agei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    AgeI
    Description:
    AgeI 1 500 units
    Catalog Number:
    r0552l
    Price:
    298
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs agei
    AgeI
    AgeI 1 500 units
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon"

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon

    Journal: Virology Journal

    doi: 10.1186/1743-422X-6-173

    Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.
    Figure Legend Snippet: Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Techniques Used: Sequencing, Expressing, Transfection

    2) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal: Journal of Virology

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    3) Product Images from "Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System"

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    Journal: Journal of Virology

    doi: 10.1128/JVI.02956-12

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Figure Legend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: Mechanism of the Antigen-Independent Cytokinergic SPE-7 IgE Activation of Human Mast Cells in Vitro
    Article Snippet: Paragraph title: Fab PIPE Cloning ... This purified pVITRO1_SPE-7 IgE light-chain plasmid was linearised at MCS2 by AgeI and NheI restriction enzyme digest (New England Biolabs).

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: Paragraph title: 2.2. Protein design and cloning ... The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence.

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: Construction of guide RNA plasmids Plasmid pMLM3636 (plasmid ID 43860) was obtained from Addgene, cut with BsmBI and a double-stranded DNA fragment, generated by annealing the two oligos MLM3636-1F (5′-ATCTTGTGGAAAGGACGAAACACCGGTTTTAGAGCTAGAAATAGCAAGTT) and MLM3636-1R (5′-AACTTGCTATTTCTAGCTCTAAAACCGGTGTTTCGTCCTTTCCACAAGAT), inserted via Gibson cloning. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: The sequences for pIS2-M17, pIS2-AS1, pIS2-LS1, and pIS2-LS1-CM were ordered as gBlocks from IDT and cloned using AgeI (5') and Spe1 (3') restriction sites (sequences in ). .. Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures.

    Centrifugation:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: Upon centrifugation of the reaction mixture over a sucrose cushion to collect ribosomes, RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction ( ). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Amplification:

    Article Title: Mechanism of the Antigen-Independent Cytokinergic SPE-7 IgE Activation of Human Mast Cells in Vitro
    Article Snippet: In parallel, SPE-7 IgE light-chain was amplified with Phusion High Fidelity DNA polymerase (Finnzymes), using forward and reverse primers to add regions homologous to the digested pVITRO vector ( ). .. This purified pVITRO1_SPE-7 IgE light-chain plasmid was linearised at MCS2 by AgeI and NheI restriction enzyme digest (New England Biolabs).

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Coding sequences were PCR amplified (Phusion DNA polymerase, New England Biolabs, Ipswich, MA) using oligomers (Integrated DNA Technologies, Coralville, Iowa) with AgeI-forward and Not1-reverse overhangs incorporated. .. Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core.

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: The vector was first digested with EcoRI (NEB) and AgeI (NEB). .. Next, the desired sequences were amplified from pgRNA1 using primers gRNA-PLKO-F (5′-TTTCTTGGGTAGTTTGCAGTTTT) and gRNA-PLKO-R (5′-ccatttgtctcgaggtcgag-TACCTCGAGCGGCCCAAGC) and inserted into PLKO.1.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: Briefly, for the N-terminal P98 plus C-terminal C92 construct, SIRV2 P98 was amplified using P98-AgeI-F and P98-BsrGI-R ( and ), and STIV C92 was amplified using C92-AgeI-F and C92-BsrGI-R ( and ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Scaffolding:

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Molecular Cloning:

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence. .. Standard molecular cloning techniques were used throughout [ ].

    Construct:

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: The elastin-based proteins ELP[KEY4 -24], ELP[KEY4 -48], ELP[KEY4 -96] and ELP[K3 Y3 -48] were constructed with a cloning scheme modified from one previously developed by our laboratory [ ]. .. The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence.

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core. .. TNFR1:Fc was PCR amplified from the plasmid pTNFR1:Fc (a kind gift of Dr. Jay K. Kolls, University of Pittsburgh School of Medicine to the UNC Gene Therapy Center), using AgeI/NotI primers and ligated into pTR2/CBA identically to the TNFα constructs. rTNFR2:Fc is a fusion protein composed of the extracellular domain of rat type-2 TNF receptor fused to the same Fc region as TNFR1:Fc.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: Briefly, for the N-terminal P98 plus C-terminal C92 construct, SIRV2 P98 was amplified using P98-AgeI-F and P98-BsrGI-R ( and ), and STIV C92 was amplified using C92-AgeI-F and C92-BsrGI-R ( and ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: Briefly, for the N-terminal C92 plus C-terminal P98 construct, STIV C92 was amplified using C92-AgeI-F and C92-BsrGI-R ( and ), and SIRV2 P98 was amplified using P98-BsrGI-F and P98-AgeI-R ( and ). .. The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: Using a similar strategy as previously used for SAV2 [ ], we constructed the plasmid pmSAV3 (Fig. ). .. The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ].

    Incubation:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Luciferase:

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: Paragraph title: Luciferase vectors ... Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures.

    Expressing:

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ]. .. Transfection of pmSAV3 into CHSE or BF2 cells using Amaxa nucleofector kit T (Lonza) or Metafectene Pro according to producer recommendations resulted in expression of the EGFP reporter that was visualized by fluorescence microscopy (Fig. ).

    Modification:

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: The elastin-based proteins ELP[KEY4 -24], ELP[KEY4 -48], ELP[KEY4 -96] and ELP[K3 Y3 -48] were constructed with a cloning scheme modified from one previously developed by our laboratory [ ]. .. The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence.

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Transformation Assay:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and the transformants were screened via colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: .. Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures. .. Carbenicillin selected colonies were cultured and plasmids were extracted (Qiaprep kit) and sequenced using an Applied Biosystems 3730xl DNA Analyzer.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and colonies were screened by colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Transfection:

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. WT HIV-1 and HIV-1 with mutations were generated by transfection of plasmids into 293T/17 cells with Fugene 6 Transfection Reagent (Roche Applied Science) according to the manufacturer's instructions.

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ]. .. Transfection of pmSAV3 into CHSE or BF2 cells using Amaxa nucleofector kit T (Lonza) or Metafectene Pro according to producer recommendations resulted in expression of the EGFP reporter that was visualized by fluorescence microscopy (Fig. ).

    Article Title: An efficient method of directly cloning chimpanzee adenovirus as a vaccine vector
    Article Snippet: EcoRI (New England Biolabs, cat. no. R0101S) KpnI (New England Biolabs, cat. no. R0142S) PmeI (New England Biolabs, cat. no. R0560S) PacI (New England Biolabs, cat. no. R0547S) XbaI (New England Biolabs, cat. no. R0145S) SnaBI (New England Biolabs, cat. no. R0130S) NdeI (New England Biolabs, cat. no. R0111S) SphI (New England Biolabs, cat. no. R0182S) HindIII (New England Biolabs, cat. no. R0104S) AgeI (New England Biolabs, cat. no. R0552S) MluI (New England Biolabs, cat. no. R0198S) SbfI (New England Biolabs, cat. no. R0642S) BstAPI (New England Biolabs, cat. no. V0269S) SwaI (New England Biolabs, cat. no. R0604S) I-CeuI (New England Biolabs, cat. no. R0699S) PI-SceI (New England Biolabs, cat. no. R0696S) SgfI (Promega, cat. no. R5104) Eco47III (Promega, cat. no. R6731) Phusion hot start high-fidelity DNA polymerase (England Biolabs, cat. no. F-540S) dNTP mix (10 mM each; Invitrogen, cat. no. R72501) Alkaline phosphatase (AP; Roche, cat. no. 13826120) T4 DNA ligase (Roche, cat. no. 13827621) DNA ladders (Invitrogen, cat. nos. .. 10381-010 and 15628-019) Agarose (low melting point; Sigma-Aldrich, cat. no. A9414-25G) UltraPure agarose (Invitrogen, cat. no. 15510-027) l -broth (LB) capsules (MP Biomedicals, cat. no. 3001-031) Ampicillin (Mediatech, cat. no. 61-238-RH) Kanamycin (Roche, cat. no. 106801) Pronase (Boehringer Mannheim, cat. no. 165921) Proteinase K (Boehringer Mannheim, cat. no. 745723) Complete protease inhibitor cocktail tablets (Roche, cat. no. 04693124001) SDS solution (10% (wt/vol); Ambion, cat. no. 9822) Tris-HCl (1 M, pH 8.0; Sigma-Aldrich, cat. no. T-2694) Plasmid DNA mini and midi preparation kit (Qiagen) pShuttle (Clontech, cat. no. K1650-1) pNEB193 (New England Biolabs, cat. no. N3051S) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-027) DMEM (Mediatech, cat. no. 10-017-CV) Leibovitz’s L-15 medium (L-15; Mediatech, cat. no. 10-045-CV) FBS (PAA Laboratories, cat. no. A11-034) Penicillin-streptomycin (Mediatech, cat. no. 30-002-CI) Trypsin-EDTA (Mediatech, cat. no. 25-053-CI) Primers and oligo linker (Integrated DNA Technologies) Codon-optimized HIV gag (GenScript) DNeasy extraction kit (Qiagen) Distilled water

    Ligation:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and the transformants were screened via colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: .. The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and colonies were screened by colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Protease Inhibitor:

    Article Title: An efficient method of directly cloning chimpanzee adenovirus as a vaccine vector
    Article Snippet: EcoRI (New England Biolabs, cat. no. R0101S) KpnI (New England Biolabs, cat. no. R0142S) PmeI (New England Biolabs, cat. no. R0560S) PacI (New England Biolabs, cat. no. R0547S) XbaI (New England Biolabs, cat. no. R0145S) SnaBI (New England Biolabs, cat. no. R0130S) NdeI (New England Biolabs, cat. no. R0111S) SphI (New England Biolabs, cat. no. R0182S) HindIII (New England Biolabs, cat. no. R0104S) AgeI (New England Biolabs, cat. no. R0552S) MluI (New England Biolabs, cat. no. R0198S) SbfI (New England Biolabs, cat. no. R0642S) BstAPI (New England Biolabs, cat. no. V0269S) SwaI (New England Biolabs, cat. no. R0604S) I-CeuI (New England Biolabs, cat. no. R0699S) PI-SceI (New England Biolabs, cat. no. R0696S) SgfI (Promega, cat. no. R5104) Eco47III (Promega, cat. no. R6731) Phusion hot start high-fidelity DNA polymerase (England Biolabs, cat. no. F-540S) dNTP mix (10 mM each; Invitrogen, cat. no. R72501) Alkaline phosphatase (AP; Roche, cat. no. 13826120) T4 DNA ligase (Roche, cat. no. 13827621) DNA ladders (Invitrogen, cat. nos. .. 10381-010 and 15628-019) Agarose (low melting point; Sigma-Aldrich, cat. no. A9414-25G) UltraPure agarose (Invitrogen, cat. no. 15510-027) l -broth (LB) capsules (MP Biomedicals, cat. no. 3001-031) Ampicillin (Mediatech, cat. no. 61-238-RH) Kanamycin (Roche, cat. no. 106801) Pronase (Boehringer Mannheim, cat. no. 165921) Proteinase K (Boehringer Mannheim, cat. no. 745723) Complete protease inhibitor cocktail tablets (Roche, cat. no. 04693124001) SDS solution (10% (wt/vol); Ambion, cat. no. 9822) Tris-HCl (1 M, pH 8.0; Sigma-Aldrich, cat. no. T-2694) Plasmid DNA mini and midi preparation kit (Qiagen) pShuttle (Clontech, cat. no. K1650-1) pNEB193 (New England Biolabs, cat. no. N3051S) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-027) DMEM (Mediatech, cat. no. 10-017-CV) Leibovitz’s L-15 medium (L-15; Mediatech, cat. no. 10-045-CV) FBS (PAA Laboratories, cat. no. A11-034) Penicillin-streptomycin (Mediatech, cat. no. 30-002-CI) Trypsin-EDTA (Mediatech, cat. no. 25-053-CI) Primers and oligo linker (Integrated DNA Technologies) Codon-optimized HIV gag (GenScript) DNeasy extraction kit (Qiagen) Distilled water

    Cell Culture:

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures. .. Carbenicillin selected colonies were cultured and plasmids were extracted (Qiaprep kit) and sequenced using an Applied Biosystems 3730xl DNA Analyzer.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Generated:

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: Construction of guide RNA plasmids Plasmid pMLM3636 (plasmid ID 43860) was obtained from Addgene, cut with BsmBI and a double-stranded DNA fragment, generated by annealing the two oligos MLM3636-1F (5′-ATCTTGTGGAAAGGACGAAACACCGGTTTTAGAGCTAGAAATAGCAAGTT) and MLM3636-1R (5′-AACTTGCTATTTCTAGCTCTAAAACCGGTGTTTCGTCCTTTCCACAAGAT), inserted via Gibson cloning. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. WT HIV-1 and HIV-1 with mutations were generated by transfection of plasmids into 293T/17 cells with Fugene 6 Transfection Reagent (Roche Applied Science) according to the manufacturer's instructions.

    DNA Sequencing:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The resulting transformants were verified by DNA sequencing with A510-seq-F ( ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ). .. The PCR products were digested with BsrGI and further confirmed by DNA sequencing.

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Sequencing:

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: .. The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence. .. Standard molecular cloning techniques were used throughout [ ].

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The PCR products were then digested with BsrGI and further confirmed by sequencing.

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: .. The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ]. .. This information indicated that eight substitutions were present in the RC coding region compared to the nucleotide sequence of passage 20 of the parental strain SAVH20/03 (Table ).

    Binding Assay:

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: The pIS2-LS1-CM vector had three base mutations introduced which reintroduce a bulge on the lower part of the first highly conserved hairpin of Motif 17 by disrupting the binding introduced by the pIS2-LS1 mutations. .. Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures.

    Nucleic Acid Electrophoresis:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Fluorescence:

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: The plasmid has the following characteristics: (i) a pVAX1 (Invitrogen) backbone optimized for DNA-vaccination, with a transcription unit controlled by the cytomegalovirus (CMV) immediate early promoter and a bovine growth hormone (BGH) polyadenylation signal, (ii) the SAV3 genome in which the structural ORF has been replaced with that of the enhanced green fluorescence protein (EGFP), flanked by AgeI and AscI restriction enzyme sites, (iii) a polyadenylated tail fused directly to the 3'-UTR of SAV3, and (iv) a hammerhead ribozyme fused directly to the SAV3 5'-UTR. .. The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ].

    Mutagenesis:

    Article Title: Comparison of SIV and HIV-1 Genomic RNA Structures Reveals Impact of Sequence Evolution on Conserved and Non-Conserved Structural Motifs
    Article Snippet: .. The resulting plasmid and pNL4-3 were then digested with PflMI and AgeI (New England Biolabs) and ligated with T4 DNA Ligase (New England Biolabs) to create the plasmid pSLSA1m, which was sequenced to confirm the presence of the given mutation. .. Virus production A total of 2 µg of pSLSA1m or pNL4-3 and was used to produce mutant and wild-type infectious virus (HIV-1wt and HIV-1SLSA1m , respectively) by transfection into 3×105 293T cells in a volume of 2 ml DMEM following the FuGENE (Promega) protocol.

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Isolation:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C. .. The restriction fragments were determined using PAA gel-electrophoresis and visualized by EtBr-staining.

    Subcloning:

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Paragraph title: TNFα, and TNFR:Fc subcloning and functional validation ... Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core.

    Microscopy:

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ]. .. Transfection of pmSAV3 into CHSE or BF2 cells using Amaxa nucleofector kit T (Lonza) or Metafectene Pro according to producer recommendations resulted in expression of the EGFP reporter that was visualized by fluorescence microscopy (Fig. ).

    Purification:

    Article Title: Mechanism of the Antigen-Independent Cytokinergic SPE-7 IgE Activation of Human Mast Cells in Vitro
    Article Snippet: .. This purified pVITRO1_SPE-7 IgE light-chain plasmid was linearised at MCS2 by AgeI and NheI restriction enzyme digest (New England Biolabs). .. SPE-7 IgE Fab heavy-chain (comprising the SPE-7 IgE VH-region coupled to the Cε1 constant domain) was amplified and a 6×-histidine tag added at the N-terminus using round 1 PCR primers, followed by a second round of PCR to add regions homologous to linearised pVITRO1_SPE-7 IgE light-chain plasmid.

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: The RT-PCR product was analyzed on 10% PAA gels in TBE buffer, and purified using ‘PCR clean up kit’ (Qiagen, Hilden, Germany). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: .. Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures. .. Carbenicillin selected colonies were cultured and plasmids were extracted (Qiaprep kit) and sequenced using an Applied Biosystems 3730xl DNA Analyzer.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Polymerase Chain Reaction:

    Article Title: Mechanism of the Antigen-Independent Cytokinergic SPE-7 IgE Activation of Human Mast Cells in Vitro
    Article Snippet: PCR reaction was carried out as above with an annealing temperature of 61°C and no final extension. .. This purified pVITRO1_SPE-7 IgE light-chain plasmid was linearised at MCS2 by AgeI and NheI restriction enzyme digest (New England Biolabs).

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: The RT-PCR product was analyzed on 10% PAA gels in TBE buffer, and purified using ‘PCR clean up kit’ (Qiagen, Hilden, Germany). .. For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Coding sequences were PCR amplified (Phusion DNA polymerase, New England Biolabs, Ipswich, MA) using oligomers (Integrated DNA Technologies, Coralville, Iowa) with AgeI-forward and Not1-reverse overhangs incorporated. .. Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The amplicons were PCR purified and digested with BsrGI (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The amplicons were PCR purified and digested with BsrGI (NEB). .. The ligation reaction mixture was digested with AgeI (NEB) and ligated to AgeI-digested del-C92-TOPO “subclone” ( ).

    Nested PCR:

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core. .. Rat TNFR2 extracellular domain (nucleotides 70-843 of NCBI ; OriGene, Rockville, MD) was fused to the mouse Fc region of TNFR1:Fc using nested PCR reactions.

    Plasmid Preparation:

    Article Title: Mechanism of the Antigen-Independent Cytokinergic SPE-7 IgE Activation of Human Mast Cells in Vitro
    Article Snippet: .. This purified pVITRO1_SPE-7 IgE light-chain plasmid was linearised at MCS2 by AgeI and NheI restriction enzyme digest (New England Biolabs). .. SPE-7 IgE Fab heavy-chain (comprising the SPE-7 IgE VH-region coupled to the Cε1 constant domain) was amplified and a 6×-histidine tag added at the N-terminus using round 1 PCR primers, followed by a second round of PCR to add regions homologous to linearised pVITRO1_SPE-7 IgE light-chain plasmid.

    Article Title: Comparison of SIV and HIV-1 Genomic RNA Structures Reveals Impact of Sequence Evolution on Conserved and Non-Conserved Structural Motifs
    Article Snippet: .. The resulting plasmid and pNL4-3 were then digested with PflMI and AgeI (New England Biolabs) and ligated with T4 DNA Ligase (New England Biolabs) to create the plasmid pSLSA1m, which was sequenced to confirm the presence of the given mutation. .. Virus production A total of 2 µg of pSLSA1m or pNL4-3 and was used to produce mutant and wild-type infectious virus (HIV-1wt and HIV-1SLSA1m , respectively) by transfection into 3×105 293T cells in a volume of 2 ml DMEM following the FuGENE (Promega) protocol.

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: .. Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core. ..

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: .. The vector was first digested with EcoRI (NEB) and AgeI (NEB). .. Next, the desired sequences were amplified from pgRNA1 using primers gRNA-PLKO-F (5′-TTTCTTGGGTAGTTTGCAGTTTT) and gRNA-PLKO-R (5′-ccatttgtctcgaggtcgag-TACCTCGAGCGGCCCAAGC) and inserted into PLKO.1.

    Article Title: RNA structural analysis of the MYC mRNA reveals conserved motifs that affect gene expression
    Article Snippet: .. Insertion of experimental sequences into the 3' UTR of pIS2 required double restriction enzyme digest (using AgeI and SpeI from NEB) of both the gBlock and pIS2; following digestion, fragment and vector DNA were purified (Zymo DNA Clean and Concentrator kit), ligated (T4 Ligase from ThermoFischer), and transformed into DH5α-T1 competent cells using standard procedures. .. Carbenicillin selected colonies were cultured and plasmids were extracted (Qiaprep kit) and sequenced using an Applied Biosystems 3730xl DNA Analyzer.

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon
    Article Snippet: .. The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ]. .. This information indicated that eight substitutions were present in the RC coding region compared to the nucleotide sequence of passage 20 of the parental strain SAVH20/03 (Table ).

    Article Title: An efficient method of directly cloning chimpanzee adenovirus as a vaccine vector
    Article Snippet: EcoRI (New England Biolabs, cat. no. R0101S) KpnI (New England Biolabs, cat. no. R0142S) PmeI (New England Biolabs, cat. no. R0560S) PacI (New England Biolabs, cat. no. R0547S) XbaI (New England Biolabs, cat. no. R0145S) SnaBI (New England Biolabs, cat. no. R0130S) NdeI (New England Biolabs, cat. no. R0111S) SphI (New England Biolabs, cat. no. R0182S) HindIII (New England Biolabs, cat. no. R0104S) AgeI (New England Biolabs, cat. no. R0552S) MluI (New England Biolabs, cat. no. R0198S) SbfI (New England Biolabs, cat. no. R0642S) BstAPI (New England Biolabs, cat. no. V0269S) SwaI (New England Biolabs, cat. no. R0604S) I-CeuI (New England Biolabs, cat. no. R0699S) PI-SceI (New England Biolabs, cat. no. R0696S) SgfI (Promega, cat. no. R5104) Eco47III (Promega, cat. no. R6731) Phusion hot start high-fidelity DNA polymerase (England Biolabs, cat. no. F-540S) dNTP mix (10 mM each; Invitrogen, cat. no. R72501) Alkaline phosphatase (AP; Roche, cat. no. 13826120) T4 DNA ligase (Roche, cat. no. 13827621) DNA ladders (Invitrogen, cat. nos. .. 10381-010 and 15628-019) Agarose (low melting point; Sigma-Aldrich, cat. no. A9414-25G) UltraPure agarose (Invitrogen, cat. no. 15510-027) l -broth (LB) capsules (MP Biomedicals, cat. no. 3001-031) Ampicillin (Mediatech, cat. no. 61-238-RH) Kanamycin (Roche, cat. no. 106801) Pronase (Boehringer Mannheim, cat. no. 165921) Proteinase K (Boehringer Mannheim, cat. no. 745723) Complete protease inhibitor cocktail tablets (Roche, cat. no. 04693124001) SDS solution (10% (wt/vol); Ambion, cat. no. 9822) Tris-HCl (1 M, pH 8.0; Sigma-Aldrich, cat. no. T-2694) Plasmid DNA mini and midi preparation kit (Qiagen) pShuttle (Clontech, cat. no. K1650-1) pNEB193 (New England Biolabs, cat. no. N3051S) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-027) DMEM (Mediatech, cat. no. 10-017-CV) Leibovitz’s L-15 medium (L-15; Mediatech, cat. no. 10-045-CV) FBS (PAA Laboratories, cat. no. A11-034) Penicillin-streptomycin (Mediatech, cat. no. 30-002-CI) Trypsin-EDTA (Mediatech, cat. no. 25-053-CI) Primers and oligo linker (Integrated DNA Technologies) Codon-optimized HIV gag (GenScript) DNeasy extraction kit (Qiagen) Distilled water

    Software:

    Article Title: Critical factors for the bulk adhesion of engineered elastomeric proteins
    Article Snippet: Predicted protein isoelectric points (pI) were estimated with the Geneious software. .. The new scheme used AgeI and AvaI restriction enzymes (New England Biolabs, Ipswich, MA) to achieve seamless repeats of the elastin-like sequence.

    Functional Assay:

    Article Title: Opposing Actions of Hippocampus TNFα Receptors on Limbic Seizure Susceptibility
    Article Snippet: Paragraph title: TNFα, and TNFR:Fc subcloning and functional validation ... Amplicons were digested with AgeI and NotI restriction enzymes (New England Biolabs) and ligated into pTR2/CBA-GFP, acquired from the UNC Gene Therapy Center Vector Core.

    Agarose Gel Electrophoresis:

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    In Vitro:

    Article Title: The RNA ligase RtcB reverses MazF-induced ribosome heterogeneity in Escherichia coli
    Article Snippet: Paragraph title: In vitro ribosome repair assay ... For AgeI restriction analysis the isolated RT-PCR product was incubated with 4 units of AgeI-HF (New England Biolabs) for 30 min at 37°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs agei
    Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced <t>AgeI</t> and AscI sites. Position of the <t>EcoRI</t> site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.
    Agei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    New England Biolabs sirv2 p98 agei f
    Schematic overview of the construction of the <t>C92/P98</t> chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + <t>AgeI-F;</t> P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Sirv2 P98 Agei F, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirv2 p98 agei f/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sirv2 p98 agei f - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    New England Biolabs del c92 agei r
    Schematic overview of the construction of the <t>C92/P98</t> chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + <t>AgeI-R.</t> (B) Construction of N-terminal
    Del C92 Agei R, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/del c92 agei r/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    del c92 agei r - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    New England Biolabs agei digested p98
    Schematic overview of the construction of the <t>C92/P98</t> chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + <t>AgeI-F;</t> P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal
    Agei Digested P98, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei digested p98/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    agei digested p98 - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Journal: Virology Journal

    Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon

    doi: 10.1186/1743-422X-6-173

    Figure Lengend Snippet: Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

    Article Snippet: The authenticity of the plasmid construction was verified by EcoRI, AgeI and AscI (New England Biolabs) digestion (Fig. ) and by sequencing as previously described [ ].

    Techniques: Sequencing, Expressing, Transfection

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Journal: Journal of Virology

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    doi: 10.1128/JVI.02956-12

    Figure Lengend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Article Snippet: The P98 ORF was amplified from SIRV2 viral DNA using 50 pmol (each) of SIRV2-P98-AgeI-F and SIRV2-P98-AgeI-R ( ) with Phusion DNA polymerase (NEB).

    Techniques:

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Journal: Journal of Virology

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    doi: 10.1128/JVI.02956-12

    Figure Lengend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Article Snippet: The C92 gene was removed from the subclone using del-C92-AgeI-F and del-C92-AgeI-R ( ) and Phusion High-Fidelity DNA polymerase (New England BioLabs [NEB], Ipswich, MA) using the manufacturer's recommendations.

    Techniques:

    Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Journal: Journal of Virology

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System

    doi: 10.1128/JVI.02956-12

    Figure Lengend Snippet: Schematic overview of the construction of the C92/P98 chimeric genes. (A) Construction of N-terminal C92 + C-terminal P98 for replication within STIV. P1, c92 + AgeI-F; P2, c92 + BsrGI-R; P3, p98 + BsrGI-F; P4, p98 + AgeI-R. (B) Construction of N-terminal

    Article Snippet: After heat treatment and another purification, the AgeI-digested P98 product was ligated to AgeI-digested STIV-TOPO (C92 deletion construct) with T4 DNA ligase (NEB) and transformed into E. coli .

    Techniques: