Structured Review

Evrogen agei
Agei, supplied by Evrogen, used in various techniques. Bioz Stars score: 89/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agei/product/Evrogen
Average 89 stars, based on 17 article reviews
Price from $9.99 to $1999.99
agei - by Bioz Stars, 2020-02
89/100 stars

Images

Related Articles

Clone Assay:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons
Article Snippet: In the pTurbo-mitoDendra expression vector, Dendra coding region substituted the GFP at the AgeI and NotI sites of the pTurboGFP-mito (Evrogen). .. In the amyloid precursor protein (APP695)-Dendra expression vector, APP695 cDNA was cloned into pTurbo-DendraV-N using HindIII and AgeI sites.

Article Title: Non-invasive intravital imaging of cellular differentiation with a bright red-excitable fluorescent protein
Article Snippet: The purified and digested PCR products were ligated into similarly digested pEGFP-C1 and pEGFP-N1 cloning vectors to create pmCardinal-C1 and pmCardinal-N1. .. To prepare C-terminal fusions to mCardinal, the following digests were performed: human β-actin (NM_001101.3, Clontech), NheI and BglII; human α-tubulin (NM_006082, Clontech), NheI and BglII; human Rab4a (NM_004578.2, Viki Allen, University of Manchester, U.K.), BspEI and BamHI; human lamin B1 (NM_005573.2, George Patterson, NIH), EcoRI and BamHI; human myotilin (NM_006790.1, Origene), AgeI and BspEI; human fibrillarin (NM_001436.3, Evrogen), BglII and BamHI; human tight junction protein ZO1 (NM_003257.1, Origene), AgeI and BspEI; human VE cadherin (NM_001795.3, Origene), BglII and EcoRI; and the 20-amino-acid farnesylation signal from c-Ha-Ras (NM_001130442.1, Clontech), AgeI and BspEI.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: The PCR products were gel purified, digested and ligated into EGFP-C1 or EGFP-N1 cloning vectors respectively, resulting in mIFP C1 and N1 cloning vectors. .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

Transfection:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech). .. DNA for mammalian transfection was prepared by either the Plasmid Midi or Maxi kit (QIAGEN).

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3). .. DNA for transfection was prepared using the Plasmid Maxi kit (Qiagen).

Amplification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The FPs were amplified with a 5' primer encoding an AgeI site and a 3' primer encoding either a BspEI (C1) or Not1 (N1) site. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Non-invasive intravital imaging of cellular differentiation with a bright red-excitable fluorescent protein
Article Snippet: A cDNA fragment encoding each protein domain was PCR amplified with primers containing the appropriate restriction enzyme sites and ligated into pmCardinal-C1 or pmCardinal-N1. .. To prepare C-terminal fusions to mCardinal, the following digests were performed: human β-actin (NM_001101.3, Clontech), NheI and BglII; human α-tubulin (NM_006082, Clontech), NheI and BglII; human Rab4a (NM_004578.2, Viki Allen, University of Manchester, U.K.), BspEI and BamHI; human lamin B1 (NM_005573.2, George Patterson, NIH), EcoRI and BamHI; human myotilin (NM_006790.1, Origene), AgeI and BspEI; human fibrillarin (NM_001436.3, Evrogen), BglII and BamHI; human tight junction protein ZO1 (NM_003257.1, Origene), AgeI and BspEI; human VE cadherin (NM_001795.3, Origene), BglII and EcoRI; and the 20-amino-acid farnesylation signal from c-Ha-Ras (NM_001130442.1, Clontech), AgeI and BspEI.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: The mIFP cDNA was PCR amplified with a 5’ primer encoding an AgeI site and a 3’ primer encoding either a BspEI (C1) or NotI (N1) site, in reference to mIFP. .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

Isolation:

Article Title: Unique establishment of procephalic head segments is supported by the identification of cis-regulatory elements driving segment-specific segment polarity gene expression in Drosophila
Article Snippet: Reporter constructs turboGFP reporter [tgfp_SV40 952 bp sequence] was excised with AgeI (site T4 blunted)/AflII from pTGFP_PRL (EVROGEN, Moscow, Russia) and inserted into PmlI (T4 blunted)/AflII of pSLaf1180af vector (Horn and Wimmer ) to generate pSLaf_tgfp_af.2 . .. The promoter sequence of hh (−120_+99 bp) was isolated with primers CAACGCGGAATGAA CTCGAG GCGATAG (XhoI_Forward) and A ACTAGT TAGCTCTCGGTTCGGACAACCGTTG (SpeI_Reverse) on Drosophila genomic DNA and subcloned into Xho/SpeI of pslaf_tgfp_af.2 to result in construct pSLaf[Dm_hh promoter_tgfp_SV40] .

Construct:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: All of the other mTFP1 and mWasabi vectors were constructed using C1 and N1 (Clontech-style) cloning vectors. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Unique establishment of procephalic head segments is supported by the identification of cis-regulatory elements driving segment-specific segment polarity gene expression in Drosophila
Article Snippet: .. Reporter constructs turboGFP reporter [tgfp_SV40 952 bp sequence] was excised with AgeI (site T4 blunted)/AflII from pTGFP_PRL (EVROGEN, Moscow, Russia) and inserted into PmlI (T4 blunted)/AflII of pSLaf1180af vector (Horn and Wimmer ) to generate pSLaf_tgfp_af.2 . .. The promoter sequence of hh (−120_+99 bp) was isolated with primers CAACGCGGAATGAA CTCGAG GCGATAG (XhoI_Forward) and A ACTAGT TAGCTCTCGGTTCGGACAACCGTTG (SpeI_Reverse) on Drosophila genomic DNA and subcloned into Xho/SpeI of pslaf_tgfp_af.2 to result in construct pSLaf[Dm_hh promoter_tgfp_SV40] .

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3). .. To prepare the mIFP N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human calnexin (14), AgeI and NotI (cDNA source: Origene; NM_001746.3); human CENP-B (22), BamHI and NotI (A. Khodjakov, Wadsworth Center, Albany, NY, USA; NM_001810.5); Cx43 (7), BamHI and NotI (rat α-1 connexin 43 cDNA source: M. Falk, Lehigh University, Bethlehem, PA, USA; NM_001004099.1); human EB3 (7), BglII and BamHI (cDNA source: L. Cassimeris, Lehigh University; NM_012326.2); H1 (10), BamHI and NotI (mouse histone 1, cDNA source: G. Patterson, NIH; NM_008197.3); H2B (6), BamHI and NotI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human keratin18 (17), EcoRI and NotI (cDNA source: Open Biosystems, Huntsville, AL, USA; NM_199187.1); rat lysosomal membrane glycoprotein 1 (20), BamHI and NotI (LAMP1; cDNA source: G. Patterson, NIH; NM_012857.1); lifeact (7), BamHI and NotI (cDNA source: Integrated DNA Technologies, Coralville, IA, USA); human MAPTau (10), AgeI and NotI (cDNA source: Origene; NM_016841.4); human nucleoporin 50 kDa (10), BamHI and NotI (NUP50; cDNA source: Origene; NM_007172.3); human peroxisomal membrane protein (10), NotI and AgeI (PMP; cDNA source: Origene; NM_018663.1); human translocase outer mitochondria membrane 20 (10), (TOMM-20; cDNA source: Origene; NM_014765.2); human zyxin (6), BamHI and NotI (cDNA source: Origene; NM_003461.4).

Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Non-invasive intravital imaging of cellular differentiation with a bright red-excitable fluorescent protein
Article Snippet: The purified and digested PCR products were ligated into similarly digested pEGFP-C1 and pEGFP-N1 cloning vectors to create pmCardinal-C1 and pmCardinal-N1. .. To prepare C-terminal fusions to mCardinal, the following digests were performed: human β-actin (NM_001101.3, Clontech), NheI and BglII; human α-tubulin (NM_006082, Clontech), NheI and BglII; human Rab4a (NM_004578.2, Viki Allen, University of Manchester, U.K.), BspEI and BamHI; human lamin B1 (NM_005573.2, George Patterson, NIH), EcoRI and BamHI; human myotilin (NM_006790.1, Origene), AgeI and BspEI; human fibrillarin (NM_001436.3, Evrogen), BglII and BamHI; human tight junction protein ZO1 (NM_003257.1, Origene), AgeI and BspEI; human VE cadherin (NM_001795.3, Origene), BglII and EcoRI; and the 20-amino-acid farnesylation signal from c-Ha-Ras (NM_001130442.1, Clontech), AgeI and BspEI.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: The PCR products were gel purified, digested and ligated into EGFP-C1 or EGFP-N1 cloning vectors respectively, resulting in mIFP C1 and N1 cloning vectors. .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

Sequencing:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Unique establishment of procephalic head segments is supported by the identification of cis-regulatory elements driving segment-specific segment polarity gene expression in Drosophila
Article Snippet: .. Reporter constructs turboGFP reporter [tgfp_SV40 952 bp sequence] was excised with AgeI (site T4 blunted)/AflII from pTGFP_PRL (EVROGEN, Moscow, Russia) and inserted into PmlI (T4 blunted)/AflII of pSLaf1180af vector (Horn and Wimmer ) to generate pSLaf_tgfp_af.2 . .. The promoter sequence of hh (−120_+99 bp) was isolated with primers CAACGCGGAATGAA CTCGAG GCGATAG (XhoI_Forward) and A ACTAGT TAGCTCTCGGTTCGGACAACCGTTG (SpeI_Reverse) on Drosophila genomic DNA and subcloned into Xho/SpeI of pslaf_tgfp_af.2 to result in construct pSLaf[Dm_hh promoter_tgfp_SV40] .

Polymerase Chain Reaction:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Non-invasive intravital imaging of cellular differentiation with a bright red-excitable fluorescent protein
Article Snippet: A cDNA fragment encoding each protein domain was PCR amplified with primers containing the appropriate restriction enzyme sites and ligated into pmCardinal-C1 or pmCardinal-N1. .. To prepare C-terminal fusions to mCardinal, the following digests were performed: human β-actin (NM_001101.3, Clontech), NheI and BglII; human α-tubulin (NM_006082, Clontech), NheI and BglII; human Rab4a (NM_004578.2, Viki Allen, University of Manchester, U.K.), BspEI and BamHI; human lamin B1 (NM_005573.2, George Patterson, NIH), EcoRI and BamHI; human myotilin (NM_006790.1, Origene), AgeI and BspEI; human fibrillarin (NM_001436.3, Evrogen), BglII and BamHI; human tight junction protein ZO1 (NM_003257.1, Origene), AgeI and BspEI; human VE cadherin (NM_001795.3, Origene), BglII and EcoRI; and the 20-amino-acid farnesylation signal from c-Ha-Ras (NM_001130442.1, Clontech), AgeI and BspEI.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: The PCR products were gel purified, digested and ligated into EGFP-C1 or EGFP-N1 cloning vectors respectively, resulting in mIFP C1 and N1 cloning vectors. .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

Imaging:

Article Title: Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons
Article Snippet: Live imaging experiments were performed in Lab-Tek 4-well chambered glass slides (Nalge Nunc International). .. In the pTurbo-mitoDendra expression vector, Dendra coding region substituted the GFP at the AgeI and NotI sites of the pTurboGFP-mito (Evrogen).

Expressing:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Paragraph title: Mammalian expression vectors ... To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons
Article Snippet: .. In the pTurbo-mitoDendra expression vector, Dendra coding region substituted the GFP at the AgeI and NotI sites of the pTurboGFP-mito (Evrogen). .. In the amyloid precursor protein (APP695)-Dendra expression vector, APP695 cDNA was cloned into pTurbo-DendraV-N using HindIII and AgeI sites.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: Fusion plasmid construction The monomeric infrared fluorescent protein (mIFP) mammalian expression vectors were constructed from C1 or N1 cloning vectors (Clontech-style). .. To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

IA:

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3). .. To prepare the mIFP N-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human calnexin (14), AgeI and NotI (cDNA source: Origene; NM_001746.3); human CENP-B (22), BamHI and NotI (A. Khodjakov, Wadsworth Center, Albany, NY, USA; NM_001810.5); Cx43 (7), BamHI and NotI (rat α-1 connexin 43 cDNA source: M. Falk, Lehigh University, Bethlehem, PA, USA; NM_001004099.1); human EB3 (7), BglII and BamHI (cDNA source: L. Cassimeris, Lehigh University; NM_012326.2); H1 (10), BamHI and NotI (mouse histone 1, cDNA source: G. Patterson, NIH; NM_008197.3); H2B (6), BamHI and NotI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human keratin18 (17), EcoRI and NotI (cDNA source: Open Biosystems, Huntsville, AL, USA; NM_199187.1); rat lysosomal membrane glycoprotein 1 (20), BamHI and NotI (LAMP1; cDNA source: G. Patterson, NIH; NM_012857.1); lifeact (7), BamHI and NotI (cDNA source: Integrated DNA Technologies, Coralville, IA, USA); human MAPTau (10), AgeI and NotI (cDNA source: Origene; NM_016841.4); human nucleoporin 50 kDa (10), BamHI and NotI (NUP50; cDNA source: Origene; NM_007172.3); human peroxisomal membrane protein (10), NotI and AgeI (PMP; cDNA source: Origene; NM_018663.1); human translocase outer mitochondria membrane 20 (10), (TOMM-20; cDNA source: Origene; NM_014765.2); human zyxin (6), BamHI and NotI (cDNA source: Origene; NM_003461.4).

Plasmid Preparation:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Unique establishment of procephalic head segments is supported by the identification of cis-regulatory elements driving segment-specific segment polarity gene expression in Drosophila
Article Snippet: .. Reporter constructs turboGFP reporter [tgfp_SV40 952 bp sequence] was excised with AgeI (site T4 blunted)/AflII from pTGFP_PRL (EVROGEN, Moscow, Russia) and inserted into PmlI (T4 blunted)/AflII of pSLaf1180af vector (Horn and Wimmer ) to generate pSLaf_tgfp_af.2 . .. The promoter sequence of hh (−120_+99 bp) was isolated with primers CAACGCGGAATGAA CTCGAG GCGATAG (XhoI_Forward) and A ACTAGT TAGCTCTCGGTTCGGACAACCGTTG (SpeI_Reverse) on Drosophila genomic DNA and subcloned into Xho/SpeI of pslaf_tgfp_af.2 to result in construct pSLaf[Dm_hh promoter_tgfp_SV40] .

Article Title: Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons
Article Snippet: .. In the pTurbo-mitoDendra expression vector, Dendra coding region substituted the GFP at the AgeI and NotI sites of the pTurboGFP-mito (Evrogen). .. In the amyloid precursor protein (APP695)-Dendra expression vector, APP695 cDNA was cloned into pTurbo-DendraV-N using HindIII and AgeI sites.

Article Title: A naturally-monomeric infrared fluorescent protein for protein labeling in vivo
Article Snippet: Paragraph title: Fusion plasmid construction ... To construct the mIFP C-terminal fusions (number of linker amino acids in parenthesis), the following digests were performed: human β-actin (30), NheI and BglII (cDNA source: Clontech, Mountain View, CA, USA; NM_001101.3); CAF1 (22), AgeI and BspEI (mouse chromatin assembly factor; cDNA source: A. Gunjan, Florida State University, Tallahassee, FL, USA; NM_013733.3); human light chain clathrin (27), NheI and BglII (cDNA source: G. Patterson, National Institutes of Health, Bethesda, MD, USA; NM_001834.2); human endosomes (26), NheI and BspEI (human RhoB GTPase; cDNA source: Clontech; NM_004040.2); human fibrillarin (19), AgeI and BspEI (cDNA source: Evrogen, Moscow, Russia; NM_001436.3); H2B (10), BglII and NheI (human histone 2B, cDNA source: G. Patterson, NIH; NM_021058.3); human lamin A/C (30), NheI and BglII (cDNA source: D. Gilbert, Florida State University; NM_170707.2); human lasp1 (22) NheI and BglII (cDNA source: Origene; NM_006148.3); human myotilin (26), AgeI and BspEI (cDNA source: Origene; NM_006790.2); human Rab4a (19), BglII and BamHI (cDNA source: V. Allen, University of Manchester, Manchester, UK; NM_004578.3); rat sEpsin (30) NheI and BglII (cDNA source: Origene; NM_019585.3); human α-tubulin (30), NheI and BglII (cDNA source: Clontech; NM_006082); human vinculin (35) NheI and EcoRI (cDNA source: Origene; NM_003373.3).

Gel Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Evrogen agei
    Agei, supplied by Evrogen, used in various techniques. Bioz Stars score: 89/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/Evrogen
    Average 89 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results