agencourt ampure xp beads  (Beckman Coulter)


Bioz Verified Symbol Beckman Coulter is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Beckman Coulter agencourt ampure xp beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 1986 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 1986 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Sensitive Assay:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Magnetic Beads:

    Article Title: Pairwise Interactions in Adjuvant Combinations Dictate Immune Responses and Inform Cancer Immunotherapy Design
    Article Snippet: .. Second, pooled full-length cDNA was amplified with 4-6 cycles of single-primer PCR using the following primer: 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ (5Biosg = 5’ biotinylation) and the Advantage 2 PCR Kit (Clontech 639206) in a 50-µL reaction volume and using the following cycling condition: 1 cycle at 95°C for 1 min; 4-6 cycles at 95°C for 15 sec, 65°C for 30 sec, 68°C for 6 min; and 1 cycle at 72°C for 10 min. Amplified cDNAs were cleaned up using 0.6X volume of magnetic beads Agencourt AMPure XP (Beckman Coulter A63880) and quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851). .. Third, 1 ng of cDNA was tagmented and amplified by PCR using the following forward forward 5’-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg*a*t*c*t-3’, where * indicates phosphorothioated DNA bases, and Illumina i7 reverse primers using the Nextera XT Kit (Illumina) with the following cycling conditions: 1 cycle at 72°C for 3 min; 1 cycle at 95°C for 30 sec; 12 cycles at 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec; and 1 cycle at 72°C for 5 min.

    Purification:

    Article Title: Discovery of widespread transcription initiation at microsatellites predictable by sequence-based deep neural network
    Article Snippet: .. The volume of used AMPure XP beads was 46.8ul at 1st purification and 40ul at 2nd purification. ..

    Article Title: MAPS integrates overlooked regulation of actin-targeting effector SteC into the virulence control network of Salmonella small RNA PinT
    Article Snippet: .. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. .. For Illumina NextSeq sequencing, the samples were pooled in approximately equimolar amounts.

    Article Title: Esrrb is a cell cycle dependent priming factor balancing between pluripotency and differentiation
    Article Snippet: .. The ligated product was purified with 1.5x reaction volume of AMPure XP beads (Beckman Coulter, A63881) and eluted in 11.5 μl TE buffer. .. The resulting libraries were PCR amplified using standard PE1/PE2 full-length primer mix containing Illumina library indices for multiplexing (sequences are given in Supplementary Table X).

    Article Title: Temporal and Spatial Heterogeneity of Host Response to SARS-CoV-2 Pulmonary Infection
    Article Snippet: .. PCR reactions were purified with two rounds of AMPure XP beads (Beckman Coulter) at 1.2x beadto-sample ratio. ..

    Article Title: Epigenetic age-predictions in mice using pyrosequencing, droplet digital PCR or barcoded bisulfite amplicon sequencing
    Article Snippet: .. The three amplicons of each donor were pooled at equal concentrations under the quantification of Qubit (Invitrogen), and cleaned up with paramagnetic beads from Agencourt AMPure XP PCR Purification system (Beckman Coulter). .. 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit, Bioo Scientific, Austin, USA) for a second amplification (95°C for 15 min; 16 cycles of 95°C for 30 s, 60°C for 30s, 72°C for 30s; final elongation 72°C for 10min).

    Article Title: Esrrb is a cell cycle dependent priming factor balancing between pluripotency and differentiation
    Article Snippet: .. DNA was purified using ratio of 1:1.8 sample to AMPure XP beads. .. Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs).

    Electrophoresis:

    Article Title: MAPS integrates overlooked regulation of actin-targeting effector SteC into the virulence control network of Salmonella small RNA PinT
    Article Snippet: .. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. .. For Illumina NextSeq sequencing, the samples were pooled in approximately equimolar amounts.

    Polymerase Chain Reaction:

    Article Title: Temporal and Spatial Heterogeneity of Host Response to SARS-CoV-2 Pulmonary Infection
    Article Snippet: .. PCR reactions were purified with two rounds of AMPure XP beads (Beckman Coulter) at 1.2x beadto-sample ratio. ..

    Article Title: Epigenetic age-predictions in mice using pyrosequencing, droplet digital PCR or barcoded bisulfite amplicon sequencing
    Article Snippet: .. The three amplicons of each donor were pooled at equal concentrations under the quantification of Qubit (Invitrogen), and cleaned up with paramagnetic beads from Agencourt AMPure XP PCR Purification system (Beckman Coulter). .. 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit, Bioo Scientific, Austin, USA) for a second amplification (95°C for 15 min; 16 cycles of 95°C for 30 s, 60°C for 30s, 72°C for 30s; final elongation 72°C for 10min).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Beckman Coulter agencourt ampure xp beads
    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with <t>Agencourt</t> <t>Ampure</t> XP beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 95/100, based on 1986 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 95 stars, based on 1986 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    85
    Beckman Coulter pcr purification bead system
    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single <t>PCR</t> tube. The first-strand <t>cDNA</t> was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.
    Pcr Purification Bead System, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification bead system/product/Beckman Coulter
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr purification bead system - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    91
    Beckman Coulter magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit
    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt <t>AMPure</t> paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a <t>PCR</t> reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.
    Magnetic Beads Nucleic Acid Extraction Agencout Ampure Xp Pcr Purification Kit, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit/product/Beckman Coulter
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Journal: Genome Biology

    Article Title: Quartz-Seq: a highly reproducible and sensitive single-cell RNA sequencing method, reveals non-genetic gene-expression heterogeneity

    doi: 10.1186/gb-2013-14-4-r31

    Figure Lengend Snippet: Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Article Snippet: The amplified cDNA was purified using a PCR purification column (MinElute; Qiagen) or a PCR purification bead system (Agencourt AMPure XP; Beckman Coulter Inc., Brea, CA, USA).

    Techniques: Chromatin Immunoprecipitation, Amplification, Polymerase Chain Reaction, Synthesized, Sequencing, Microarray

    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Journal: PLoS Biology

    Article Title: Nucleic acid purification from plants, animals and microbes in under 30 seconds

    doi: 10.1371/journal.pbio.2003916

    Figure Lengend Snippet: Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Article Snippet: Magnetic beads nucleic acid extraction Agencout AMPure XP PCR Purification kit (Beckman Coulter) was used to purify DNA following the manufacturer’s recommendations.

    Techniques: Nucleic Acid Purification, Transferring, Purification, Lysis, Polymerase Chain Reaction, Amplification