μl TE buffer. .. The resulting libraries were PCR amplified using standard PE1/PE2 full-length primer mix containing Illumina library indices for multiplexing (sequences are given in Supplementary Table X).

    Article Title: Temporal and Spatial Heterogeneity of Host Response to SARS-CoV-2 Pulmonary Infection
    Article Snippet: .. PCR reactions were purified with two rounds of AMPure XP beads (Beckman Coulter) at 1.2x beadto-sample ratio. ..

    Article Title: Epigenetic age-predictions in mice using pyrosequencing, droplet digital PCR or barcoded bisulfite amplicon sequencing
    Article Snippet: .. The three amplicons of each donor were pooled at equal concentrations under the quantification of Qubit (Invitrogen), and cleaned up with paramagnetic beads from Agencourt AMPure XP PCR Purification system (Beckman Coulter). .. 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit, Bioo Scientific, Austin, USA) for a second amplification (95°C for 15 min; 16 cycles of 95°C for 30 s, 60°C for 30s, 72°C for 30s; final elongation 72°C for 10min).

    Article Title: Esrrb is a cell cycle dependent priming factor balancing between pluripotency and differentiation
    Article Snippet: .. DNA was purified using ratio of 1:1.8 sample to AMPure XP beads. .. Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs).

    Electrophoresis:

    Article Title: MAPS integrates overlooked regulation of actin-targeting effector SteC into the virulence control network of Salmonella small RNA PinT
    Article Snippet: .. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. .. For Illumina NextSeq sequencing, the samples were pooled in approximately equimolar amounts.

    Polymerase Chain Reaction:

    Article Title: Temporal and Spatial Heterogeneity of Host Response to SARS-CoV-2 Pulmonary Infection
    Article Snippet: .. PCR reactions were purified with two rounds of AMPure XP beads (Beckman Coulter) at 1.2x beadto-sample ratio. ..

    Article Title: Epigenetic age-predictions in mice using pyrosequencing, droplet digital PCR or barcoded bisulfite amplicon sequencing
    Article Snippet: .. The three amplicons of each donor were pooled at equal concentrations under the quantification of Qubit (Invitrogen), and cleaned up with paramagnetic beads from Agencourt AMPure XP PCR Purification system (Beckman Coulter). .. 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit, Bioo Scientific, Austin, USA) for a second amplification (95°C for 15 min; 16 cycles of 95°C for 30 s, 60°C for 30s, 72°C for 30s; final elongation 72°C for 10min).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Beckman Coulter ampure xp beads
    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of <t>PCR</t> with <t>AMPure</t> XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).
    Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 94/100, based on 574 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampure xp beads/product/Beckman Coulter
    Average 94 stars, based on 574 article reviews
    Price from $9.99 to $1999.99
    ampure xp beads - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Journal: PLoS ONE

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding

    doi: 10.1371/journal.pone.0206253

    Figure Lengend Snippet: cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Article Snippet: For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles.

    Techniques: Chromatin Immunoprecipitation, Transfection, Polymerase Chain Reaction, Amplification, Western Blot

    Improved DNA size selection using an adapted PEG‐NaCl‐SPRI beads protocol. Each lane represents 150 ng DNA before size selection. Lanes 0 contain the HyperLadder 1 kb (BioLine) as untreated control. Lanes 1–3 are DNA ladder size selected with 0.4 vol, 0.45 vol, and 0.5 vol (V/V) Agencourt AMPure XP beads. Lanes 4–6 are DNA ladder size selected with 0.8 vol, 0.9 vol, 1.0 vol (V/V) of the adapted PEG‐NaCl‐SPRI beads solution without Tween 20 (Schalamun Schwessinger, 2017a ). Lanes 7–9 are DNA ladder size selected with 0.8 vol, 0.9 vol, 1.0 vol (V/V) of the adapted PEG‐NaCl‐SPRI beads solution with 0.25% Tween‐20 (Nagar Schwessinger, 2018a )

    Journal: Molecular Ecology Resources

    Article Title: Harnessing the MinION: An example of how to establish long‐read sequencing in a laboratory using challenging plant tissue from Eucalyptus pauciflora, et al. Harnessing the MinION: An example of how to establish long‐read sequencing in a laboratory using challenging plant tissue from Eucalyptus pauciflora

    doi: 10.1111/1755-0998.12938

    Figure Lengend Snippet: Improved DNA size selection using an adapted PEG‐NaCl‐SPRI beads protocol. Each lane represents 150 ng DNA before size selection. Lanes 0 contain the HyperLadder 1 kb (BioLine) as untreated control. Lanes 1–3 are DNA ladder size selected with 0.4 vol, 0.45 vol, and 0.5 vol (V/V) Agencourt AMPure XP beads. Lanes 4–6 are DNA ladder size selected with 0.8 vol, 0.9 vol, 1.0 vol (V/V) of the adapted PEG‐NaCl‐SPRI beads solution without Tween 20 (Schalamun Schwessinger, 2017a ). Lanes 7–9 are DNA ladder size selected with 0.8 vol, 0.9 vol, 1.0 vol (V/V) of the adapted PEG‐NaCl‐SPRI beads solution with 0.25% Tween‐20 (Nagar Schwessinger, 2018a )

    Article Snippet: AMPure XP beads can be used to size‐select DNA fragments in the range 100–500 bp (He, Zhu, & Gu, ; Schmitz & Riesner, ).

    Techniques: Selection