agei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HindIII
    Description:
    HindIII 50 000 units
    Catalog Number:
    R0104L
    Price:
    244
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs agei
    HindIII
    HindIII 50 000 units
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal:

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    2) Product Images from "Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon"

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon

    Journal: Virology Journal

    doi: 10.1186/1743-422X-6-173

    Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.
    Figure Legend Snippet: Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Techniques Used: Sequencing, Expressing, Transfection

    3) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal:

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    Related Articles

    Transduction:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Clone Assay:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Amplification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Stable Transfection:

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Synthesized:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Autoradiography:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    TA Cloning:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Construct:

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: Paragraph title: APE1 Plasmid Constructs ... The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ.

    Real-time Polymerase Chain Reaction:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Incubation:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Luciferase:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Activity Assay:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: Paragraph title: Enzyme activity assays ... The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Expressing:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: To create the fluorescently-tagged APE1 variant expression systems, the APE1 cDNA was PCR amplified from the respective pET11a plasmid constructs above using the following primers: Forward, 5′-CCCCAAGCTTTAATGCCGAAGCGTGG-3′ and Reverse, 5′-CGGGATCCTCACAGTGCTAGGTATAGG-3′ . .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Modification:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: Paragraph title: Construction of the modified EZ-Tn5 transposon vector and transposome preparation ... The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs).

    Transformation Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: After digestion with Dpn1, the DNA mix was transformed into XL10-Gold Ultracompetent cells (Stratagene), and selected clones were sequence confirmed by the Johns Hopkins Synthesis and Sequencing Facility (Baltimore, MD). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The digested EZ-Tn5 -carrying pMOD-2 plasmid and the erm gene PCR product were ligated overnight at 4°C with T4 DNA ligase (New England Biolab).

    Hybridization:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Countercurrent Chromatography:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Transfection:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: Paragraph title: Plasmids and Gene Transfection ... The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Southern Blot:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Ligation:

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Generated:

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. Genospecies’ designation of the isolates was performed by analyzing the resulting genospecies-specific PCR-RFLP patterns according to Michel et al. .

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    DNA Labeling:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Sequencing:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Sequencing revealed that the genes encoding several EsaR* variants had multiple mutations ( ). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Binding Assay:

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    DNA Extraction:

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Paragraph title: Genomic DNA Isolation and Southern Blot Hybridization ... A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA.

    Mutagenesis:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Paragraph title: Site-directed mutagenesis ... Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Aspartate-to-alanine mutations were made at amino acid position 53 (GAC- > GCC) and 878 (GAT- > GCT) of the BCBL-1 LANA amino acid sequence (GENBANK accession number U93872).

    Isolation:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Subcloning:

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: Paragraph title: MCL1 promoter sub-cloning ... Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    Labeling:

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    Hot Start PCR:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: An oligonucleotide, SHU5, reverse primer (5′ TCTAGAAAAA GATACCATGTGCTAGTGAACCTGACAGGAAG GGTTCACTA GCACATGGTATCGGTG 3′ ), containing the sequences complementary to the 3′ end of the U6 promoter, sense siRNA (bold letters), mir23 loop (italic letters) antisense siRNA (bold letters) and the string of As was synthesized and used in a hot start PCR reaction with the U6NSB forward primer. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. The 3C product was quantified by qPCR after diluting the template 10-fold in comparison with purified genomic DNA of known concentration.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: A discrete chromatin loop in the murine Tcra-Tcrd locus shapes the TCRδ and TCRα repertoires
    Article Snippet: Hind III (NEB) was used to digest chromatin. .. 3C products were quantified by Taqman-based quantitative real-time PCR as described .

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites. .. PROMO analysis was carried out on the three fragments to identify putative transcription factors binding sites.

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The polIII short hairpin expression plasmids were constructed applying a PCR-based approach. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Borrelia valaisiana Resist Complement-Mediated Killing Independently of the Recruitment of Immune Regulators and Inactivation of Complement Components
    Article Snippet: Genotyping of borrelial isolates was performed by PCR amplification of the ospA gene followed by restriction fragment length polymorphism analysis as described by Michel et al. . .. For differentiation, PCR-generated ospA fragments were digested separately with 0.5 U of restriction endonucleases BglII, SspI, HindIII (New England Biolabs, Frankfurt, Germany), Kpn21 (Fermentas, St. Leon-Rot, Germany), and SfuI (Roche Applied Science, Mannheim, Germany) overnight according to the manufactureŕs instruction. .. The digested PCR fragments were then analyzed by electrophoresis on a 2% agarose gel and visualized with ethidium bromide.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: 2.5 To construct pCMV6-XL5-ERBB1 which expresses human ERBB1, the full length human ERBB1 coding sequence was amplified by PCR from LNCaP cDNA using Kpn1-forward primer (5′-GGTACCCGGCCCCCTGACTCCGTCCAG-3′) and HindIII-reverse primer (5′-AAGCTTTCATGCTCCAATAAATTCACTGCTTTGTGGC-3′). .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The construct was sequenced to ensure the integrity of the entire coding sequence and correct orientation of the gene.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    shRNA:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: Paragraph title: Construction of the PolIII shRNA Expression Plasmids ... The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Purification:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The reaction mix was overlaid with an ampliwax bead and subjected to 80°C heating for five minutes, 24°C for one minute and cooled down to 4°C for two minutes. .. The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Plasmid Preparation:

    Article Title: MicroRNA-431 regulates axon regeneration in mature sensory neurons by targeting the Wnt antagonist Kremen1
    Article Snippet: Afterward, the bonds between RNA and protein were disrupted by heating at 50°C for 30 min. RNA was then extracted and purified using Trizol (Invitrogen) and used for qRT-PCR. .. Luciferase assays were performed using the pMIR-REPORTTM miRNA expression reporter vector system (Ambion). pMIR-REPORT firefly luciferase (FL) plasmids were purified with Miniprep kit (Qiagen, Valencia, CA, USA) and digested with restriction enzymes Spe I and Hind III (New England BioLabs, Ipswich, MA, USA). .. Linearized vectors from the restriction digestion were retrieved by agarose gel electrophoresis and gel purification of DNA using Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, GA, USA).

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB). .. The resulting fragments were ligated together and transformed into E. coli Top10 pRNP-lacZ .

    Article Title: Resistance to HSP90 inhibition involving loss of MCL1 addiction
    Article Snippet: The full-length MCL1 promoter (352 bp) and the pGL2 basic empty vector were kindly donated by Prof. El-Tanani (Centre for Cancer Research and Cell Biology, Queens University Belfast, Belfast, UK). .. Three fragments of 277 bp, 193 bp and 115 bp have been generated by PCR and directional cloning with Xho I and Hin dIII (New England Biolabs, Ipswich, MA, USA) restriction sites.

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The amplification program used was as follows: one cycle of 95°C for five minutes to denature the AMV reverse transcriptase, twenty-eight cycles of 55°C annealing, 72°C extension and 94°C denaturation for one minute each.

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech). .. Recombinant plasmid sequences were confirmed as above.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The fusion protein was expressed in T7 Express lysY/Iq E. coli (NEB) and purified over amylose resin according to the manufacturer's instructions.

    Article Title: Loss of Canonical Smad4 Signaling Promotes KRAS Driven Malignant Transformation of Human Pancreatic Duct Epithelial Cells and Metastasis
    Article Snippet: Smad4 expression was stably downregulated by shRNA retroviral transduction method using Phoenix-amphotropic packaging cell line (ATCC, Manassas, VA, USA). .. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Whitby, ON, Canada). .. The shRNA oligonucleotides used were: S4KD1: ggacaatatgtctattacgaa ; S4KD2: gcagtgactttgtatagagaa ; S4KD3: actgctaaattctatgttaaa ; S4KD4: ggtggagagagtgaaacattt ; and non-silencing (NS) control siRNA sequence: ttctccgaacgtgtcacgt (Qiagen, Venlo, Netherlands ).

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: One unit of enzyme was defined an amount that solubilizes 5 nmol of dsDNA at 37°C in 20 min. Chi cutting and DNA unwinding activities were measured together [ ]. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. DNA substrate (4.5 nM) was mixed with the indicated amount of cell-free extract in 20 mM MOPS pH 7.5, 3.5 mM MgCl2 , 5 mM ATP, 1 mM DTT, and 1.6 μM SSB (Promega).

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: To modify the EZ-Tn5 -carrying plasmid pMOD-2 (Epicentre) for use in C. perfringens , a single colony of an E. coli strain encoding the EZ-Tn5 pMOD-2 vector was inoculated into 10 ml of LB broth supplemented with ampicillin (LBA) and then incubated overnight at 37°C with shaking (250 RPM). .. The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Bordetella pertussis Autotransporter Vag8 Binds Human C1 Esterase Inhibitor and Confers Serum Resistance
    Article Snippet: The detailed construction of pBrkA ) is as follows. .. The entire brkA locus of vector pRF1066 , beginning from the NruI site of the adjacent brkB gene, was cloned into the broad-range vector pBBR1MCS using NruI and HindIII (New England Biolabs), and a 476-bp fragment of brkB was deleted using AatII (New England Biolabs). .. The promoter region of cpn10 (Pcpn10 ) was amplified by PCR from genomic DNA of B. pertussis BP338 (isolated with DNeasy® tissue kit from QIAGEN according to the manufacturer's instructions) using Vent® DNA polymerase (New England Biolabs) and primers Pcpn10fw1 ( GTGTATCCCGGTACCTGAGCCCAGC ) and Pcpn10rev1 ( GACGCAGGTACCTGAGGAACTCCTG ).

    Article Title: Inhibition of ERBB2-overexpressing Tumors by Recombinant Human Prolidase and Its Enzymatically Inactive Mutant
    Article Snippet: The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes. .. The amplified PCR product was digested by KpnI and HindIII (New England BioLabs), followed by ligation into pCMV6-XL5 (Origene) which was pre-digested with the same restriction enzymes.

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA). .. Three additional FLAG-tagged LANA expression vectors were prepared containing mutations in putative caspase cleavage sites.

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Recombinant:

    Article Title: Cell Cycle Abnormalities Associated with Differential Perturbations of the Human U5 snRNP Associated U5-200kD RNA Helicase
    Article Snippet: The top phase of the reaction consists of Taq DNA polymerase buffer 10 nanograms of the purified S5S fragment previously digested with DraIII and HindIII restriction enzymes (New England Biolabs) and 1.5 units of Taq DNA polymerase in a volume of 75 µl. .. The polIII short hairpin cassette was gel purified and cloned into the PCR2.1 plasmid by TA cloning.

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: Anti-VP2 polyclonal serum was raised by immunizing a rabbit (Lampire Biological Products) with purified recombinant MCV VP2 immunogens expressed in bacteria. .. The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB).

    Agarose Gel Electrophoresis:

    Article Title: High Incidence of Malaria Along the Sino–Burmese Border Is Associated With Polymorphisms of CR1, IL-1A, IL-4R, IL-4, NOS, and TNF, But Not With G6PD Deficiency
    Article Snippet: The F2 and R2 primers (Table ) were used to PCR amplify cDNA containing the T520C SNP in intron 27 of CR1, producing a PCR product approximately 1800 bp in size. .. The PCR product was digested using the restriction enzyme, Hind III (New England Biolabs, Ipswich, MA), and the restriction fragments were analyzed by agarose gel electrophoresis. .. The homozygous wild-type genotype, 520T/520T (H/H allele), produces one 1800-bp restriction fragment.

    Article Title: Construction of recB-recD genetic fusion and functional analysis of RecBDC fusion enzyme in Escherichia coli
    Article Snippet: The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column. .. The substrate, plasmid DNA χ+ F, was made linear with HindIII (New England BioLabs), incubated with shrimp alkaline phosphatase (SAP) (Invitrogen) at 37°C for 30 min, and labeled with γ32 P at the 5'ends by T4 polynucleotide kinase (Invitrogen) at 25°C for 30 min. Free nucleotides were removed with an SR-200 mini column.

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Article Title: Cloning and Characterization of an Armillaria gallica cDNA Encoding Protoilludene Synthase, Which Catalyzes the First Committed Step in the Synthesis of Antimicrobial Melleolides
    Article Snippet: Cells were then harvested by centrifugation, resuspended in protoilludene assay buffer, and lysed using a microfluidizer. .. A. gallica genomic DNA was isolated using the cetyltrimethylammonium bromide method, and 120 μg was digested with 50 units of BamHI, EcoRI, or HindIII (New England Biolabs), as appropriate, for 8 h. The digested DNA was fractionated by 0.7% agarose gel electrophoresis at a constant 50 V overnight, transferred to a positively charged nylon membrane (Roche Applied Science) and prehybridized with Roti®-Hybri-Quick (Roth) containing single-stranded salmon sperm DNA. .. Two nucleic acid probes (∼400 bp) were synthesized by PCR using forward primer (5′-CCT TCC TGA TAC TCT TGC CAA CTG-3′) and reverse primer (5′-CCT CCT CCG TCG AGA CGT CCG AGT AC-3′) for probe 1 and forward primer (5′-GTC ATC AAT CAT CCG GTT ATC AAA G-3′) and reverse primer (5′-CTT GGG CAT CAG CGT TAT CCA CCT C-3′) for probe 2.

    In Vitro:

    Article Title: HIV-1 TAR miRNA protects against apoptosis by altering cellular gene expression
    Article Snippet: TAR-WT and TAR-D were transcribed from previously described T7 expression vectors [ ]. .. For in vitro transcription reactions 1.5 μg of each plasmid was linearized with HindIII (New England Biolabs), ethanol precipitated and used for in vitro transcription via the MegaScript High Yield Transcription Kit (Ambion). .. After transcription TAR RNA was purified on a 2% agarose gel, eluted from the gel with 0.5 M NaAcetate, 1 mM EDTA, 0.2% SDS, and ethanol precipitated before re-suspension in DEPC treated water. siDicer, siLuc, siEGFP and siERCC1 were obtained from a commercial source (Dharmacon).

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Paragraph title: Production of FLAG-tagged LANA and in vitro caspase cleavage of FLAG-LANA ... The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    Concentration Assay:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: For the NDRG1 locus, fixed chromatin from 5×106 cells was digested with 400 units of Hind III (NEB). .. Ligation was done with 800 units of T4 DNA ligase (NEB) for 4 hrs.

    CTG Assay:

    Article Title: Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses
    Article Snippet: Full-length ORF73 (LANA) gene was amplified by PCR with specific primers: ORF73F- CAT GAA TTC ATG GCG CCC CCG GGA ATG CGC, and ORF73R- CAT AAG CTT TGT CAT TTC CTG TGG AGA GTC containing EcoRI and HindIII restriction sites at the 5' and 3' ends, respectively. .. The amplified products were digested with EcoRI and HindIII (New England BioLabs, Ipswich, MA) and inserted into the EcoRI and HindIII restriction sites of a FLAG-tagged expression vector, pCMV-Tag2B (Agilent Technologies, Santa Clara, CA).

    BAC Assay:

    Article Title: Construction and Characterization of a Bacterial Artificial Chromosome Library for the Hexaploid Wheat Line 92R137
    Article Snippet: Because the advantage of easy handling, stability, and low chimerism, the BAC library technique has become relatively popular in modern genetics research compared with other large insert clone techniques [ ]. .. To create such genetic resource for map-based cloning of stripe rust resistance gene Yr26 in wheat line 92R137, a large BAC library consisting of 765,696 clones was constructed by digesting genomic DNA of 92R137 with Hin dIII and Bam HI. .. The different cloning sites were chosen to enhance unbiased genome representation and minimize the numbers of gaps between BAC contigs that result from uneven restriction site distributions [ , , ].

    Marker:

    Article Title: DAYSLEEPER: a nuclear and vesicular-localized protein that is expressed in proliferating tissues
    Article Snippet: DAYSLEEPER promoter constructs were made in pCAMBIA1304 (CAMBIA foundation) to obtain promoter-reporter gene fusions. .. First, to separate the DAYSLEEPER promoter from promoter elements present on the pCAMBIA1304 vector, λ phage HindIII DNA marker (New England Biolabs®) was digested using KpnI and BamHI and the 5 kb fragment was cloned into the respective sites in the multiple cloning sites (MCS) of pCAMBIA1304, resulting in pCAMBIA1304λ. .. Using primer combination MK3 and MK4, 6.1 kb of the DAYSLEEPER upstream region was amplified from genomic DNA.

    Gel Extraction:

    Article Title: Acyl-Homoserine Lactone Recognition and Response Hindering the Quorum-Sensing Regulator EsaR
    Article Snippet: Following the first round of PCR, the desired fragment was gel purified using a Qiaquick Gel Extraction Kit (Qiagen) and a second round of PCR with external primers BADVF and BADR or BADR500 was performed in order to obtain a full length esaR gene containing the mutation. .. Upon completion of the second round of PCR, the full-length esaR* gene and pBAD22 vector were digested with Nhe I and Hind III (NEB).

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13
    Article Snippet: The plasmid was extracted with a QIAprep Spin plasmid extraction kit (Qiagen) and simultaneously digested with EcoRI and HindIII (New England Biolabs). .. The erythromycin resistance gene (erm ) from the E. coli-C. perfringens shuttle vector pJIR751 was amplified by PCR using JumpStart REDTaq ready mix (Sigma-Aldrich) and primers erm-Fwd-EcoRI and erm-Rev-HindIII ( ).

    Variant Assay:

    Article Title: Functional Assessment of Population and Tumor-Associated APE1 Protein Variants
    Article Snippet: The A317V variant was amplified using a modified reverse primer, which harbored the unique codon sequence for amino acid residue 317∶5′-CGGGATCCTTCACAG TACTAGGTATAGG-3′. .. The PCR products were digested with BamHI and HindIII (New England BioLabs) and subcloned into the pmCherry-C1 vector (Clontech).

    Article Title: The Merkel Cell Polyomavirus Minor Capsid Protein
    Article Snippet: The rabbit was initially primed with a maltose binding protein (MBP)-VP2 fusion protein expressed from plasmid pMVP2M, which was made by PCR-mediated transfer of the VP2 ORF of ph2m into the HindIII and BamHI sites of pMXB10 (NEB). .. The VP2 PCR product incorporated a recognition site for tobacco etch virus (TEV) protease between the MBP and VP2.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs agei
    Schematic overview of the construction of the <t>C92/P98</t> chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + <t>AgeI-F;</t> P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Agei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    97
    New England Biolabs agei hf
    RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 <t>AgeI</t> used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) <t>RT-PCR</t> performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.
    Agei Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei hf/product/New England Biolabs
    Average 97 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    agei hf - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    Image Search Results


    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Journal:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    doi: 10.1128/JVI.02956-12

    Figure Lengend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Article Snippet: The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Techniques:

    Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Journal: Virology Journal

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon

    doi: 10.1186/1743-422X-6-173

    Figure Lengend Snippet: Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Article Snippet: The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ].

    Techniques: Sequencing, Expressing, Transfection

    RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 AgeI used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) RT-PCR performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.

    Journal: Nucleic Acids Research

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli

    doi: 10.1093/nar/gkw1018

    Figure Lengend Snippet: RtcB re-ligates RNA43 to purified 70S Δ43 ribosomes in vitro . ( A ) Schematic showing the in vitro ribosome repair assay (see text for details). ( B ) RNA43 AgeI used in the assay. Nucleotides changed in helix 45 and the binding site for primers Y12 (gray) and H17 (green) are indicated. ( C ) RT-PCR performed on RNA purified from 70S Δ43 ribosomes incubated in the absence of RtcB and RNA43 AgeI (lane 1), in the presence of either RNA43 AgeI (lane 2) or RtcB (lane 3), or both (lane 4) employing primer pairs specific for the central region of 16S rRNA (S7/X15; panel a), the 3΄end of 16S rRNA (S7/Y12; panel b), and specific for the AU nucleotide change present in 16S AgeI rRNA upon successful ligation (S7/H17; panel c). ( D ) AgeI restriction analysis and ( E ), sequencing of the RT-PCR product obtained with primer pair S7/H17 (shown in C, panel c, lane 4). Sequencing analyses from position 1509–1517 of the 16S rRNA of (a) rrsB , and (b) the RT-PCR product are shown. Nucleotides changed in RNA43 AgeI are underlined.

    Article Snippet: For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Techniques: Purification, In Vitro, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Incubation, Ligation, Sequencing