agencourt ampure xp beads  (Beckman Coulter)


Bioz Verified Symbol Beckman Coulter is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Beckman Coulter agencourt ampure xp beads
    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with <t>Agencourt</t> <t>Ampure</t> XP beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 1478 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 1478 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Next-generation sequencing library construction on a surface"

    Article Title: Next-generation sequencing library construction on a surface

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4797-4

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads
    Figure Legend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Techniques Used: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    2) Product Images from "Next-generation sequencing library construction on a surface"

    Article Title: Next-generation sequencing library construction on a surface

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4797-4

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads
    Figure Legend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Techniques Used: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Related Articles

    Methylation Sequencing:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: Paragraph title: Reduced representation bisulfite sequencing ... The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: Fragments with 210–290 bp size were selected by gel electrophoresis, purified, and bisulfite treated using EZ DNA Methylation-Gold Kit (Zymo Research, USA). .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. Adapter-ligated cDNA was amplified by linker-mediated PCR (LM-PCR) for 15 cycles and then size selected by gel electrophoresis using 6% Tris-borate-EDTA (TBE) gels (Invitrogen) targeting 145- to 500-bp fragments.

    Amplification:

    Article Title: Implementation of non‐invasive prenatal testing by semiconductor sequencing in a genetic laboratory) Implementation of non‐invasive prenatal testing by semiconductor sequencing in a genetic laboratory
    Article Snippet: .. After the amplification, double‐size selection was performed using Agencourt AMPure XP beads for removal of residual adaptors and primers and potential contaminating genomic maternal DNA. .. Libraries were quantified with the Ion Library Quantitation Kit (Thermo Fisher).

    Article Title: Characterising a human endogenous retrovirus(HERV)-derived tumour-associated antigen: enriched RNA-Seq analysis of HERV-K(HML-2) in mantle cell lymphoma cell lines
    Article Snippet: .. The amplified captured library was finally purified with Agencourt AMPure XP beads (Beckman Coulter), and quantified by real-time PCR for later sequencing. .. For the long-read sequencing, 300 ng of mRNA was synthesised into double-stranded cDNA using the Roche cDNA synthesis kit according to the manufacturer’s instructions.

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). .. Libraries were pooled together and analyzed by paired-end sequencing (2 × 75 bp) read on Illumina Hiseq (High Output Mode).

    Article Title: Commensal Microbiota Promote Lung Cancer Development via γδ T Cells
    Article Snippet: The first PCR amplified the V1–2 region of the 16S rRNA gene with 27F/338R, and added adapters at each end, followed by the second PCR adding full sequencing adapters and barcodes. .. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the PCR products following the manufacturer’s protocol and Kapa HiFi HotStart 2x ReadyMix (Kapa Biosystems) was used for PCR reaction.

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. Adapter-ligated cDNA was amplified by linker-mediated PCR (LM-PCR) for 15 cycles and then size selected by gel electrophoresis using 6% Tris-borate-EDTA (TBE) gels (Invitrogen) targeting 145- to 500-bp fragments.

    Sample Prep:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: The digested product was subsequently purified with the QIAquick PCR Purification Kit (QIAGEN GmbH), end-repaired, 3′-end-adenylated, and adapter-ligated using TruSeq ChIP-Seq Sample Preparation Kit (Illumina, USA). .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: Small RNA libraries were created according to Illumina’s TruSeq stranded RNA sample preparation (Rev.C) guide and using the Illumina TruSeq stranded RNA kit (Illumina Inc.), with modifications. cDNA was synthesized as described above. .. The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter).

    Methylation:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: Fragments with 210–290 bp size were selected by gel electrophoresis, purified, and bisulfite treated using EZ DNA Methylation-Gold Kit (Zymo Research, USA). .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Isolation:

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. Excised gel fragments were macerated using “gel breaker” tubes. cDNA was eluted from the gel debris with DNA storage solution in 1.5-ml tubes with rotation, isolated via an acetate column, and then ethanol precipitated.

    Ligation:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: Ten microliters of the RNA adapter index adapter oligonucleotides and 3 μL of ligation mix were used in a 45 μL reaction system and the ligation was performed for 10 min at 30 °C in the adapter-ligation step. .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: Following synthesis of the double-stranded cDNA, samples were extracted in equal volumes of phenol-chloroform-isoamyl alcohol (25:24:1), and the cDNA was ethanol precipitated. cDNAs were adenylated with a single “A” base, followed by ligation of an adapter. .. The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter).

    Purification:

    Article Title: Characterising a human endogenous retrovirus(HERV)-derived tumour-associated antigen: enriched RNA-Seq analysis of HERV-K(HML-2) in mantle cell lymphoma cell lines
    Article Snippet: .. The amplified captured library was finally purified with Agencourt AMPure XP beads (Beckman Coulter), and quantified by real-time PCR for later sequencing. .. For the long-read sequencing, 300 ng of mRNA was synthesised into double-stranded cDNA using the Roche cDNA synthesis kit according to the manufacturer’s instructions.

    Article Title: High prevalence of the MLH1 V384D germline mutation in patients with HER2-positive luminal B breast cancer
    Article Snippet: .. The resulting libraries were PCR-amplified and purified with Agencourt AMPure XP beads. .. Captured libraries were PCR-amplified using Illumina p5 and p7 primers and purified with Agencourt AMPure XP beads.

    Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
    Article Snippet: .. Libraries were purified using 1x volumes Agencourt AMPure XP beads. .. The fragment size distribution of the libraries was evaluated in a High-Sensitivity Bioanalyzer run (Agilent, #5067-4626, US) and the size selection was repeated when there was a large proportion of fragments longer than 500 bp (replicate 1 t05, t15, t30, t35, t40).

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). .. Libraries were pooled together and analyzed by paired-end sequencing (2 × 75 bp) read on Illumina Hiseq (High Output Mode).

    Article Title: LANA Binds to Multiple Active Viral and Cellular Promoters and Associates with the H3K4Methyltransferase hSET1 Complex
    Article Snippet: .. The DNA was re-amplified for 22 PCR cycles with primers ( 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and 5′-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT ), and purified using Agencourt AMPure XP beads. .. The libraries were quantified with QuantIT dsDNA Assay Kit (Invitrogen) and sequenced as above.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. The amplicons from these two reactions for each sample were pooled, size-selected with Agencourt AMPure XP beads at a ratio of 0.8, and the supernatant from this was further size-selected and purified at a ratio of 1.6. .. The purified second-step PCR library was quantified by Qubit dsDNA HS assay (Thermo Fisher Scientific) and used for downstream sequencing on an Illumina MiSeq platform.

    Article Title: Next-generation sequencing library construction on a surface
    Article Snippet: .. The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter). ..

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: .. The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. Adapter-ligated cDNA was amplified by linker-mediated PCR (LM-PCR) for 15 cycles and then size selected by gel electrophoresis using 6% Tris-borate-EDTA (TBE) gels (Invitrogen) targeting 145- to 500-bp fragments.

    Article Title: Mapping Cellular Reprogramming via Pooled Overexpression Screens with Paired Fitness and Single Cell RNA-Sequencing Readout
    Article Snippet: .. The thermocycling parameters were: 95 °C for 3 min; 6 cycles of (98 °C for 20 s; 65 °C for 20 s; 72 °C for 30 s); and 72 °C for 2 mi n. The amplicons from these two reactions for each sample were pooled, size-selected with Agencourt AMPure XP beads at a ratio of 0.8, and the supernatant from this was further size-selected and purified at a ratio of 1.6. .. The purified second-step PCR library was quantified by Qubit dsDNA HS assay (Thermo Fisher Scientific) and used for downstream sequencing on an Illumina MiSeq platform.

    Real-time Polymerase Chain Reaction:

    Article Title: Characterising a human endogenous retrovirus(HERV)-derived tumour-associated antigen: enriched RNA-Seq analysis of HERV-K(HML-2) in mantle cell lymphoma cell lines
    Article Snippet: .. The amplified captured library was finally purified with Agencourt AMPure XP beads (Beckman Coulter), and quantified by real-time PCR for later sequencing. .. For the long-read sequencing, 300 ng of mRNA was synthesised into double-stranded cDNA using the Roche cDNA synthesis kit according to the manufacturer’s instructions.

    Article Title: Commensal Microbiota Promote Lung Cancer Development via γδ T Cells
    Article Snippet: For quantification of total bacterial burden, qPCR was performed with universal 16S primers targeting the V1–2 region (27F: AGAGTTTGATCMTGGCTCAG, 338R: TGCTGCCTCCCGTAGGAGT) and the Kapa SYBR Fast 2X master mix (Kapa Biosystems). .. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the PCR products following the manufacturer’s protocol and Kapa HiFi HotStart 2x ReadyMix (Kapa Biosystems) was used for PCR reaction.

    Sequencing:

    Article Title: Characterising a human endogenous retrovirus(HERV)-derived tumour-associated antigen: enriched RNA-Seq analysis of HERV-K(HML-2) in mantle cell lymphoma cell lines
    Article Snippet: .. The amplified captured library was finally purified with Agencourt AMPure XP beads (Beckman Coulter), and quantified by real-time PCR for later sequencing. .. For the long-read sequencing, 300 ng of mRNA was synthesised into double-stranded cDNA using the Roche cDNA synthesis kit according to the manufacturer’s instructions.

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). .. Libraries were pooled together and analyzed by paired-end sequencing (2 × 75 bp) read on Illumina Hiseq (High Output Mode).

    Article Title: Commensal Microbiota Promote Lung Cancer Development via γδ T Cells
    Article Snippet: The first PCR amplified the V1–2 region of the 16S rRNA gene with 27F/338R, and added adapters at each end, followed by the second PCR adding full sequencing adapters and barcodes. .. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the PCR products following the manufacturer’s protocol and Kapa HiFi HotStart 2x ReadyMix (Kapa Biosystems) was used for PCR reaction.

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: Paragraph title: Library preparation and sequencing for sRNA-seq. ... The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter).

    Incubation:

    Article Title: Next-generation sequencing library construction on a surface
    Article Snippet: Tn5 transposases, purified as previously described [ ], were loaded onto the poly-acrylamide gel slide and incubated at 37 °C for 1 h. The slide was then washed several times with Tn5 wash buffer (100 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA and 0.2% Triton-X100), and the surface was allowed to dry while preparing the tagmentation mix (1 μl 10× TAPS-MgCl2 , 2 μl 40% PEG8000, 4 μl H2 O and 3 μl 200 ng/μl DNA). .. The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Selection:

    Article Title: Implementation of non‐invasive prenatal testing by semiconductor sequencing in a genetic laboratory) Implementation of non‐invasive prenatal testing by semiconductor sequencing in a genetic laboratory
    Article Snippet: .. After the amplification, double‐size selection was performed using Agencourt AMPure XP beads for removal of residual adaptors and primers and potential contaminating genomic maternal DNA. .. Libraries were quantified with the Ion Library Quantitation Kit (Thermo Fisher).

    E. coli Genomic Assay:

    Article Title: Commensal Microbiota Promote Lung Cancer Development via γδ T Cells
    Article Snippet: E. coli genomic DNA was used as a standard, with samples at 1, 0.1, 0.01, and 0.001 ng per reaction used to create a standard curve. .. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the PCR products following the manufacturer’s protocol and Kapa HiFi HotStart 2x ReadyMix (Kapa Biosystems) was used for PCR reaction.

    Polymerase Chain Reaction:

    Article Title: High prevalence of the MLH1 V384D germline mutation in patients with HER2-positive luminal B breast cancer
    Article Snippet: .. The resulting libraries were PCR-amplified and purified with Agencourt AMPure XP beads. .. Captured libraries were PCR-amplified using Illumina p5 and p7 primers and purified with Agencourt AMPure XP beads.

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). .. Libraries were pooled together and analyzed by paired-end sequencing (2 × 75 bp) read on Illumina Hiseq (High Output Mode).

    Article Title: LANA Binds to Multiple Active Viral and Cellular Promoters and Associates with the H3K4Methyltransferase hSET1 Complex
    Article Snippet: .. The DNA was re-amplified for 22 PCR cycles with primers ( 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and 5′-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT ), and purified using Agencourt AMPure XP beads. .. The libraries were quantified with QuantIT dsDNA Assay Kit (Invitrogen) and sequenced as above.

    Article Title: Commensal Microbiota Promote Lung Cancer Development via γδ T Cells
    Article Snippet: .. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the PCR products following the manufacturer’s protocol and Kapa HiFi HotStart 2x ReadyMix (Kapa Biosystems) was used for PCR reaction. .. The final PCR products were quantified using the Qubit DNA assay (Thermo Fisher Scientific), and all samples were normalized and pooled at equal mass for the final sequencing pool.

    Article Title: Next-generation sequencing library construction on a surface
    Article Snippet: .. The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter). ..

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. Adapter-ligated cDNA was amplified by linker-mediated PCR (LM-PCR) for 15 cycles and then size selected by gel electrophoresis using 6% Tris-borate-EDTA (TBE) gels (Invitrogen) targeting 145- to 500-bp fragments.

    Chromatin Immunoprecipitation:

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter). .. The quality and quantity of the finished libraries were assessed using an Agilent high-sensitivity DNA chip (Agilent Technologies) and a Qubit dsDNA HS assay kit (Invitrogen), respectively.

    Synthesized:

    Article Title: Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
    Article Snippet: Small RNA libraries were created according to Illumina’s TruSeq stranded RNA sample preparation (Rev.C) guide and using the Illumina TruSeq stranded RNA kit (Illumina Inc.), with modifications. cDNA was synthesized as described above. .. The adapter-ligated material was purified using Agencourt AMPure XP beads (Beckman Coulter).

    ChIP-sequencing:

    Article Title: Dynamic DNA methylation landscape defines brown and white cell specificity during adipogenesis
    Article Snippet: The digested product was subsequently purified with the QIAquick PCR Purification Kit (QIAGEN GmbH), end-repaired, 3′-end-adenylated, and adapter-ligated using TruSeq ChIP-Seq Sample Preparation Kit (Illumina, USA). .. The bisulfite converted DNA was then PCR amplified, purified by by Agencourt AMPure XP Beads (Beckman Coulter Inc.) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

    Hybridization:

    Article Title: Characterising a human endogenous retrovirus(HERV)-derived tumour-associated antigen: enriched RNA-Seq analysis of HERV-K(HML-2) in mantle cell lymphoma cell lines
    Article Snippet: After hybridisation, the enriched fragment library was captured using streptavidin beads (Dynabeads MyOne Streptavidin T1, Invitrogen) and purified, also according to the same enrichment protocol. .. The amplified captured library was finally purified with Agencourt AMPure XP beads (Beckman Coulter), and quantified by real-time PCR for later sequencing.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Beckman Coulter agencourt ampure xp beads
    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with <t>Agencourt</t> <t>Ampure</t> XP beads
    Agencourt Ampure Xp Beads, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 99/100, based on 1478 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agencourt ampure xp beads/product/Beckman Coulter
    Average 99 stars, based on 1478 article reviews
    Price from $9.99 to $1999.99
    agencourt ampure xp beads - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Beckman Coulter pcr purification bead system
    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single <t>PCR</t> tube. The first-strand <t>cDNA</t> was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.
    Pcr Purification Bead System, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification bead system/product/Beckman Coulter
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr purification bead system - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    92
    Beckman Coulter magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit
    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt <t>AMPure</t> paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a <t>PCR</t> reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.
    Magnetic Beads Nucleic Acid Extraction Agencout Ampure Xp Pcr Purification Kit, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit/product/Beckman Coulter
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    magnetic beads nucleic acid extraction agencout ampure xp pcr purification kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Journal: BMC Genomics

    Article Title: Next-generation sequencing library construction on a surface

    doi: 10.1186/s12864-018-4797-4

    Figure Lengend Snippet: Drosophila sequencing library. a and b Agarose gel (2%) demonstrating the PCR products from surface tagmentation, various amount of acrydite oligonucleotides were used when casting the poly-acrylamide gel. c Agarose gel (2%) demonstrating the sequencing library after surface tagmentation and 16 cycles of PCR. The sequencing library was size selected with Agencourt Ampure XP beads

    Article Snippet: The PCR products were purified and size selected by Agencourt AMPure XP beads (Beckman Coulter).

    Techniques: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Acrylamide Gel Assay

    Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Journal: Genome Biology

    Article Title: Quartz-Seq: a highly reproducible and sensitive single-cell RNA sequencing method, reveals non-genetic gene-expression heterogeneity

    doi: 10.1186/gb-2013-14-4-r31

    Figure Lengend Snippet: Schematic of the single-cell Quartz-Seq and Quartz-Chip methods . All of the steps of the whole-transcript amplification were executed in a single PCR tube. The first-strand cDNA was synthesized using the reverse transcription (RT) primer, which contains oligo-dT24, the T7 promoter (T7) and the PCR target region (M) sequences. After the first-strand synthesis, the majority of the RT primer was digested by exonuclease I, although it was not possible to eliminate the RT primer completely using this procedure. A poly-A tail was then added to the 3' ends of the first-strand cDNA and to any surviving RT primer. After the second-strand synthesis with the tagging primer, the resulting cDNA and the byproducts from the surviving primers contained the whole-transcript amplification (WTA) adaptor sequences, which include the RT primer sequence and the tagging primer sequence. These DNAs were used for the suppression PCR, which used the suppression PCR primer. Enrichment of the short DNA fragments, such as the byproducts, was suppressed. After the enrichment, the high-quality cDNA, which did not contain any byproducts, was obtained. The amplified cDNAs then had the T7 promoter sequence at the 3' ends of the DNA. These cDNAs were used for the Illumina sequencing and microarray experiments.

    Article Snippet: The amplified cDNA was purified using a PCR purification column (MinElute; Qiagen) or a PCR purification bead system (Agencourt AMPure XP; Beckman Coulter Inc., Brea, CA, USA).

    Techniques: Chromatin Immunoprecipitation, Amplification, Polymerase Chain Reaction, Synthesized, Sequencing, Microarray

    Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Journal: PLoS Biology

    Article Title: Nucleic acid purification from plants, animals and microbes in under 30 seconds

    doi: 10.1371/journal.pbio.2003916

    Figure Lengend Snippet: Cellulose dipsticks outperform a commercially available nucleic acid purification system. (A) The time required, number of pipetting steps involved, and the costs of all consumables—including tubes and pipette tips—were calculated for purification of nucleic acids from Arabidopsis leaf tissue using either the cellulose dipstick or Agencourt AMPure paramagnetic beads. All solutions that could be prepared in advance, including lysis and wash buffers, were made and prealiquoted. The time and pipetting involved in the preparation of these solutions was not added to the tallies in the table. (B) Purified Arabidopsis DNA at different concentrations was a captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads (Beckman Coulter). The eluted DNA was used in a PCR reaction with using primers designed for the G-protein gamma subunit 1 gene. The band intensities relative to the 1 ng/μl paramagnetic bead sample appear below each band. (C) Different volumes of an Arabidopsis leaf extract were captured, washed, and eluted using either the cellulose dipsticks or AMPure paramagnetic beads and subsequently amplified in a PCR reaction as described above. The band intensities relative to the 50 μl paramagnetic bead sample appear below each band. n.a., no amplification; USD, United States Dollar.

    Article Snippet: Magnetic beads nucleic acid extraction Agencout AMPure XP PCR Purification kit (Beckman Coulter) was used to purify DNA following the manufacturer’s recommendations.

    Techniques: Nucleic Acid Purification, Transferring, Purification, Lysis, Polymerase Chain Reaction, Amplification