ampure xp beads  (Beckman Coulter)


Bioz Verified Symbol Beckman Coulter is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Beckman Coulter ampure xp beads
    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of <t>PCR</t> with <t>AMPure</t> XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).
    Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 1353 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 1353 article reviews
    Price from $9.99 to $1999.99
    ampure xp beads - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding"

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206253

    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).
    Figure Legend Snippet: cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Techniques Used: Chromatin Immunoprecipitation, Transfection, Polymerase Chain Reaction, Amplification, Western Blot

    2) Product Images from "E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding"

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206253

    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).
    Figure Legend Snippet: cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Techniques Used: Chromatin Immunoprecipitation, Transfection, Polymerase Chain Reaction, Amplification, Western Blot

    3) Product Images from "A comparative analysis of exome capture"

    Article Title: A comparative analysis of exome capture

    Journal: Genome Biology

    doi: 10.1186/gb-2011-12-9-r97

    Insert size distributions differed between the sample libraries prepared for the NimbleGen and Agilent exome capture kits . Sample libraries were produced independently and were prepared according to the manufacturer's guidelines. The insert size distributions were generated based on properly mapped and paired reads determined by our capture analysis pipeline. The NimbleGen library preparation process involved agarose gel electrophoresis-based size selection, whereas the Agilent process involved a more relaxed, bead-based size selection using AMPure XP (Beckman Coulter Genomics). Bead-based size selection is useful for removing DNA fragments smaller than 100 bp but less effective than gel-based size selection in producing narrow size distributions. Yet, from a technical standpoint, the gel-based process is more susceptible to variability of mean insert size. The two different size selection processes are illustrated by our group of NimbleGen capture libraries and our group of Agilent capture libraries. PDF, probability distribution function.
    Figure Legend Snippet: Insert size distributions differed between the sample libraries prepared for the NimbleGen and Agilent exome capture kits . Sample libraries were produced independently and were prepared according to the manufacturer's guidelines. The insert size distributions were generated based on properly mapped and paired reads determined by our capture analysis pipeline. The NimbleGen library preparation process involved agarose gel electrophoresis-based size selection, whereas the Agilent process involved a more relaxed, bead-based size selection using AMPure XP (Beckman Coulter Genomics). Bead-based size selection is useful for removing DNA fragments smaller than 100 bp but less effective than gel-based size selection in producing narrow size distributions. Yet, from a technical standpoint, the gel-based process is more susceptible to variability of mean insert size. The two different size selection processes are illustrated by our group of NimbleGen capture libraries and our group of Agilent capture libraries. PDF, probability distribution function.

    Techniques Used: Produced, Generated, Agarose Gel Electrophoresis, Selection

    4) Product Images from "A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples"

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples

    Journal: Nar Genomics and Bioinformatics

    doi: 10.1093/nargab/lqz017

    Work flow of the standard versus DDAT library preparation method. To generate WGS libraries from low-input, degraded DNA, the complete protocol starts with the addition of enzymes SMUG1 (single-strand-selective monofunctional uracil-DNA glycosylase) and Fpg (formamidopyrimidine [fapy]-DNA glycosylase) to the input DNA ( A and B ) that remove damaged bases such as deoxyuracil and 8-oxoguanine, caused by the FFPE treatment. A short denaturation step (B) is followed by the first strand synthesis; during this step, the genomic DNA, primers and Klenow fragment (3′ → 5′ exo-) are gradually heated from 4 to 37°C with a slow ramping speed of 4°C/min, which is an essential reaction condition (see ‘Discussion’ section), before incubation at 37°C for a further 1.5 h ( C ). The primers contain nine random nucleotides from the 3′-end, in addition to the standard Illumina adaptor sequence, and will anneal to complementary DNA sequences present in the DNA sample. After the first strand synthesis, any remaining primers or short ssDNA fragments are digested with exonuclease I and the dsDNA is purified with AMPure XP beads. Next, the dsDNA is denatured to carry out the second strand synthesis using a second adaptor primer also containing nine random nucleotides, with the same conditions as the first synthesis, followed by bead purification (C). Finally, 10 PCR cycles are carried out using standard Illumina p5 and p7 indexed primers ( D ). The library is purified and assessed using standard quality control methods.
    Figure Legend Snippet: Work flow of the standard versus DDAT library preparation method. To generate WGS libraries from low-input, degraded DNA, the complete protocol starts with the addition of enzymes SMUG1 (single-strand-selective monofunctional uracil-DNA glycosylase) and Fpg (formamidopyrimidine [fapy]-DNA glycosylase) to the input DNA ( A and B ) that remove damaged bases such as deoxyuracil and 8-oxoguanine, caused by the FFPE treatment. A short denaturation step (B) is followed by the first strand synthesis; during this step, the genomic DNA, primers and Klenow fragment (3′ → 5′ exo-) are gradually heated from 4 to 37°C with a slow ramping speed of 4°C/min, which is an essential reaction condition (see ‘Discussion’ section), before incubation at 37°C for a further 1.5 h ( C ). The primers contain nine random nucleotides from the 3′-end, in addition to the standard Illumina adaptor sequence, and will anneal to complementary DNA sequences present in the DNA sample. After the first strand synthesis, any remaining primers or short ssDNA fragments are digested with exonuclease I and the dsDNA is purified with AMPure XP beads. Next, the dsDNA is denatured to carry out the second strand synthesis using a second adaptor primer also containing nine random nucleotides, with the same conditions as the first synthesis, followed by bead purification (C). Finally, 10 PCR cycles are carried out using standard Illumina p5 and p7 indexed primers ( D ). The library is purified and assessed using standard quality control methods.

    Techniques Used: Flow Cytometry, Formalin-fixed Paraffin-Embedded, Incubation, Sequencing, Purification, Polymerase Chain Reaction

    Related Articles

    Centrifugation:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: After centrifugation (5 min, 1300 rpm) at 4°C, the pellet was resuspended in 600 ul buffer III (10 mM Tris-HCl, pH8, 100 mM NaCl, 1 mM EDTA, pH8 and 0.5 mM EGTA, 0.1% sodium doxycholate and 0.5% n-lauroylsarcosine) and sonicated at a Bioruptor for 40 min. Triton X-100 was added to a final concentration of 1% and the chromatin preparation was pre-cleared using magnetic beads for 1 h. The HSF1 antibody (Cell Signaling, 4356, 5ug) was coupled to magnetic beads (50ul) for 6 h and subsequently added to the pre-cleared chromatin. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Amplification:

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover. .. After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene (Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported.

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: The transposed DNA fragments were amplified using the NEBNext High-Fidelity 2× PCR Master Mix (M0541) supplied with 2.5 μl of 25 μM barcoded primers and amplification for 13 cycles. .. The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions.

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Libraries were generated as described previously , including end repair, A-tailing, adaptor ligation (Illumina TrueSeq system) and PCR amplification of the libraries. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene ( Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported. .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter).

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Single-cell Hi-C libraries were amplified from the beads by adding 15 µl of Nextera PCR Master Mix, 5 µl of Index 1 primer of choice and 5 µl of Index 2 primer of choice. .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles. .. Library quality was assessed by a bioanalyzer using a High Sensitivity chip.

    Cytometry:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: RNA isolation Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Real-time Polymerase Chain Reaction:

    Article Title: Tissue–selective effects of nucleolar stress and rDNA damage in developmental disorders
    Article Snippet: After 15 min, tubes were removed and mixed with 5 μl of Circligase-II reaction buffer (3.3 μl water, 1.5 μl 10 × Circligase-II buffer, and 0.2 μl of Circligase-II, Epicentre, catalogue number CL9021K). cDNA was circularized in a thermocycler for 1.5 h at 60 °C. cDNA was captured by addition of 30 μl of Ampure XP beads (Beckman Coulter, catalogue number ), 75 μl of isopropanol, and incubation for 15 min (the solution was remixed after 7.5 min). .. The tubes were then placed in a Stratagene MX3000P qPCR machine with the following program: 98 °C for 2 min, 15 cycles of 98 °C for 15 s, 65 °C for 30 s, 72 °C for 30 s, with data acquisition set to the 72 °C extension.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover. .. After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene (Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene ( Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported. .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter).

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: Real-time PCR was performed as previously described [ ] using primers flanking the E2F-binding site in birc2 promoters (BS1 primer sense: ( 5’-TGAGGTGACACAGGGTAGGA-3’ , antisense: 5’- GGTTTCCCAAAACTCAAACG-3’ ; BS2 primer sense: 5’- ACTCTTCTGGCCCTTGGACT -3’ , antisense: 5’-AAACTTAGCCCTCGGCGTT -3’ ). .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles.

    Incubation:

    Article Title: Tissue–selective effects of nucleolar stress and rDNA damage in developmental disorders
    Article Snippet: .. After 15 min, tubes were removed and mixed with 5 μl of Circligase-II reaction buffer (3.3 μl water, 1.5 μl 10 × Circligase-II buffer, and 0.2 μl of Circligase-II, Epicentre, catalogue number CL9021K). cDNA was circularized in a thermocycler for 1.5 h at 60 °C. cDNA was captured by addition of 30 μl of Ampure XP beads (Beckman Coulter, catalogue number ), 75 μl of isopropanol, and incubation for 15 min (the solution was remixed after 7.5 min). ..

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: The transposition reaction was performed by adding 50 μl of transposition mix to the pellet (25 μl TD (2× reaction buffer from Nextera kit), 25 μl TDE1 (Tn5 transposase from Nextera kit), 22.5 μl nuclease-free water) and incubation for 30 min at 37 °C. .. The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions.

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples
    Article Snippet: 50 U of Klenow (3′ → 5′ exo-; Enzymatics) fragment was added to each sample and the tubes were incubated at 4°C for 5 min before slow ramping (4°C/min) to 37°C (i.e. 8 min for the ramping step), and then held at 37°C for 90 min. After this step, samples can be stored overnight at −20°C if required. .. The remaining primers were digested with 20 U of exonuclease I (NEB) at 37°C for 1 h in 100 μl before purification using AMPure XP beads (Beckman).

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: The reaction mix was incubated for 16 h. The beads carrying the immune-precipitated chromatin fragments were washed eight times with RIPA buffer (50 mM HEPES-KOH, pH 7.6, 300 mM LiCl, 1 mM EDTA, 1% NP-40 (IGEPAL) and 0.7% sodium deoxycholate) and once with TE, followed by treatment with RNase and proteinase K. The cross-links were reversed, and the DNA was precipitated with ethanol and glycogen. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Beads were prepared by washing with 1 x BW buffer (5 mM Tris-Cl pH 7.5, 0.5 mM EDTA, 1 M NaCl), resuspended in 4 x BW buffer (20 mM Tris-Cl pH 7.5, 2 mM EDTA, 4 M NaCl; 8 µl per sample), and then mixed with the 25 µl sample and incubated at room temperature overnight with gentle agitation. .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    Formalin-fixed Paraffin-Embedded:

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples
    Article Snippet: WGS library preparation—DDAT protocol To remove damaged bases, 2 ng of good or poor quality FFPE DNA and 10 ng of very poor quality DNA were combined with 5 U of SMUG1, 1 U Fpg, 1× NEB buffer 1 and 0.1 μg/ml bovine serum albumin (NEB) in 10 μl and incubated for 1 h at 37°C. (This enzyme digestion step was excluded in the pilot experiment.) .. The remaining primers were digested with 20 U of exonuclease I (NEB) at 37°C for 1 h in 100 μl before purification using AMPure XP beads (Beckman).

    Expressing:

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover. .. After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene (Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene ( Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported. .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter).

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Modification:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Libraries were made following the NEBNext Ultra DNA Library Prep protocol with methylated adaptors and the following modifications: following adaptor ligation, bisulphite conversion was carried out using the Imprint Modification Kit (Sigma); and PCR enrichment was carried out for 18 cycles using the KAPA Uracil+ DNA polymerase master mix (KAPA Biosystems) and the NEBNext Library Prep universal and index primers (NEB).

    Bisulfite Sequencing:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Paragraph title: Reduced representation bisulphite sequencing (RRBS) library preparation ... Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter).

    Flow Cytometry:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: RNA isolation Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Ligation:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Libraries were made following the NEBNext Ultra DNA Library Prep protocol with methylated adaptors and the following modifications: following adaptor ligation, bisulphite conversion was carried out using the Imprint Modification Kit (Sigma); and PCR enrichment was carried out for 18 cycles using the KAPA Uracil+ DNA polymerase master mix (KAPA Biosystems) and the NEBNext Library Prep universal and index primers (NEB).

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Libraries were generated as described previously , including end repair, A-tailing, adaptor ligation (Illumina TrueSeq system) and PCR amplification of the libraries. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Hi-C ligation junctions were then captured by Dynabeads M-280 streptavidin beads (Thermo Fisher; 20 µl of original suspension per single-cell sample). .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    Methylation:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Libraries were made following the NEBNext Ultra DNA Library Prep protocol with methylated adaptors and the following modifications: following adaptor ligation, bisulphite conversion was carried out using the Imprint Modification Kit (Sigma); and PCR enrichment was carried out for 18 cycles using the KAPA Uracil+ DNA polymerase master mix (KAPA Biosystems) and the NEBNext Library Prep universal and index primers (NEB).

    Generated:

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions. .. Sequencing reads were mapped using bwa mem and coverage plots were generated using COVERnant (v.0.3.2) ( https://github.com/konrad/COVERnant ) .

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Libraries were generated as described previously , including end repair, A-tailing, adaptor ligation (Illumina TrueSeq system) and PCR amplification of the libraries. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Sequencing:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Pooled libraries were sequenced on the Illumina HiSeq 2500 instrument, using the 'dark sequencing' protocol, as previously described .

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Single cells were sorted into individual wells of a 96 well plate (Bio-Rad) containing 5 μl of lysis solution and sequencing libraries were prepared using the smart-seq2 method as reported with the following modifications . .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions. .. Paired-end 76-bp sequencing was carried out using the Illumina NextSeq 500 system with a high-output NextSeq 500/550 kit, according to the manufacturer’s instructions.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter). .. 31 additional cells were then ‘multiplexed’ with 96 samples per Illumina HiSeq 2500 lane and 58 base pair single end sequencing was performed.

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Hi-C concatemer DNA was fragmented and linked with sequencing adapters using the Nextera XT DNA Library Preparation Kit (Illumina), by adding 10 µl of Tagment DNA Buffer and 5 µl of Amplicon Tagment Mix, incubating at 55°C for 5 min, then cooling down to 10°C, followed by addition 5 µl of Neutralize Tagment Buffer and incubation for 5 min at room temperature. .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    Article Title: A comparative analysis of exome capture
    Article Snippet: These performance factors directly influence the theoretical coverage one may expect from the capture method and therefore the amount of raw sequence data that would be necessary for providing sufficient coverage of genomic regions of interest. .. The NimbleGen workflow involved a standard agarose gel electrophoresis and excision-based method, whereas the Agilent workflow applied a more relaxed small-fragment exclusion technique involving AMPure XP beads (Beckman Coulter Genomics).

    Sonication:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: After centrifugation (5 min, 1300 rpm) at 4°C, the pellet was resuspended in 600 ul buffer III (10 mM Tris-HCl, pH8, 100 mM NaCl, 1 mM EDTA, pH8 and 0.5 mM EGTA, 0.1% sodium doxycholate and 0.5% n-lauroylsarcosine) and sonicated at a Bioruptor for 40 min. Triton X-100 was added to a final concentration of 1% and the chromatin preparation was pre-cleared using magnetic beads for 1 h. The HSF1 antibody (Cell Signaling, 4356, 5ug) was coupled to magnetic beads (50ul) for 6 h and subsequently added to the pre-cleared chromatin. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Injection:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: RNA isolation Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Binding Assay:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: The following primers were used to test NOTCH1 binding enrichment: HSF1 for 5′-ATTCCCTCCTTGCTCGAGAT-3′, rev 5′-CACGAGGGTCCACAGCTT-3′; HES1 for 5′-TGGGGACATGGAACCTAGAG-3′, rev 5′-GCGACCTCTCAGATCACCTC-3′. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Hi-C:

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Paragraph title: Single-cell Hi-C library preparation ... The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    ChIP-sequencing:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Paragraph title: ChIP and ChIP-seq library preparation ... AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles. .. Library quality was assessed by a bioanalyzer using a High Sensitivity chip.

    Staining:

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Single-cell RNA sequencing and computational analysis Single-cell epithelial suspensions were isolated and stained as described below and sorted using a FACS Aria Fusion (BD Biosciences). .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    RNA Sequencing Assay:

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Paragraph title: Single-cell RNA sequencing and computational analysis ... For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    Magnetic Beads:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: After centrifugation (5 min, 1300 rpm) at 4°C, the pellet was resuspended in 600 ul buffer III (10 mM Tris-HCl, pH8, 100 mM NaCl, 1 mM EDTA, pH8 and 0.5 mM EGTA, 0.1% sodium doxycholate and 0.5% n-lauroylsarcosine) and sonicated at a Bioruptor for 40 min. Triton X-100 was added to a final concentration of 1% and the chromatin preparation was pre-cleared using magnetic beads for 1 h. The HSF1 antibody (Cell Signaling, 4356, 5ug) was coupled to magnetic beads (50ul) for 6 h and subsequently added to the pre-cleared chromatin. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Isolation:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Reduced representation bisulphite sequencing (RRBS) library preparation Total DNA from FACS-sorted PGCs isolated from individual Tet1 -KO or wild type embryos was isolated using ZR-Duet DNA-RNA MiniPrep kit (Zymo), and DNA from between two to six embryos (equivalent to 1,000 to 8,000 cells) of the same genotype, stage and sex was pooled and concentrated to 26 µL final volume using the Savant SpeedVac Concentrator (Thermo) and following the manufacturer’s instructions. .. Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter).

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Single-cell RNA sequencing and computational analysis Single-cell epithelial suspensions were isolated and stained as described below and sorted using a FACS Aria Fusion (BD Biosciences). .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Paragraph title: RNA isolation ... The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Purification:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: .. Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Libraries were made following the NEBNext Ultra DNA Library Prep protocol with methylated adaptors and the following modifications: following adaptor ligation, bisulphite conversion was carried out using the Imprint Modification Kit (Sigma); and PCR enrichment was carried out for 18 cycles using the KAPA Uracil+ DNA polymerase master mix (KAPA Biosystems) and the NEBNext Library Prep universal and index primers (NEB).

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover. .. After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene (Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported.

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: .. The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions. .. The library fragment sizes between 150 and 1,000 bp were purified from a 6% polyacrylamide gel.

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples
    Article Snippet: .. The remaining primers were digested with 20 U of exonuclease I (NEB) at 37°C for 1 h in 100 μl before purification using AMPure XP beads (Beckman). .. For purification, 80 μl AMPure XP beads were added directly to the samples and incubated for 10 min at room temperature.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter). .. In batch one, 96 cells were initially ‘multiplexed’ with 48 samples per Illumina HiSeq 2500 lane.

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined). .. The eluate was purified once more with AMPure XP beads (equal volume to the previous eluate) and eluted with 11 µl of 10 mM Tris-Cl pH 8.5.

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). .. 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA.

    Polymerase Chain Reaction:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter). .. Libraries were made following the NEBNext Ultra DNA Library Prep protocol with methylated adaptors and the following modifications: following adaptor ligation, bisulphite conversion was carried out using the Imprint Modification Kit (Sigma); and PCR enrichment was carried out for 18 cycles using the KAPA Uracil+ DNA polymerase master mix (KAPA Biosystems) and the NEBNext Library Prep universal and index primers (NEB).

    Article Title: Tissue–selective effects of nucleolar stress and rDNA damage in developmental disorders
    Article Snippet: After 15 min, tubes were removed and mixed with 5 μl of Circligase-II reaction buffer (3.3 μl water, 1.5 μl 10 × Circligase-II buffer, and 0.2 μl of Circligase-II, Epicentre, catalogue number CL9021K). cDNA was circularized in a thermocycler for 1.5 h at 60 °C. cDNA was captured by addition of 30 μl of Ampure XP beads (Beckman Coulter, catalogue number ), 75 μl of isopropanol, and incubation for 15 min (the solution was remixed after 7.5 min). .. The 14 μl eluate was transferred to a new 0.2 ml PCR tube containing 15 μl of 2 × Phusion HF-PCR Master Mix (NEB, catalogue number M0531), 0.5 μl of 30 μM P3/P6 PCR1 oligo mix, and 0.5 μl of 15 × SYBR Green I (Thermo Fisher Scientific, catalogue number S7563).

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover. .. After the first PCR amplification, cDNA libraries were screened via quantitative PCR (we used a 1:10 dilution of purified cDNA libraries for quantitative PCR) for expression of a mouse housekeeping gene (Ubc) , and the distribution of library size was checked on a Bioanalyzer instrument (Agilent) as reported.

    Article Title: Genome organization and DNA accessibility control antigenic variation in trypanosomes
    Article Snippet: The transposed DNA fragments were amplified using the NEBNext High-Fidelity 2× PCR Master Mix (M0541) supplied with 2.5 μl of 25 μM barcoded primers and amplification for 13 cycles. .. The libraries were purified using AMPure XP beads (Beckman Coulter) according to the manufacturer’s instructions.

    Article Title: A novel use of random priming-based single-strand library preparation for whole genome sequencing of formalin-fixed paraffin-embedded tissue samples
    Article Snippet: The remaining primers were digested with 20 U of exonuclease I (NEB) at 37°C for 1 h in 100 μl before purification using AMPure XP beads (Beckman). .. DNA was eluted in 38 μl of water before adding components for second strand synthesis (1× blue buffer, 400 nM dNTPs and 0.8 μM oligo 2 [5′-CAGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′]) to the PCR tube still containing the beads.

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Libraries were generated as described previously , including end repair, A-tailing, adaptor ligation (Illumina TrueSeq system) and PCR amplification of the libraries. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: 50 pg of cDNA was used for the “tagmentation” (transposase-based fragmentation) reaction and 12 cycles were applied for the final enrichment PCR. .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter).

    Article Title: Cell-cycle dynamics of chromosomal organisation at single-cell resolution
    Article Snippet: Single-cell Hi-C libraries were amplified from the beads by adding 15 µl of Nextera PCR Master Mix, 5 µl of Index 1 primer of choice and 5 µl of Index 2 primer of choice. .. The combined or uncombined supernatant was purified with AMPure XP beads (Beckman Coulter; 0.6 times volume of the supernatant) according to manufacturer's instructions and eluted with 10 mM Tris-Cl pH 8.5 (100 µl when 96 samples were combined; 30 µl when sample was uncombined).

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles. .. Library quality was assessed by a bioanalyzer using a High Sensitivity chip.

    Lysis:

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Batch 2: 1 μl of a 1:1,000,000 dilution of ERCC Spike-In Mix (ThermoFisher) in RNase-free water was included in a total volume of 5 μl lysis buffer. .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Batch 2: 1 μl of a 1:1,000,000 dilution of ERCC Spike-In Mix (ThermoFisher) in RNase-free water was included in a total volume of 5 μl lysis buffer. .. The final purification step was performed with a ratio of 0.6:1.0 (as above) of Ampure XP beads (Beckman Coulter).

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: RNA isolation Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Concentration Assay:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: After centrifugation (5 min, 1300 rpm) at 4°C, the pellet was resuspended in 600 ul buffer III (10 mM Tris-HCl, pH8, 100 mM NaCl, 1 mM EDTA, pH8 and 0.5 mM EGTA, 0.1% sodium doxycholate and 0.5% n-lauroylsarcosine) and sonicated at a Bioruptor for 40 min. Triton X-100 was added to a final concentration of 1% and the chromatin preparation was pre-cleared using magnetic beads for 1 h. The HSF1 antibody (Cell Signaling, 4356, 5ug) was coupled to magnetic beads (50ul) for 6 h and subsequently added to the pre-cleared chromatin. .. AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). .. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher).

    Mouse Assay:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: RNA isolation Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter).

    Chromatin Immunoprecipitation:

    Article Title: Oncogenic hijacking of the stress response machinery in T cell acute lymphoblastic leukemia
    Article Snippet: Paragraph title: ChIP and ChIP-seq library preparation ... AMPure XP beads (Beckman Coulter, A63880) were used for DNA cleaning steps.

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles. .. Library quality was assessed by a bioanalyzer using a High Sensitivity chip.

    SYBR Green Assay:

    Article Title: Tissue–selective effects of nucleolar stress and rDNA damage in developmental disorders
    Article Snippet: After 15 min, tubes were removed and mixed with 5 μl of Circligase-II reaction buffer (3.3 μl water, 1.5 μl 10 × Circligase-II buffer, and 0.2 μl of Circligase-II, Epicentre, catalogue number CL9021K). cDNA was circularized in a thermocycler for 1.5 h at 60 °C. cDNA was captured by addition of 30 μl of Ampure XP beads (Beckman Coulter, catalogue number ), 75 μl of isopropanol, and incubation for 15 min (the solution was remixed after 7.5 min). .. The 14 μl eluate was transferred to a new 0.2 ml PCR tube containing 15 μl of 2 × Phusion HF-PCR Master Mix (NEB, catalogue number M0531), 0.5 μl of 30 μM P3/P6 PCR1 oligo mix, and 0.5 μl of 15 × SYBR Green I (Thermo Fisher Scientific, catalogue number S7563).

    Selection:

    Article Title: A comparative analysis of exome capture
    Article Snippet: The NimbleGen workflow involved a standard agarose gel electrophoresis and excision-based method, whereas the Agilent workflow applied a more relaxed small-fragment exclusion technique involving AMPure XP beads (Beckman Coulter Genomics). .. Despite producing inserts that are more narrowly distributed, the process of gel-based size selection is more susceptible to variation inherent to the process of preparing electrophoresis gels and manually excising gel slices.

    Agarose Gel Electrophoresis:

    Article Title: A comparative analysis of exome capture
    Article Snippet: .. The NimbleGen workflow involved a standard agarose gel electrophoresis and excision-based method, whereas the Agilent workflow applied a more relaxed small-fragment exclusion technique involving AMPure XP beads (Beckman Coulter Genomics). .. Overall, there were tight and uniform insert size distributions for the NimbleGen capture libraries, ranging from 150 to 250 bp and peaking at 200 bp, whereas the insert size distributions for the Agilent libraries were broader, starting from approximately 100 bp and extending beyond 300 bp.

    In Vitro:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Electrophoresis:

    Article Title: A comparative analysis of exome capture
    Article Snippet: The NimbleGen workflow involved a standard agarose gel electrophoresis and excision-based method, whereas the Agilent workflow applied a more relaxed small-fragment exclusion technique involving AMPure XP beads (Beckman Coulter Genomics). .. Despite producing inserts that are more narrowly distributed, the process of gel-based size selection is more susceptible to variation inherent to the process of preparing electrophoresis gels and manually excising gel slices.

    Immunoprecipitation:

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding
    Article Snippet: The remaining lysate was diluted and immunoprecipitated with 5μg of rabbit anti-E2F1 (C-20) or rabbit control Igg (Santa Cruz biotechnology) overnight. .. For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles.

    FACS:

    Article Title: Epigenetic reprogramming enables the primordial germ cell-to-gonocyte transition
    Article Snippet: Reduced representation bisulphite sequencing (RRBS) library preparation Total DNA from FACS-sorted PGCs isolated from individual Tet1 -KO or wild type embryos was isolated using ZR-Duet DNA-RNA MiniPrep kit (Zymo), and DNA from between two to six embryos (equivalent to 1,000 to 8,000 cells) of the same genotype, stage and sex was pooled and concentrated to 26 µL final volume using the Savant SpeedVac Concentrator (Thermo) and following the manufacturer’s instructions. .. Genomic DNA was digested by 20 units of MspI enzyme (NEB) in NEB buffer 2 at 37°C for 3 hrs, and digested DNA was purified using AMPure XP beads (Beckman-Coulter).

    Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
    Article Snippet: Single-cell RNA sequencing and computational analysis Single-cell epithelial suspensions were isolated and stained as described below and sorted using a FACS Aria Fusion (BD Biosciences). .. For both batches 21 cycles of initial PCR amplification were performed and a ratio of 0.56:1.0 (beads/total PCR volume; instead of 1.0:1.0) of Ampure XP beads (Beckman Coulter) was used for the first PCR purification to minimize primer dimer carryover.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Beckman Coulter magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit
    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt <t>AMPure</t> paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a <t>PCR</t> reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.
    Magnetic Beads Nucleic Acid Extraction Agencout Ampure Xp Pcr Purification Kit, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit/product/Beckman Coulter
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    99
    Beckman Coulter agencourt ampure xp beads
    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with <t>Agencourt</t> <t>Ampure</t> XP beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 3026 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 3026 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Journal: PLoS Biology

    Article Title: Nucleic acid purification from plants, animals and microbes in under 30 seconds

    doi: 10.1371/journal.pbio.2003916

    Figure Lengend Snippet: Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Article Snippet: Magnetic beads nucleic acid extraction Agencout AMPure XP PCR Purification kit (Beckman Coulter) was used to purify DNA following the manufacturer’s recommendations.

    Techniques: Nucleic Acid Purification, Transferring, Purification, Lysis, Polymerase Chain Reaction, Amplification

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Journal: PLoS ONE

    Article Title: E2F1 binds to the peptide-binding groove within the BIR3 domain of cIAP1 and requires cIAP1 for chromatin binding

    doi: 10.1371/journal.pone.0206253

    Figure Lengend Snippet: cIAP1 is required for the recruitment of E2F1 onto chromatin. ChIP-seq analysis of the recruitment of E2F1 onto chromatin in HeLa cells transfected with scrambled (Sc) or cIAP1-siRNA. Enriched DNA from ChIP and Input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter) and amplified by PCR for 10 more cycles (A). The efficiency of siRNA was checked by Western Blot analysis (B).

    Article Snippet: For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles.

    Techniques: Chromatin Immunoprecipitation, Transfection, Polymerase Chain Reaction, Amplification, Western Blot