agencourt ampure xp pcr purification beads  (Beckman Coulter)


Bioz Verified Symbol Beckman Coulter is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Agencourt AMPure XP SPRI beads
    Description:

    Catalog Number:
    A63880
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Beckman Coulter agencourt ampure xp pcr purification beads

    https://www.bioz.com/result/agencourt ampure xp pcr purification beads/product/Beckman Coulter
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp pcr purification beads - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Multiplexing:

    Article Title: Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome
    Article Snippet: Amplicon replicates were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) at a bead-to-DNA ratio of 0.7:1, resuspended in 30 μL of MilliQ water and evaluated in agarose gels. .. Each cleaned PCR 1 product within the same sample received a unique combination of forward and reverse primers (respectively, N7 and S5 Illumina dual index oligos).

    Centrifugation:

    Article Title: Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures
    Article Snippet: Cell debris and impurities were eliminated by a two-step centrifugation at 20,000g for 30 min and another 10 min. After adding 1 volume of isopropanol, DNA was precipitated by incubation at -20°C for 1 hour, centrifuged at 20,000g for 30 min, washed and resuspended in 100 μl of TE. .. Finally, DNA was purified by the Agencourt AMpure XP kit (Beckman Coulter, Indianapolis, USA).

    Amplification:

    Article Title: Resetting the Epigenetic Balance of Polycomb and COMPASS Function at Enhancers for Cancer Therapy
    Article Snippet: Libraries were amplified using 13 cycles on the thermocycler. .. Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter. .. Libraries were validated using the Agilent High Sensitivity DNA Kit.

    Article Title: Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome
    Article Snippet: For 16S PCR 1 amplification, the thermocycler program was set at initial denaturing at 95 °C for 5 min, followed by 25 cycles of denaturing at 95 °C for 30 s, PNA annealing at 78 °C for 10 s, primmer annealing at 50 °C for 60 s and extension at 68 °C for 60 s. The same thermocycler program was used for ITS PCR 1 amplification, but the step for PNA annealing was omitted. .. Amplicon replicates were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) at a bead-to-DNA ratio of 0.7:1, resuspended in 30 μL of MilliQ water and evaluated in agarose gels. .. The PCR 2 reaction followed the same protocol for both 16S and ITS PCR 1 products.

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: The specimens that showed bands of the target size were regarded as positive. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol. .. Index PCR was performed in a total volume of 25 μl, containing 2 μl of purified DNA sample, 2.5 μl each of index 1 and index 2 primers in the Nextera XT Index Kit (Illumina Inc.), 12.5 μl of Tks Gflex™ DNA Polymerase Low DNA (TAKARA BIO INC.), and 5.5 μl of pure water.

    Article Title: Genomic analysis of bacteria in the Acute Oak Decline pathobiome
    Article Snippet: Amplicon and insert size were assessed through 2 % agarose gel electrophoresis. .. Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives. .. Samples were adjusted to a concentration of 2 nM in 10 mM Tris-HCl and 0.1 % Tween before being heat denatured and added to a single lane of the MiSeq Personal Sequencer (Illumina).

    Article Title: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin-Embedded Tumors by Next Generation Sequencing
    Article Snippet: Ion Xpress™ Barcode Adapters were then ligated to the amplicons. .. After purification with Agencourt® AMPure® XP beads (Beckman Coulter), the ligated DNA underwent 5 cycles of amplification. .. The resulting library was purified by using the Agencourt® AMPure® XP beads.

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: PCR was performed with Veriti Thermal Cycler (Applied Biosystems) and the following conditions: 15 min at 95 °C for denaturation, 18 cycles of amplification at 95 °C for 15 s, 60 °C for 4 min, 72 °C for 10 min for extension, and a final maintenance at 4 °C. .. The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Adaptor-ligated amplicons were purified using the Agencourt® AMPure® XP reagent (Beckman Coulter) and eluted into the amplification mix (Platinum® PCR SuperMix High Fidelity and Library Amplification Primer Mix, Thermo Fisher Scientific) and amplified. .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: All reactions, including blank controls, were checked for amplification success on a 1.5% agarose gel and visualized with SYBR®Safe (Invitrogen, Paisley, UK). .. Second PCR products were cleaned using Agencourt AMPure xp system (Beckman Coulter, Brea, CA, USA).

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    Article Title: Human Thanatomicrobiome Succession and Time Since Death
    Article Snippet: Paragraph title: Thanatomicrobiome DNA extraction, PCR amplification, and MiSeq Data Analyses ... Products were then pooled equimolar and each pool was size selected in two rounds using Agencourt AMPure XP (BeckmanCoulter) in a 0.7 ratio for both rounds.

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: The samples were preheated at 95°C for 4 min and then amplified in a thermal cycler (MyCycler; Bio‐Rad, Germany) under the following conditions: 28 cycles of denaturation at 95°C for 40 sec, annealing at 53°C for 40 sec, and elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min. .. The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions.

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: Twenty-five microliters PCR reaction volume were prepared containing 12.5 μl 2X Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific, Waltham, USA), 3 μl of each index primers, and 2 μl of cleaned PCR amplicon product. .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA).

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: Genomic loci were amplified for a control condition (empty sgRNA), wild-type, and D1135E SpCas9. .. An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation.

    Neutralization:

    Article Title: Whole genome sequencing analysis of Plasmodium vivax using whole genome capture
    Article Snippet: After three washes, elution buffer (0.1 M NaOH) was added and incubated for 10 minutes at room temperature. .. The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter). .. Finally, the targets were enriched by 12-cycle PCR amplification by using 1 μl per sample as a template, and the amplified targets were purified with Agencourt AMPure XP beads.

    Picogreen Assay:

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA).

    Construct:

    Article Title: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin-Embedded Tumors by Next Generation Sequencing
    Article Snippet: Ion Torrent adapter-ligated libraries were constructed with the Ion Ampliseq library kit 2.0 (Life Technologies) according to the manufacturer’s protocol with modifications described as follows. .. After purification with Agencourt® AMPure® XP beads (Beckman Coulter), the ligated DNA underwent 5 cycles of amplification.

    Article Title: Human Thanatomicrobiome Succession and Time Since Death
    Article Snippet: Primers for the first step were constructed using 515F–806R with the Illumina i5 and i7 sequencing primers added to the 5′ end of each, respectively. .. Products were then pooled equimolar and each pool was size selected in two rounds using Agencourt AMPure XP (BeckmanCoulter) in a 0.7 ratio for both rounds.

    Electrophoresis:

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: Mutagenesis frequencies were quantified using a Qiaxcel capillary electrophoresis instrument (QIagen), as previously described for human cells and zebrafish . .. An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation.

    Incubation:

    Article Title: Whole genome sequencing analysis of Plasmodium vivax using whole genome capture
    Article Snippet: After three washes, elution buffer (0.1 M NaOH) was added and incubated for 10 minutes at room temperature. .. The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter).

    Article Title: Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures
    Article Snippet: Cell debris and impurities were eliminated by a two-step centrifugation at 20,000g for 30 min and another 10 min. After adding 1 volume of isopropanol, DNA was precipitated by incubation at -20°C for 1 hour, centrifuged at 20,000g for 30 min, washed and resuspended in 100 μl of TE. .. Finally, DNA was purified by the Agencourt AMpure XP kit (Beckman Coulter, Indianapolis, USA).

    Expressing:

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Two biological replicates, four samples each (1 control, 3 test samples), representing intact high-quality RNA (50 ng each) were reverse transcribed according to the protocol provided in the Ion AmpliSeq™ Transcriptome Human Gene Expression kit (Revision A.0, Thermo Fisher Scientific). cDNA was amplified using Ion AmpliSeq™ Transcriptome Human Gene Expression core panel (Thermo Fisher Scientific) and primer sequences were partially digested followed by adaptors ligation (Ion P1 Adapter and Ion Xpress™ Barcode Adapter, Thermo Fisher Scientific). .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Modification:

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA).

    Ligation:

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: PCR was performed with Veriti Thermal Cycler (Applied Biosystems) and the following conditions: 15 min at 95 °C for denaturation, 18 cycles of amplification at 95 °C for 15 s, 60 °C for 4 min, 72 °C for 10 min for extension, and a final maintenance at 4 °C. .. The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Article Title: Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms
    Article Snippet: After PCR, the samples were purified with Agencourt AMPure XP beads (Beckman Coulter) according to kit’s protocol. .. Samples were end-repaired, purified with Agencourt AMPure XP beads, and the bar-coded sequencing adapters were ligated following the manufacturer’s protocol.

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Two biological replicates, four samples each (1 control, 3 test samples), representing intact high-quality RNA (50 ng each) were reverse transcribed according to the protocol provided in the Ion AmpliSeq™ Transcriptome Human Gene Expression kit (Revision A.0, Thermo Fisher Scientific). cDNA was amplified using Ion AmpliSeq™ Transcriptome Human Gene Expression core panel (Thermo Fisher Scientific) and primer sequences were partially digested followed by adaptors ligation (Ion P1 Adapter and Ion Xpress™ Barcode Adapter, Thermo Fisher Scientific). .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Magnetic Beads:

    Article Title: Caught in the middle with multiple displacement amplification: the myth of pooling for avoiding multiple displacement amplification bias in a metagenome
    Article Snippet: This allows for the generation of consensus sequences that are higher quality (up to > 99% accuracy) than single pass sequences. .. DNA was fragmented to a target length of 2 kb using Covaris S2 Adaptive Focused Acoustic Disruptor (Covaris, Inc., Woburn, MA, USA) and concentrated using 0.6× volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Pasadena, CA, USA). .. Fragmented DNA was end-repaired and SMRTbell adapters were ligated to the blunt ends.

    Article Title: Whole genome sequencing analysis of Plasmodium vivax using whole genome capture
    Article Snippet: The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter). .. The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter).

    Multiple Displacement Amplification:

    Article Title: Caught in the middle with multiple displacement amplification: the myth of pooling for avoiding multiple displacement amplification bias in a metagenome
    Article Snippet: DNA was fragmented to a target length of 2 kb using Covaris S2 Adaptive Focused Acoustic Disruptor (Covaris, Inc., Woburn, MA, USA) and concentrated using 0.6× volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Pasadena, CA, USA). .. SMRT sequencing was performed at the University of Delaware Sequencing and Genotyping Center using C2/C2 chemistry on a Pacific Biosciences RS sequencer.

    other:

    Article Title: Germline DNA replication timing shapes mammalian genome composition
    Article Snippet: 1.8x Agencourt AMPure XP beads (Beckman Coulter) were used to lower the elution buffer volume and gDNA was eluted from beads in 50 μl EB (Qiagen).

    DNA Sequencing:

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. Equimolar quantities of every sample were pooled, and these pools were then quantified with Qubit (ThermoFisher Scientific, Waltham, USA) and run on a Bioanalyzer DNA 2100 chip for quality and size validation.

    Polymerase Chain Reaction:

    Article Title: Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome
    Article Snippet: For 16S PCR 1 amplification, the thermocycler program was set at initial denaturing at 95 °C for 5 min, followed by 25 cycles of denaturing at 95 °C for 30 s, PNA annealing at 78 °C for 10 s, primmer annealing at 50 °C for 60 s and extension at 68 °C for 60 s. The same thermocycler program was used for ITS PCR 1 amplification, but the step for PNA annealing was omitted. .. Amplicon replicates were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) at a bead-to-DNA ratio of 0.7:1, resuspended in 30 μL of MilliQ water and evaluated in agarose gels.

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: The specimens that showed bands of the target size were regarded as positive. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol. .. Index PCR was performed in a total volume of 25 μl, containing 2 μl of purified DNA sample, 2.5 μl each of index 1 and index 2 primers in the Nextera XT Index Kit (Illumina Inc.), 12.5 μl of Tks Gflex™ DNA Polymerase Low DNA (TAKARA BIO INC.), and 5.5 μl of pure water.

    Article Title: Genomic analysis of bacteria in the Acute Oak Decline pathobiome
    Article Snippet: Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives. .. Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives.

    Article Title: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin-Embedded Tumors by Next Generation Sequencing
    Article Snippet: The resulting amplicons were treated with 2 ul of FuPa reagent to partially digest PCR primers and repair fragment ends. .. After purification with Agencourt® AMPure® XP beads (Beckman Coulter), the ligated DNA underwent 5 cycles of amplification.

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: PCR was performed with Veriti Thermal Cycler (Applied Biosystems) and the following conditions: 15 min at 95 °C for denaturation, 18 cycles of amplification at 95 °C for 15 s, 60 °C for 4 min, 72 °C for 10 min for extension, and a final maintenance at 4 °C. .. The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Article Title: Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms
    Article Snippet: A volume of 1 µl of each sample DNA (3 ng/µl) was used for library preparation, and PCR was performed according to the kit’s instructions with 18-cycle PCR protocol (two reactions/sample). .. After PCR, the samples were purified with Agencourt AMPure XP beads (Beckman Coulter) according to kit’s protocol. .. Samples were end-repaired, purified with Agencourt AMPure XP beads, and the bar-coded sequencing adapters were ligated following the manufacturer’s protocol.

    Article Title: Robust BRCA1‐like classification of copy number profiles of samples repeated across different datasets and platforms), Robust BRCA1-like classification of copy number profiles of samples repeated across different datasets and platforms
    Article Snippet: Up to 250 ng of double stranded genomic DNA was fragmented by Covaris shearing to obtain fragment sizes of 160–180 bp. .. Samples were purified with the Agencourt AMPure XP PCR Purification beads according to manufacturer's instructions (Beckman Coulter, cat no A63881). .. DNA library preparation for Illumina sequencing was done with the TruSeq® DNA LT Sample Preparation kit (Illumina).

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Adaptor-ligated amplicons were purified using the Agencourt® AMPure® XP reagent (Beckman Coulter) and eluted into the amplification mix (Platinum® PCR SuperMix High Fidelity and Library Amplification Primer Mix, Thermo Fisher Scientific) and amplified. .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: All successful first PCR products were diluted and used as templates for the second-round PCRs. .. Second PCR products were cleaned using Agencourt AMPure xp system (Beckman Coulter, Brea, CA, USA). .. We repeated Tests 2 and 3 with modified cycling conditions in an attempt to reduce errors: Test 2b & 3b, respectively.

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    Article Title: Human Thanatomicrobiome Succession and Time Since Death
    Article Snippet: Paragraph title: Thanatomicrobiome DNA extraction, PCR amplification, and MiSeq Data Analyses ... Products were then pooled equimolar and each pool was size selected in two rounds using Agencourt AMPure XP (BeckmanCoulter) in a 0.7 ratio for both rounds.

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: The samples were preheated at 95°C for 4 min and then amplified in a thermal cycler (MyCycler; Bio‐Rad, Germany) under the following conditions: 28 cycles of denaturation at 95°C for 40 sec, annealing at 53°C for 40 sec, and elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min. .. The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions. .. The quality and yield of the DNA were subsequently determined in a PicoGreen® dsDNA quantitation assay (protocol: “Quant‐iT™ PicoGreen® dsDNA Reagent and Kits” from the manufacturer′s homepage) and by comparison with a calibration line obtained by measuring a serial dilution of DNA of known concentration (calf thymus DNA, Sigma‐Aldrich, Steinheim, Germany).

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR profile was set to 8 cycles at 98 °C (10 s), 55 °C (30 s), and 72 °C (15 s), ending with 72 °C for 5 min. .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. Cleaning was done as mentioned above, except for the addition of 23 μl AMPure XP beads to each sample and 38 μl of double-distilled water for elution.

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: Roughly 200 ng of purified PCR product was denatured, annealed, and digested with T7E1 (New England BioLabs). .. An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation.

    Binding Assay:

    Article Title: Whole genome sequencing analysis of Plasmodium vivax using whole genome capture
    Article Snippet: The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter). .. The eluted captured targets were then transferred to a tube containing neutralization buffer (1 M Tris–HCl, pH 7.5) and desalted with Agencourt AMPure XP paramagnetic beads (Beckman Coulter).

    Pyromark Assay:

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    ChIP-sequencing:

    Article Title: Resetting the Epigenetic Balance of Polycomb and COMPASS Function at Enhancers for Cancer Therapy
    Article Snippet: ChIP-sequencing libraries were prepared using the KAPA HTP Library Preparation Kit complemented with NEXTflex DNA Barcodes from Bioo Scientific. .. Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter.

    DNA Extraction:

    Article Title: Human Thanatomicrobiome Succession and Time Since Death
    Article Snippet: Paragraph title: Thanatomicrobiome DNA extraction, PCR amplification, and MiSeq Data Analyses ... Products were then pooled equimolar and each pool was size selected in two rounds using Agencourt AMPure XP (BeckmanCoulter) in a 0.7 ratio for both rounds.

    Article Title: Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures
    Article Snippet: Paragraph title: DNA extraction and sequencing ... Finally, DNA was purified by the Agencourt AMpure XP kit (Beckman Coulter, Indianapolis, USA).

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: Paragraph title: DNA extraction and PCR ... The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions.

    Nucleic Acid Electrophoresis:

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: After PCR amplification, 5 μl of reaction mixture was applied to gel electrophoresis using a 1.0% agarose gel and subsequently stained with 0.5 μg/ml of ethidium bromide for 30 min. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol.

    RNA Sequencing Assay:

    Article Title: Resetting the Epigenetic Balance of Polycomb and COMPASS Function at Enhancers for Cancer Therapy
    Article Snippet: Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter. .. Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter.

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Paragraph title: RNA extraction and RNA sequencing ... Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Methylation:

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    Mutagenesis:

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: Mutagenesis frequencies were quantified using a Qiaxcel capillary electrophoresis instrument (QIagen), as previously described for human cells and zebrafish . .. An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation.

    RNA Extraction:

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Paragraph title: RNA extraction and RNA sequencing ... Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Purification:

    Article Title: Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome
    Article Snippet: For 16S PCR 1 amplification, the thermocycler program was set at initial denaturing at 95 °C for 5 min, followed by 25 cycles of denaturing at 95 °C for 30 s, PNA annealing at 78 °C for 10 s, primmer annealing at 50 °C for 60 s and extension at 68 °C for 60 s. The same thermocycler program was used for ITS PCR 1 amplification, but the step for PNA annealing was omitted. .. Amplicon replicates were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) at a bead-to-DNA ratio of 0.7:1, resuspended in 30 μL of MilliQ water and evaluated in agarose gels. .. The PCR 2 reaction followed the same protocol for both 16S and ITS PCR 1 products.

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: The specimens that showed bands of the target size were regarded as positive. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol. .. Index PCR was performed in a total volume of 25 μl, containing 2 μl of purified DNA sample, 2.5 μl each of index 1 and index 2 primers in the Nextera XT Index Kit (Illumina Inc.), 12.5 μl of Tks Gflex™ DNA Polymerase Low DNA (TAKARA BIO INC.), and 5.5 μl of pure water.

    Article Title: Genomic analysis of bacteria in the Acute Oak Decline pathobiome
    Article Snippet: Amplicon and insert size were assessed through 2 % agarose gel electrophoresis. .. Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives. .. Samples were adjusted to a concentration of 2 nM in 10 mM Tris-HCl and 0.1 % Tween before being heat denatured and added to a single lane of the MiSeq Personal Sequencer (Illumina).

    Article Title: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin-Embedded Tumors by Next Generation Sequencing
    Article Snippet: Ion Xpress™ Barcode Adapters were then ligated to the amplicons. .. After purification with Agencourt® AMPure® XP beads (Beckman Coulter), the ligated DNA underwent 5 cycles of amplification. .. The resulting library was purified by using the Agencourt® AMPure® XP beads.

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: PCR was performed with Veriti Thermal Cycler (Applied Biosystems) and the following conditions: 15 min at 95 °C for denaturation, 18 cycles of amplification at 95 °C for 15 s, 60 °C for 4 min, 72 °C for 10 min for extension, and a final maintenance at 4 °C. .. The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Article Title: Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms
    Article Snippet: A volume of 1 µl of each sample DNA (3 ng/µl) was used for library preparation, and PCR was performed according to the kit’s instructions with 18-cycle PCR protocol (two reactions/sample). .. After PCR, the samples were purified with Agencourt AMPure XP beads (Beckman Coulter) according to kit’s protocol. .. Samples were end-repaired, purified with Agencourt AMPure XP beads, and the bar-coded sequencing adapters were ligated following the manufacturer’s protocol.

    Article Title: Caught in the middle with multiple displacement amplification: the myth of pooling for avoiding multiple displacement amplification bias in a metagenome
    Article Snippet: DNA was fragmented to a target length of 2 kb using Covaris S2 Adaptive Focused Acoustic Disruptor (Covaris, Inc., Woburn, MA, USA) and concentrated using 0.6× volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Pasadena, CA, USA). .. DNA was fragmented to a target length of 2 kb using Covaris S2 Adaptive Focused Acoustic Disruptor (Covaris, Inc., Woburn, MA, USA) and concentrated using 0.6× volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Pasadena, CA, USA).

    Article Title: Robust BRCA1‐like classification of copy number profiles of samples repeated across different datasets and platforms), Robust BRCA1-like classification of copy number profiles of samples repeated across different datasets and platforms
    Article Snippet: Up to 250 ng of double stranded genomic DNA was fragmented by Covaris shearing to obtain fragment sizes of 160–180 bp. .. Samples were purified with the Agencourt AMPure XP PCR Purification beads according to manufacturer's instructions (Beckman Coulter, cat no A63881). .. DNA library preparation for Illumina sequencing was done with the TruSeq® DNA LT Sample Preparation kit (Illumina).

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Adaptor-ligated amplicons were purified using the Agencourt® AMPure® XP reagent (Beckman Coulter) and eluted into the amplification mix (Platinum® PCR SuperMix High Fidelity and Library Amplification Primer Mix, Thermo Fisher Scientific) and amplified. .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter). .. Amplicons were quantified using the Fragment AnalyzerTM instrument (Advanced Analytical Technologies, INC.) with the DNF-474 High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical Technologies, INC.).

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: The samples were preheated at 95°C for 4 min and then amplified in a thermal cycler (MyCycler; Bio‐Rad, Germany) under the following conditions: 28 cycles of denaturation at 95°C for 40 sec, annealing at 53°C for 40 sec, and elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min. .. The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions. .. The quality and yield of the DNA were subsequently determined in a PicoGreen® dsDNA quantitation assay (protocol: “Quant‐iT™ PicoGreen® dsDNA Reagent and Kits” from the manufacturer′s homepage) and by comparison with a calibration line obtained by measuring a serial dilution of DNA of known concentration (calf thymus DNA, Sigma‐Aldrich, Steinheim, Germany).

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR profile was set to 8 cycles at 98 °C (10 s), 55 °C (30 s), and 72 °C (15 s), ending with 72 °C for 5 min. .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. Cleaning was done as mentioned above, except for the addition of 23 μl AMPure XP beads to each sample and 38 μl of double-distilled water for elution.

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: Roughly 200 ng of purified PCR product was denatured, annealed, and digested with T7E1 (New England BioLabs). .. An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation.

    Sequencing:

    Article Title: Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome
    Article Snippet: Paragraph title: Library preparation and sequencing ... Amplicon replicates were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) at a bead-to-DNA ratio of 0.7:1, resuspended in 30 μL of MilliQ water and evaluated in agarose gels.

    Article Title: Genomic analysis of bacteria in the Acute Oak Decline pathobiome
    Article Snippet: Paragraph title: Genome sequencing using the Illumina MiSeq platform ... Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives.

    Article Title: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin-Embedded Tumors by Next Generation Sequencing
    Article Snippet: Paragraph title: Ion Torrent PGM library preparation and sequencing ... After purification with Agencourt® AMPure® XP beads (Beckman Coulter), the ligated DNA underwent 5 cycles of amplification.

    Article Title: Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms
    Article Snippet: Libraries for sequencing were prepared with Ion 16S Metagenomics kit (Thermo Fisher Scientific, USA) according to supplied protocol. .. After PCR, the samples were purified with Agencourt AMPure XP beads (Beckman Coulter) according to kit’s protocol.

    Article Title: Caught in the middle with multiple displacement amplification: the myth of pooling for avoiding multiple displacement amplification bias in a metagenome
    Article Snippet: Paragraph title: Library preparation and sequencing ... DNA was fragmented to a target length of 2 kb using Covaris S2 Adaptive Focused Acoustic Disruptor (Covaris, Inc., Woburn, MA, USA) and concentrated using 0.6× volume of Agencourt AMPure XP magnetic beads (Beckman Coulter, Pasadena, CA, USA).

    Article Title: Robust BRCA1‐like classification of copy number profiles of samples repeated across different datasets and platforms), Robust BRCA1-like classification of copy number profiles of samples repeated across different datasets and platforms
    Article Snippet: Paragraph title: Low coverage copy number sequencing and data processing ... Samples were purified with the Agencourt AMPure XP PCR Purification beads according to manufacturer's instructions (Beckman Coulter, cat no A63881).

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter). .. Samples were then pooled (8 samples per pool) followed by emulsion PCR on the Ion OneTouch™ 2 system with the Ion PI™ Template OT2 200 Kit v3 (Thermo Fisher Scientific) and enrichment using the Ion OneTouch™ ES (Thermo Fisher Scientific).

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: In the second PCR, we used the first PCR as a template with a 52 bp primer which included the M13, a sample-specific 10 bp MID, the 454 Sequencing System Primer sequence and a 4 bp primer key ( ). .. Second PCR products were cleaned using Agencourt AMPure xp system (Beckman Coulter, Brea, CA, USA).

    Article Title: Evaluation of marine zooplankton community structure through environmental DNA metabarcoding
    Article Snippet: PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.). .. PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.).

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    Article Title: Human Thanatomicrobiome Succession and Time Since Death
    Article Snippet: Primers for the first step were constructed using 515F–806R with the Illumina i5 and i7 sequencing primers added to the 5′ end of each, respectively. .. Products were then pooled equimolar and each pool was size selected in two rounds using Agencourt AMPure XP (BeckmanCoulter) in a 0.7 ratio for both rounds.

    Article Title: Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures
    Article Snippet: Paragraph title: DNA extraction and sequencing ... Finally, DNA was purified by the Agencourt AMpure XP kit (Beckman Coulter, Indianapolis, USA).

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions. .. The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions.

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: Paragraph title: Illumina MiSeq sequencing of MHC-I exon 3 ... The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA).

    Article Title: Engineered CRISPR-Cas9 nucleases with altered PAM specificities
    Article Snippet: An Agencourt Ampure XP cleanup step (Beckman Coulter Genomics) was performed prior to pooling ~500 ng of DNA from each condition for library preparation. .. Dual-indexed Tru-Seq Illumina deep-sequencing libraries were generated using the KAPA HTP library preparation kit (KAPA BioSystems).

    Blocking Assay:

    Article Title: Evaluation of marine zooplankton community structure through environmental DNA metabarcoding
    Article Snippet: Each reaction was carried out using 1 μ L DNA extract at a 1 : 10 dilution, 10 μ L AmpliTaq Gold master mix (Thermo Fisher Scientific, U.S.A.), 1 μ L each of forward and reverse primers (5 μ M), 8 μ L molecular‐biology grade water (Sigma‐Aldrich, U.S.A.), and 4 μ L of 10 μ M mammalian blocking primer (GCCCGTCGCTACTACCGATTGG/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/TTAGTGAGGCCCT/3SpC3/) for the 18S rRNA gene only (Earth Microbiome Project; Vestheim and Jarman ). .. PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.).

    Agarose Gel Electrophoresis:

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: After PCR amplification, 5 μl of reaction mixture was applied to gel electrophoresis using a 1.0% agarose gel and subsequently stained with 0.5 μg/ml of ethidium bromide for 30 min. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol.

    Article Title: Genomic analysis of bacteria in the Acute Oak Decline pathobiome
    Article Snippet: Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives. .. Amplified DNA was purified using Agencourt AMPure XP beads (Beckman Coulter) and normalized with library normalization additives.

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: The quality of extracted RNA was checked by measuring the 260/280 and 260/230 ratios using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific) and by running the samples (500 ng) on a 1.5% Tris-Borate-EDTA (TBE) agarose gel prepared with 20 mM of guanidium isothiocyanate (GITC). .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: All reactions, including blank controls, were checked for amplification success on a 1.5% agarose gel and visualized with SYBR®Safe (Invitrogen, Paisley, UK). .. Second PCR products were cleaned using Agencourt AMPure xp system (Beckman Coulter, Brea, CA, USA).

    Article Title: Evaluation of marine zooplankton community structure through environmental DNA metabarcoding
    Article Snippet: 18S rRNA cycling parameters were 94°C for 3 min; 35 cycles at 94°C for 45 s; 65°C for 15 s; 57°C for 30 s; and 72°C for 90 s; COI cycling parameters were 95°C for 10 min; 16 cycles at 94°C for 10 s; 62°C for 30 s (decreasing by 1°C per cycle); 68°C for 60 s; 25 cycles at 94°C for 10 s; 46°C for 30 s; 68°C for 60 s; and 72°C for 10 min. Triplicate PCR products were pooled and quality was confirmed by agarose gel electrophoresis (1.5%). .. PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.).

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR profile was set to 8 cycles at 98 °C (10 s), 55 °C (30 s), and 72 °C (15 s), ending with 72 °C for 5 min. .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. Cleaning was done as mentioned above, except for the addition of 23 μl AMPure XP beads to each sample and 38 μl of double-distilled water for elution.

    Chromatin Immunoprecipitation:

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter). .. Samples were then pooled (8 samples per pool) followed by emulsion PCR on the Ion OneTouch™ 2 system with the Ion PI™ Template OT2 200 Kit v3 (Thermo Fisher Scientific) and enrichment using the Ion OneTouch™ ES (Thermo Fisher Scientific).

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. Cleaned PCR products were then checked on a 2% agarose gel, and the concentration was measured with Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher Scientific/Invitrogen, Waltham, USA) modified for a 96-well plate.

    Software:

    Article Title: Age-associated hydroxymethylation in human bone-marrow mesenchymal stem cells
    Article Snippet: Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH). .. Briefly, DNA samples were cleaned using Agencourt AMPure XP (Beckman Coulter), and then oxidized with 1 μL of a KRuO4 (Alpha Aeser) solution (375 mM in 0.3 M NaOH).

    Functional Assay:

    Article Title: Evaluation of marine zooplankton community structure through environmental DNA metabarcoding
    Article Snippet: PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.). .. PCR products were purified and size‐selected using the Agencourt AMPure XP bead system (Beckman Coulter, U.S.A.).

    Selection:

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: PCR was performed with Veriti Thermal Cycler (Applied Biosystems) and the following conditions: 15 min at 95 °C for denaturation, 18 cycles of amplification at 95 °C for 15 s, 60 °C for 4 min, 72 °C for 10 min for extension, and a final maintenance at 4 °C. .. The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Sample Prep:

    Article Title: Resetting the Epigenetic Balance of Polycomb and COMPASS Function at Enhancers for Cancer Therapy
    Article Snippet: Paragraph title: NGS Sample Preparation ... Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter.

    Size-exclusion Chromatography:

    Article Title: Comparative analysis of the fecal bacterial community of five harbor seals (Phoca vitulina)
    Article Snippet: The samples were preheated at 95°C for 4 min and then amplified in a thermal cycler (MyCycler; Bio‐Rad, Germany) under the following conditions: 28 cycles of denaturation at 95°C for 40 sec, annealing at 53°C for 40 sec, and elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min. .. The PCR products were purified using the Agencourt AMPure XP–PCR purification kit (Beckman Coulter, Brea, CA, USA) following the manufacturer's instructions.

    Next-Generation Sequencing:

    Article Title: Resetting the Epigenetic Balance of Polycomb and COMPASS Function at Enhancers for Cancer Therapy
    Article Snippet: Paragraph title: NGS Sample Preparation ... Post amplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter.

    Spectrophotometry:

    Article Title: Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate
    Article Snippet: The quality of extracted RNA was checked by measuring the 260/280 and 260/230 ratios using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific) and by running the samples (500 ng) on a 1.5% Tris-Borate-EDTA (TBE) agarose gel prepared with 20 mM of guanidium isothiocyanate (GITC). .. Size-selection and purification was conducted using Agencourt® AMPure® XP reagent (Beckman Coulter).

    Concentration Assay:

    Article Title: Workflow optimization of whole genome amplification and targeted panel sequencing for CTC mutation detection
    Article Snippet: The amplified PCR products were then pooled, purified with the Agencourt AMPure XP beads (Beckman Coulter) and subjected to library preparation including adapter ligation, purification, and size selection using the TruSeq library prep kit (Illumina). .. A final PCR was performed to further amplify adapter-carrying fragments.

    Article Title: Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms
    Article Snippet: After PCR, the samples were purified with Agencourt AMPure XP beads (Beckman Coulter) according to kit’s protocol. .. After ligation, the libraries were purified with Agencourt AMPure XP beads and quantified in the TapeStation 4200 instrument (Agilent Technologies).

    Article Title: Robust BRCA1‐like classification of copy number profiles of samples repeated across different datasets and platforms), Robust BRCA1-like classification of copy number profiles of samples repeated across different datasets and platforms
    Article Snippet: Samples were purified with the Agencourt AMPure XP PCR Purification beads according to manufacturer's instructions (Beckman Coulter, cat no A63881). .. DNA library preparation for Illumina sequencing was done with the TruSeq® DNA LT Sample Preparation kit (Illumina).

    Article Title: Characterization of MHC class I in a long distance migratory wader, the Icelandic black-tailed godwit
    Article Snippet: The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA). .. The PCR products were checked on a 2% agarose gel and cleaned with Agencourt AMPure XP-PCR Purification kit (Beckman Coulter, Indianapolis, USA).

    Staining:

    Article Title: Detection of bacterial DNA from central venous catheter removed from patients by next generation sequencing: a preliminary clinical study
    Article Snippet: After PCR amplification, 5 μl of reaction mixture was applied to gel electrophoresis using a 1.0% agarose gel and subsequently stained with 0.5 μg/ml of ethidium bromide for 30 min. .. The amplified PCR products were purified using the Agencourt AMPure XP beads (Beckman Coulter) according to the manufacturer’s protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Beckman Coulter agencourt ampure xp beads
    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with <t>Agencourt</t> <t>Ampure</t> XP beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 1043 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 1043 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    78
    Beckman Coulter pcr purification bead system
    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single <t>PCR</t> tube. The first-strand <t>cDNA</t> was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.
    Pcr Purification Bead System, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification bead system/product/Beckman Coulter
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr purification bead system - by Bioz Stars, 2019-12
    78/100 stars
      Buy from Supplier

    Image Search Results


    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Journal: Genome Biology

    Article Title: Quartz-Seq: a highly reproducible and sensitive single-cell RNA sequencing method, reveals non-genetic gene-expression heterogeneity

    doi: 10.1186/gb-2013-14-4-r31

    Figure Lengend Snippet: Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Article Snippet: The amplified cDNA was purified using a PCR purification column (MinElute; Qiagen) or a PCR purification bead system (Agencourt AMPure XP; Beckman Coulter Inc., Brea, CA, USA).

    Techniques: Chromatin Immunoprecipitation, Amplification, Polymerase Chain Reaction, Synthesized, Sequencing, Microarray