Structured Review

Illumina Inc 3 end adapter
Detailed comparison of the eCLIP and meCLIP protocols. Presentation of the different steps involved in eCLIP and meCLIP procedures. Following UV crosslinking, RNase treatment, and RBP purification, an RNA adaptor (green) is ligated at the 3′ end. For meCLIP, a biotinylated RNA linker (blue) is incorporated at the 5′ end. RNAs are fractionated by electrophoresis and eluted from gels. For meCLIP, biotinylated RNAs are purified on Streptavidin beads using stringent conditions. Reverse transcription (RT) is then performed, which leads to two distinct cDNA populations. One of them bears the 5′ linker if the reverse transcriptase reads through the crosslinked peptide (read-through cDNAs). The other one lacks the 5′ linker due to a stop of RT at the crosslinked peptide. A second adaptor (purple) is ligated at the <t>3′</t> end of the cDNAs which are next amplified by PCR and submitted to high-throughput sequencing. For meCLIP, two populations of reads are easily sorted out based on the presence or absence of the biotinylated linker sequence.
3 End Adapter, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 5476 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3 end adapter/product/Illumina Inc
Average 93 stars, based on 5476 article reviews
Price from $9.99 to $1999.99
3 end adapter - by Bioz Stars, 2020-05
93/100 stars

Images

1) Product Images from "Monitored eCLIP: high accuracy mapping of RNA-protein interactions"

Article Title: Monitored eCLIP: high accuracy mapping of RNA-protein interactions

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky858

Detailed comparison of the eCLIP and meCLIP protocols. Presentation of the different steps involved in eCLIP and meCLIP procedures. Following UV crosslinking, RNase treatment, and RBP purification, an RNA adaptor (green) is ligated at the 3′ end. For meCLIP, a biotinylated RNA linker (blue) is incorporated at the 5′ end. RNAs are fractionated by electrophoresis and eluted from gels. For meCLIP, biotinylated RNAs are purified on Streptavidin beads using stringent conditions. Reverse transcription (RT) is then performed, which leads to two distinct cDNA populations. One of them bears the 5′ linker if the reverse transcriptase reads through the crosslinked peptide (read-through cDNAs). The other one lacks the 5′ linker due to a stop of RT at the crosslinked peptide. A second adaptor (purple) is ligated at the 3′ end of the cDNAs which are next amplified by PCR and submitted to high-throughput sequencing. For meCLIP, two populations of reads are easily sorted out based on the presence or absence of the biotinylated linker sequence.
Figure Legend Snippet: Detailed comparison of the eCLIP and meCLIP protocols. Presentation of the different steps involved in eCLIP and meCLIP procedures. Following UV crosslinking, RNase treatment, and RBP purification, an RNA adaptor (green) is ligated at the 3′ end. For meCLIP, a biotinylated RNA linker (blue) is incorporated at the 5′ end. RNAs are fractionated by electrophoresis and eluted from gels. For meCLIP, biotinylated RNAs are purified on Streptavidin beads using stringent conditions. Reverse transcription (RT) is then performed, which leads to two distinct cDNA populations. One of them bears the 5′ linker if the reverse transcriptase reads through the crosslinked peptide (read-through cDNAs). The other one lacks the 5′ linker due to a stop of RT at the crosslinked peptide. A second adaptor (purple) is ligated at the 3′ end of the cDNAs which are next amplified by PCR and submitted to high-throughput sequencing. For meCLIP, two populations of reads are easily sorted out based on the presence or absence of the biotinylated linker sequence.

Techniques Used: Purification, Electrophoresis, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing

2) Product Images from "Comparative transcriptomics of pathogenic and non-pathogenic Listeria species"

Article Title: Comparative transcriptomics of pathogenic and non-pathogenic Listeria species

Journal: Molecular Systems Biology

doi: 10.1038/msb.2012.11

The Listeria transcriptome browser . ( A – C ) Represent different windows of the genome in the unified browser. X axis represents the position on the genome; y axis the number of cDNA sequences mapped to the genome (log scale). The browser unifies TSS mapping (vertical lines being 5′ ends of genes, with numbers indicating the amount of supporting 5′ end sequencing reads), total RNA sequencing (black line), tiling-array data (red and blue small triangles represent probes on the forward and reverse strands, respectively), genome annotation (arrows underneath the axis; red and blue representing genes on the forward and reverse strands, respectively), operon annotation (yellow arrow), rho-independent terminators prediction (small black arrows), small RNAs (purple), asRNAs (green), as well as additional information (Materials and methods). The browser is available at http://www.weizmann.ac.il/molgen/Sorek/listeria_browser/ .
Figure Legend Snippet: The Listeria transcriptome browser . ( A – C ) Represent different windows of the genome in the unified browser. X axis represents the position on the genome; y axis the number of cDNA sequences mapped to the genome (log scale). The browser unifies TSS mapping (vertical lines being 5′ ends of genes, with numbers indicating the amount of supporting 5′ end sequencing reads), total RNA sequencing (black line), tiling-array data (red and blue small triangles represent probes on the forward and reverse strands, respectively), genome annotation (arrows underneath the axis; red and blue representing genes on the forward and reverse strands, respectively), operon annotation (yellow arrow), rho-independent terminators prediction (small black arrows), small RNAs (purple), asRNAs (green), as well as additional information (Materials and methods). The browser is available at http://www.weizmann.ac.il/molgen/Sorek/listeria_browser/ .

Techniques Used: Sequencing, RNA Sequencing Assay

3) Product Images from "De novo Transcriptome Generation and Annotation for Two Korean Endemic Land Snails, Aegista chejuensis and Aegista quelpartensis, Using Illumina Paired-End Sequencing Technology"

Article Title: De novo Transcriptome Generation and Annotation for Two Korean Endemic Land Snails, Aegista chejuensis and Aegista quelpartensis, Using Illumina Paired-End Sequencing Technology

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms17030379

PANM-DB based top-hit species classification for ( A ) A. chejuensis ; and ( B ) A. quelpartensis using BLASTX analysis.
Figure Legend Snippet: PANM-DB based top-hit species classification for ( A ) A. chejuensis ; and ( B ) A. quelpartensis using BLASTX analysis.

Techniques Used:

GO functional classification at level 2 for A. chejuensis ( A ); and A. quelpartensis ( B ) unigenes.
Figure Legend Snippet: GO functional classification at level 2 for A. chejuensis ( A ); and A. quelpartensis ( B ) unigenes.

Techniques Used: Functional Assay

Size distribution of contigs ( A ) and unigenes ( B ) after assembly and clustering of the clean reads obtained from transcriptome sequencing of A. chejuensis and A. quelpartensis .
Figure Legend Snippet: Size distribution of contigs ( A ) and unigenes ( B ) after assembly and clustering of the clean reads obtained from transcriptome sequencing of A. chejuensis and A. quelpartensis .

Techniques Used: Sequencing

COG classification of ( A ) A. chejuensis and ( B ) A. quelpartensis unigenes. The code descriptions for COG categories are as follows: R, general function prediction only; Multi, more than one classified function; T, signal transduction mechanisms; S, unknown function; O, post-translational modification, protein turnover, and chaperones; K, transcription; Z, cytoskeleton; J, translation, ribosomal structure, and biogenesis; U, intracellular trafficking, secretion, and vesicular transport; G, carbohydrate transport and metabolism; E, amino acid transport and metabolism; A, RNA processing and modification; P, inorganic ion transport and metabolism; L, replication, recombination, and repair; I, lipid transport and metabolism; C, energy production and conversion; Q, secondary metabolites biosynthesis, transport and catabolism; W, extracellular structures; M, cell wall/membrane/envelope biogenesis; D, cell cycle control, cell division, and chromosome portioning; F, nucleotide transport and metabolism; V, defense mechanisms; B, chromatin structure and dynamics; H, co-enzyme transport and metabolism; Y, nuclear structure; N, cell motility.
Figure Legend Snippet: COG classification of ( A ) A. chejuensis and ( B ) A. quelpartensis unigenes. The code descriptions for COG categories are as follows: R, general function prediction only; Multi, more than one classified function; T, signal transduction mechanisms; S, unknown function; O, post-translational modification, protein turnover, and chaperones; K, transcription; Z, cytoskeleton; J, translation, ribosomal structure, and biogenesis; U, intracellular trafficking, secretion, and vesicular transport; G, carbohydrate transport and metabolism; E, amino acid transport and metabolism; A, RNA processing and modification; P, inorganic ion transport and metabolism; L, replication, recombination, and repair; I, lipid transport and metabolism; C, energy production and conversion; Q, secondary metabolites biosynthesis, transport and catabolism; W, extracellular structures; M, cell wall/membrane/envelope biogenesis; D, cell cycle control, cell division, and chromosome portioning; F, nucleotide transport and metabolism; V, defense mechanisms; B, chromatin structure and dynamics; H, co-enzyme transport and metabolism; Y, nuclear structure; N, cell motility.

Techniques Used: Transduction, Modification

KEGG classification of unigenes in A. chejuensis ( A ); and A. quelpartensis ( B ).
Figure Legend Snippet: KEGG classification of unigenes in A. chejuensis ( A ); and A. quelpartensis ( B ).

Techniques Used:

Schematic work-flow of the transcriptome analysis employed in the present study to annotate the unigenes of Korean endemic land snails, Aegista chejuensis and Aegista quelpartensis .
Figure Legend Snippet: Schematic work-flow of the transcriptome analysis employed in the present study to annotate the unigenes of Korean endemic land snails, Aegista chejuensis and Aegista quelpartensis .

Techniques Used: Flow Cytometry

Summary of classified SSR repeat types in A. chejuensis ( A ); and A. quelpartensis ( B ) transcriptome.
Figure Legend Snippet: Summary of classified SSR repeat types in A. chejuensis ( A ); and A. quelpartensis ( B ) transcriptome.

Techniques Used:

The functional prediction of unigenes under GO classification. ( A ) The distribution of the unigenes of A. chejuensis to GO biological function, cellular component and molecular function; ( B ) The number of GO terms ascribed to unigenes of A. chejuensis ; ( C ) The GO functional prediction of A. quelpartensis unigenes; ( D ) The number of GO terms ascribed to unigenes of A. quelpartensis .
Figure Legend Snippet: The functional prediction of unigenes under GO classification. ( A ) The distribution of the unigenes of A. chejuensis to GO biological function, cellular component and molecular function; ( B ) The number of GO terms ascribed to unigenes of A. chejuensis ; ( C ) The GO functional prediction of A. quelpartensis unigenes; ( D ) The number of GO terms ascribed to unigenes of A. quelpartensis .

Techniques Used: Functional Assay

Sequence-based annotation of A. chejuensis ( A ); and A. quelpartensis ( B ) unigenes against PANM-DB, COG DB (BLASTX) and Unigene DB (BLASTN). The numbers represent the number of unigenes uniquely matched to homologous sequences in one, two or all three databases.
Figure Legend Snippet: Sequence-based annotation of A. chejuensis ( A ); and A. quelpartensis ( B ) unigenes against PANM-DB, COG DB (BLASTX) and Unigene DB (BLASTN). The numbers represent the number of unigenes uniquely matched to homologous sequences in one, two or all three databases.

Techniques Used: Sequencing

Frequency distribution of SSR repeat types in A. chejuensis ( A ); and A. quelpartensis ( B ) transcriptome.
Figure Legend Snippet: Frequency distribution of SSR repeat types in A. chejuensis ( A ); and A. quelpartensis ( B ) transcriptome.

Techniques Used:

PANM-DB homology classification of A. quelpartensis unigenes. ( A ) E -value distribution; ( B ) Identity distribution; ( C ) Similarity distribution; ( D ) Unigene hit or non-hit ratio.
Figure Legend Snippet: PANM-DB homology classification of A. quelpartensis unigenes. ( A ) E -value distribution; ( B ) Identity distribution; ( C ) Similarity distribution; ( D ) Unigene hit or non-hit ratio.

Techniques Used:

4) Product Images from "A highly robust and optimized sequence-based approach for genetic polymorphism discovery and genotyping in large plant populations"

Article Title: A highly robust and optimized sequence-based approach for genetic polymorphism discovery and genotyping in large plant populations

Journal: TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik

doi: 10.1007/s00122-016-2736-9

Workflow of modified RAD-seq library construction. a shearing the cellular DNA into fragments, b ligating the adapters to fragment ends, c pooling of samples and fragment size selection, d second round of digestion to remove the DNA fragments from rRNA genes and chloroplast sequence, e PCR amplification, f second round of fragment size selection
Figure Legend Snippet: Workflow of modified RAD-seq library construction. a shearing the cellular DNA into fragments, b ligating the adapters to fragment ends, c pooling of samples and fragment size selection, d second round of digestion to remove the DNA fragments from rRNA genes and chloroplast sequence, e PCR amplification, f second round of fragment size selection

Techniques Used: Modification, Selection, Sequencing, Polymerase Chain Reaction, Amplification

5) Product Images from "A high throughput screen for active human transposable elements"

Article Title: A high throughput screen for active human transposable elements

Journal: BMC Genomics

doi: 10.1186/s12864-018-4485-4

TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)
Figure Legend Snippet: TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)

Techniques Used: Next-Generation Sequencing, Sequencing, Amplification, Polymerase Chain Reaction, Diagnostic Assay, Multiplexing, Generated

6) Product Images from "A Microbiological Map of the Healthy Equine Gastrointestinal Tract"

Article Title: A Microbiological Map of the Healthy Equine Gastrointestinal Tract

Journal: PLoS ONE

doi: 10.1371/journal.pone.0166523

Richness of the luminal and mucosal equine gut microbiota. Bar charts showing the mean (± sem) number of unique 16S rRNA gene amplicon sequences ( A , B ) or operational taxonomic units (OTUs; C , D ) detected in luminal contents ( A , C ) or mucosa ( B , D ) of samples collected from dorsal stomach (DS), antral stomach (AS), jejunum (Je), ileum (Il), cecum (Ce), ventral colon (VC), or dorsal colon (DC) of nine healthy adult horses. Bars within a chart marked with like letters are significantly different ( p
Figure Legend Snippet: Richness of the luminal and mucosal equine gut microbiota. Bar charts showing the mean (± sem) number of unique 16S rRNA gene amplicon sequences ( A , B ) or operational taxonomic units (OTUs; C , D ) detected in luminal contents ( A , C ) or mucosa ( B , D ) of samples collected from dorsal stomach (DS), antral stomach (AS), jejunum (Je), ileum (Il), cecum (Ce), ventral colon (VC), or dorsal colon (DC) of nine healthy adult horses. Bars within a chart marked with like letters are significantly different ( p

Techniques Used: Amplification

7) Product Images from "Systematic comparison of small RNA library preparation protocols for next-generation sequencing"

Article Title: Systematic comparison of small RNA library preparation protocols for next-generation sequencing

Journal: BMC Genomics

doi: 10.1186/s12864-018-4491-6

a Predicted secondary structures of the synthetic sRNAs 1–6 used in this study ( Methods ). The free energies at 28 °C are indicated for each sRNA without or with 2’ OMe. Nucleotide substitutions introduced to distinguish between the unmodified RNAs (RNA1–6) and the 2’OMe variants (RNA-OMe1–6) are indicated in red. These nucleotide substitutions did not alter the predicted secondary structures. The absence or presence of 2’ OMe modification is indicated by “-”or “+” signs, respectively. b Predicted secondary structures of RNAs1–6 ligated with the Illumina 3′ adapter. The ligation junctions are indicated by green arrows. c Predicted secondary structures of RNAs1–6 ligated with both the Illumina 3′ and 5′ adapter. The 3′ ligation junctions are indicated by green arrows, the 5′ ligation junctions are indicated by red arrows. Note that for 3′ adapter ligation the structures in ( b ) should be considered and for subsequent 5′ adapter ligation the structures in ( c )
Figure Legend Snippet: a Predicted secondary structures of the synthetic sRNAs 1–6 used in this study ( Methods ). The free energies at 28 °C are indicated for each sRNA without or with 2’ OMe. Nucleotide substitutions introduced to distinguish between the unmodified RNAs (RNA1–6) and the 2’OMe variants (RNA-OMe1–6) are indicated in red. These nucleotide substitutions did not alter the predicted secondary structures. The absence or presence of 2’ OMe modification is indicated by “-”or “+” signs, respectively. b Predicted secondary structures of RNAs1–6 ligated with the Illumina 3′ adapter. The ligation junctions are indicated by green arrows. c Predicted secondary structures of RNAs1–6 ligated with both the Illumina 3′ and 5′ adapter. The 3′ ligation junctions are indicated by green arrows, the 5′ ligation junctions are indicated by red arrows. Note that for 3′ adapter ligation the structures in ( b ) should be considered and for subsequent 5′ adapter ligation the structures in ( c )

Techniques Used: Modification, Ligation

8) Product Images from "Cost-effective, high-throughput, single-haplotype iterative mapping and sequencing for complex genomic structures"

Article Title: Cost-effective, high-throughput, single-haplotype iterative mapping and sequencing for complex genomic structures

Journal: Nature protocols

doi: 10.1038/nprot.2018.019

Overview of SHIMS 2.0 protocol. A timeline of a single iteration of the SHIMS 2.0 protocol, showing the major protocol steps, with key quality controls on the right. During a single week-long iteration, 192 clones are processed in parallel, and the resulting draft clone sequences are used to identify sequence family variants (SFVs) that distinguish paralogous ampliconic sequences. A single technician can proceed from a list of clones to completed Illumina libraries in 5 days. After a 2-day long MiSeq run, a bioinformatics specialist assembles demultiplexed fastq sequences into draft clone assemblies and identifies SFVs to select clones for the next iteration.
Figure Legend Snippet: Overview of SHIMS 2.0 protocol. A timeline of a single iteration of the SHIMS 2.0 protocol, showing the major protocol steps, with key quality controls on the right. During a single week-long iteration, 192 clones are processed in parallel, and the resulting draft clone sequences are used to identify sequence family variants (SFVs) that distinguish paralogous ampliconic sequences. A single technician can proceed from a list of clones to completed Illumina libraries in 5 days. After a 2-day long MiSeq run, a bioinformatics specialist assembles demultiplexed fastq sequences into draft clone assemblies and identifies SFVs to select clones for the next iteration.

Techniques Used: Clone Assay, Sequencing

9) Product Images from "Biodegradation of thiocyanate by a native groundwater microbial consortium"

Article Title: Biodegradation of thiocyanate by a native groundwater microbial consortium

Journal: PeerJ

doi: 10.7717/peerj.6498

The relative abundance of 16S rRNA gene sequence assignments from the Greengenes database (A) and 18S rRNA gene sequence assignments from the SILVA database (B). Relative abundances are shown for the re-cultured groundwater community amended with DOC and PO 4 3− . 16S rRNA gene Taxonomic assignments are defined at the phylum (inner circle), family (middle) and genus (outer) levels, while 18S rRNA gene taxonomic assignments are classified at the phylum (inner), class (middle) and species (outer) levels. Classified taxa comprising ≥1% total abundance are labelled, and grey areas represent unclassified taxa.
Figure Legend Snippet: The relative abundance of 16S rRNA gene sequence assignments from the Greengenes database (A) and 18S rRNA gene sequence assignments from the SILVA database (B). Relative abundances are shown for the re-cultured groundwater community amended with DOC and PO 4 3− . 16S rRNA gene Taxonomic assignments are defined at the phylum (inner circle), family (middle) and genus (outer) levels, while 18S rRNA gene taxonomic assignments are classified at the phylum (inner), class (middle) and species (outer) levels. Classified taxa comprising ≥1% total abundance are labelled, and grey areas represent unclassified taxa.

Techniques Used: Sequencing, Cell Culture

10) Product Images from "Tet-mediated covalent labelling of 5-methylcytosine for its genome-wide detection and sequencing"

Article Title: Tet-mediated covalent labelling of 5-methylcytosine for its genome-wide detection and sequencing

Journal: Nature communications

doi: 10.1038/ncomms2527

Validation of the 5mC-labelling approach using model dsDNA and genomic DNA
Figure Legend Snippet: Validation of the 5mC-labelling approach using model dsDNA and genomic DNA

Techniques Used:

Schematic diagram of the selective labelling of 5mC in DNA
Figure Legend Snippet: Schematic diagram of the selective labelling of 5mC in DNA

Techniques Used:

11) Product Images from "A high throughput screen for active human transposable elements"

Article Title: A high throughput screen for active human transposable elements

Journal: BMC Genomics

doi: 10.1186/s12864-018-4485-4

TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)
Figure Legend Snippet: TE-NGS sequencing workflow. Enrichment for genomic fragments spanning active TEs and their unique flanking sequence is achieved by several enzymatic steps as described in the main text. First, genomic DNA is sheared, and adapters for sequencing are ligated to the genomic fragments following standard library preparation protocols. Next, a small aliquot (10 ng) of library is used as template for targeted amplification with primers complementary to TE subfamily-specific sequences and to the Illumina Universal PCR (P5) primer. Remaining genomic background fragments and inverted TEs in head-to-head orientation are removed by ssDNA exonuclease digestion after linear PCR amplification with TE-target primers or Illumina Universal primer, respectively. Last, amplification with nested primers targeting TE diagnostic bases, and containing Illumina i7 index and P7 primer sequences generates full double-stranded dual-adapter libraries containing unique indices for each sample and each TE subfamily, allowing for downstream pooling and multiplexing of many samples simultaneously. High throughput sequencing followed by alignment to the reference genome demarcates the TE insertion site by its 3′ end (read 2) and unique flanking sequence (read 1). TE insertions present in the reference genome can be identified by clustering of read pairs, whereas read 2 generated from polymorphic or novel TE insertions absent from the reference will map with lower quality and/or not at all; these TE can be identified by clusters of read 1 alone (see Methods; Supplemental Material for detailed procedures)

Techniques Used: Next-Generation Sequencing, Sequencing, Amplification, Polymerase Chain Reaction, Diagnostic Assay, Multiplexing, Generated

12) Product Images from "Unbiased screen of RNA tailing activities reveals a poly(UG) polymerase"

Article Title: Unbiased screen of RNA tailing activities reveals a poly(UG) polymerase

Journal: Nature methods

doi: 10.1038/s41592-019-0370-6

Nucleotide addition activity of S. pombe SPAC1093.04 and S. cerevisiae Cca1. (a) Left, tail-o-gram depicting nucleotide composition in each added tail length added by S. pombe SPAC1093.04 and number of tails normalized to unique heptamer sequences. Right, most abundant tail sequences added to tRNA reporter containing a 3′ CC, or 3′ CCA end. (b) Left, tail-o-gram depicting nucleotide composition in each added tail length added by S. cerevisiae Cca1 and number of tails normalized to unique heptamer sequences. Right, most abundant tail sequences added to tRNA reporter containing a 3′ CCA end. (c) Sequence motif effect analysis of tails added by Sp SPAC1093.04 (red, n=5) and Sc Cca1 (black, n=3). Each adjusted p -value quantifies the significance of contribution of the indicated oligonucleotide to the variation in tail sequence read counts. Significances for dinucleotide (CC) and trinucleotides (CCA) after multiplicity correction with the Bonferroni procedure are shown. A dashed line indicates significance level 0.05. The -log 10 p -values from left to right in the figure are 300, 148, 0.87, and 313. (d) . cca1-1 mutant strains containing CEN plasmids expressing indicated plasmids were serially diluted, spotted on SD-Ura-Leu media and grown at 37°C for 3 days or 23°C for 4 days. This experiment was repeated twice with similar results.
Figure Legend Snippet: Nucleotide addition activity of S. pombe SPAC1093.04 and S. cerevisiae Cca1. (a) Left, tail-o-gram depicting nucleotide composition in each added tail length added by S. pombe SPAC1093.04 and number of tails normalized to unique heptamer sequences. Right, most abundant tail sequences added to tRNA reporter containing a 3′ CC, or 3′ CCA end. (b) Left, tail-o-gram depicting nucleotide composition in each added tail length added by S. cerevisiae Cca1 and number of tails normalized to unique heptamer sequences. Right, most abundant tail sequences added to tRNA reporter containing a 3′ CCA end. (c) Sequence motif effect analysis of tails added by Sp SPAC1093.04 (red, n=5) and Sc Cca1 (black, n=3). Each adjusted p -value quantifies the significance of contribution of the indicated oligonucleotide to the variation in tail sequence read counts. Significances for dinucleotide (CC) and trinucleotides (CCA) after multiplicity correction with the Bonferroni procedure are shown. A dashed line indicates significance level 0.05. The -log 10 p -values from left to right in the figure are 300, 148, 0.87, and 313. (d) . cca1-1 mutant strains containing CEN plasmids expressing indicated plasmids were serially diluted, spotted on SD-Ura-Leu media and grown at 37°C for 3 days or 23°C for 4 days. This experiment was repeated twice with similar results.

Techniques Used: Activity Assay, Sequencing, Mutagenesis, Expressing

13) Product Images from "Shifts on Gut Microbiota Associated to Mediterranean Diet Adherence and Specific Dietary Intakes on General Adult Population"

Article Title: Shifts on Gut Microbiota Associated to Mediterranean Diet Adherence and Specific Dietary Intakes on General Adult Population

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2018.00890

Microbiota composition by 16S rDNA sequencing. Microbial Relative abundances (%) at phylum ( A : General profile, B : according to BMI, and C : according to MD adherence) and family level ( D : General profile, E : according to BMI, and F : according to MD adherence) found in the gut microbiome of volunteers.
Figure Legend Snippet: Microbiota composition by 16S rDNA sequencing. Microbial Relative abundances (%) at phylum ( A : General profile, B : according to BMI, and C : according to MD adherence) and family level ( D : General profile, E : according to BMI, and F : according to MD adherence) found in the gut microbiome of volunteers.

Techniques Used: Sequencing

14) Product Images from "Human RNase L tunes gene expression by selectively destabilizing the microRNA-regulated transcriptome"

Article Title: Human RNase L tunes gene expression by selectively destabilizing the microRNA-regulated transcriptome

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1513034112

RNA-seq analysis of WT and RNase L-KO human cells. ( A ) The 2–5A activates cleavage of 28S rRNA in WT but not RNase L-KO HAP1 cells. ( B ) Signed P′ profiles for poly-A + and Ribo-Zero RNA-seq data. ( C ) Running average motif frequency in Ribo-Zero
Figure Legend Snippet: RNA-seq analysis of WT and RNase L-KO human cells. ( A ) The 2–5A activates cleavage of 28S rRNA in WT but not RNase L-KO HAP1 cells. ( B ) Signed P′ profiles for poly-A + and Ribo-Zero RNA-seq data. ( C ) Running average motif frequency in Ribo-Zero

Techniques Used: RNA Sequencing Assay

15) Product Images from "Genome-wide antagonism between 5-hydroxymethylcytosine and DNA methylation in the adult mouse brain"

Article Title: Genome-wide antagonism between 5-hydroxymethylcytosine and DNA methylation in the adult mouse brain

Journal: Frontiers in biology

doi: 10.1007/s11515-014-1295-1

Relationship between 5hmC, gene expression, and protein-DNA interaction in DGNs. (A) Meta-gene analysis of 5hmC levels correlated with gene expression. 5hmC levels were averaged across all genes stratified by their expression rank (top). Spearman’s
Figure Legend Snippet: Relationship between 5hmC, gene expression, and protein-DNA interaction in DGNs. (A) Meta-gene analysis of 5hmC levels correlated with gene expression. 5hmC levels were averaged across all genes stratified by their expression rank (top). Spearman’s

Techniques Used: Expressing

Global antagonism between 5hmC and overall DNA methylation in both DGNs and ESCs. (A) A chromosome-wide view of 5hmC (top) and overall DNA methylation (bottom) levels. Signals were moving-averaged using 10-kb windows. (B) A density plots of genome-wide
Figure Legend Snippet: Global antagonism between 5hmC and overall DNA methylation in both DGNs and ESCs. (A) A chromosome-wide view of 5hmC (top) and overall DNA methylation (bottom) levels. Signals were moving-averaged using 10-kb windows. (B) A density plots of genome-wide

Techniques Used: DNA Methylation Assay, Genome Wide

16) Product Images from "Birth mode is associated with earliest strain-conferred gut microbiome functions and immunostimulatory potential"

Article Title: Birth mode is associated with earliest strain-conferred gut microbiome functions and immunostimulatory potential

Journal: Nature Communications

doi: 10.1038/s41467-018-07631-x

Transmission of functions by distinct microbial strains. a Taxa which were detected in gut microbiomes of mothers (diagonal line) and neonates (on postnatal day 3 (below the line) and/or day 5 (above the line), indicated by shading) in vaginal delivery (VD), caesarean section delivery (CSD) and CSD with small for gestational age (SGA) status (CSD + SGA) groups. The level of evidence of transmission is indicated by the shading colour, with darker shading for stronger evidence. A taxon without link describes a taxon that was found in the maternal samples, but not shared between mother and neonate. P based on PhyloPhlAn; S based on StrainPhlAn. Neonates C115 and C116 are twins. b Inter-population fixation indices (F ST ) comparing maternal (M) and neonatal (days 1, 3, 5) faecal samples. Phylum-level colour key is given in a . Encircled symbols highlight strains that are shared with the respective mother. c Intra-population diversity index (π). Circles and triangles represent maternal and neonatal faecal samples, respectively. d , e Relative abundance of the metagenomic operational taxonomic units (mOTU) belonging to Bacteroides dorei/vulgatus ( d ) and Staphylococcus epidermidis ( e ) in maternal faecal (M), maternal vaginal (MV) and neonatal faecal (days 1, 3, 5) samples from VD, CSD and CSD + SGA groups; *false discovery rate (FDR)-adjusted P
Figure Legend Snippet: Transmission of functions by distinct microbial strains. a Taxa which were detected in gut microbiomes of mothers (diagonal line) and neonates (on postnatal day 3 (below the line) and/or day 5 (above the line), indicated by shading) in vaginal delivery (VD), caesarean section delivery (CSD) and CSD with small for gestational age (SGA) status (CSD + SGA) groups. The level of evidence of transmission is indicated by the shading colour, with darker shading for stronger evidence. A taxon without link describes a taxon that was found in the maternal samples, but not shared between mother and neonate. P based on PhyloPhlAn; S based on StrainPhlAn. Neonates C115 and C116 are twins. b Inter-population fixation indices (F ST ) comparing maternal (M) and neonatal (days 1, 3, 5) faecal samples. Phylum-level colour key is given in a . Encircled symbols highlight strains that are shared with the respective mother. c Intra-population diversity index (π). Circles and triangles represent maternal and neonatal faecal samples, respectively. d , e Relative abundance of the metagenomic operational taxonomic units (mOTU) belonging to Bacteroides dorei/vulgatus ( d ) and Staphylococcus epidermidis ( e ) in maternal faecal (M), maternal vaginal (MV) and neonatal faecal (days 1, 3, 5) samples from VD, CSD and CSD + SGA groups; *false discovery rate (FDR)-adjusted P

Techniques Used: Transmission Assay

Curation of metagenomic data. a Schematic representation of the workflow for removal of artefacts introduced during genomic extraction or preparation of sequence libraries in the low-biomass neonatal samples. b Sample-wise bioinformatic workflow for removal of artefactual sequences from metagenomic data, extraction of taxonomic and functional profiles, and reconstruction of genomes and strain-resolved analyses. The resulting data sets used for inter-sample comparisons are highlighted in grey. mOTU, metagenomic operational taxonomic unit
Figure Legend Snippet: Curation of metagenomic data. a Schematic representation of the workflow for removal of artefacts introduced during genomic extraction or preparation of sequence libraries in the low-biomass neonatal samples. b Sample-wise bioinformatic workflow for removal of artefactual sequences from metagenomic data, extraction of taxonomic and functional profiles, and reconstruction of genomes and strain-resolved analyses. The resulting data sets used for inter-sample comparisons are highlighted in grey. mOTU, metagenomic operational taxonomic unit

Techniques Used: Sequencing, Functional Assay

17) Product Images from "Optimized Illumina PCR-free library preparation for bacterial whole genome sequencing and analysis of factors influencing de novo assembly"

Article Title: Optimized Illumina PCR-free library preparation for bacterial whole genome sequencing and analysis of factors influencing de novo assembly

Journal: BMC Research Notes

doi: 10.1186/s13104-016-2072-9

Insert size distributions after second size selection. Data originate from analysis with Bioanalyzer instruments. a Insert size distributions of sequencing libraries obtained with the standard Illumina TruSeq ® DNA PCR-free LPP have an overall good reproducibility. All sequenced TS libraries are shown. b Modifications during DNA fragmentation and insert size selection enabled the creation of sequencing libraries with sharper and more symmetric insert size distributions. Sequencing libraries Efa_TS and Efa_IS1 are illustrated in red and blue , respectively. c In addition, different RB:BB ratios led to sequencing libraries varying in average insert size for the same genome. Blue : Pst_IS1, red : Pst_IS3. d Insert size distribution reproducibility is maintained when using modified LPPs
Figure Legend Snippet: Insert size distributions after second size selection. Data originate from analysis with Bioanalyzer instruments. a Insert size distributions of sequencing libraries obtained with the standard Illumina TruSeq ® DNA PCR-free LPP have an overall good reproducibility. All sequenced TS libraries are shown. b Modifications during DNA fragmentation and insert size selection enabled the creation of sequencing libraries with sharper and more symmetric insert size distributions. Sequencing libraries Efa_TS and Efa_IS1 are illustrated in red and blue , respectively. c In addition, different RB:BB ratios led to sequencing libraries varying in average insert size for the same genome. Blue : Pst_IS1, red : Pst_IS3. d Insert size distribution reproducibility is maintained when using modified LPPs

Techniques Used: Selection, Sequencing, Polymerase Chain Reaction, Modification

18) Product Images from "A new platform for ultra-high density Staphylococcus aureus transposon libraries"

Article Title: A new platform for ultra-high density Staphylococcus aureus transposon libraries

Journal: BMC Genomics

doi: 10.1186/s12864-015-1361-3

Protocol for the preparation of a high quality transposon DNA library for NGS. (A) (1) Genomic DNA is isolated and digested with Not I. High molecular weight DNA is selectively precipitated using an 8%PEG + NaCl solution, and transposon-plasmid junctions (106 bp) are removed in the supernatant. A biotinylated dsDNA adapter with Not I overhang is ligated (2) before digestion with Mme I, which cuts non-specifically 20 bp from its recognition site within ITR2 into the genome to liberate biotinylated-transposon-genome junctions as short DNA fragments (114 bp). (3). Biotinylated fragments are bound to streptavidin beads (4), and an Illumina sequencing primer adapter containing an indexing barcode and MmeI compatible ends is ligated (5). Primers annealing to the P7 site and the Illumina sequencing primer adapter sequence (with a P5 site overhang) are used to PCR amplify the transposon-genome junctions (6), agarose gel purified, and submitted for Illumina sequencing (7). NGS reads capture both the 16-bp of flanking genomic DNA as well as the transposon donor specific barcode located between the P7 and ITR2. (B) Fragments arising from transposon-plasmid junctions are removed by size selective PEG-NaCl precipitation, while the remaining fragments lack both P7 annealing sites and Mme I sites for ligation of the Illumina sequencing primer adapter. These fragments are therefore not amplified in step (6) of 4A. (C) By performing the size-selective precipitation on a 1 kb DNA ladder, we show that small 300 bp fragments of DNA are retained in the solution (SN), while larger DNA is precipitated (P). (D) Six transposon donor constructs were multiplexed and designed to attenuate expression of genes proximal to the insertion site according to the regulatory elements located at the ends of the transposon backbone. Each donor can be identified from NGS reads by the unique 3 bp barcode.
Figure Legend Snippet: Protocol for the preparation of a high quality transposon DNA library for NGS. (A) (1) Genomic DNA is isolated and digested with Not I. High molecular weight DNA is selectively precipitated using an 8%PEG + NaCl solution, and transposon-plasmid junctions (106 bp) are removed in the supernatant. A biotinylated dsDNA adapter with Not I overhang is ligated (2) before digestion with Mme I, which cuts non-specifically 20 bp from its recognition site within ITR2 into the genome to liberate biotinylated-transposon-genome junctions as short DNA fragments (114 bp). (3). Biotinylated fragments are bound to streptavidin beads (4), and an Illumina sequencing primer adapter containing an indexing barcode and MmeI compatible ends is ligated (5). Primers annealing to the P7 site and the Illumina sequencing primer adapter sequence (with a P5 site overhang) are used to PCR amplify the transposon-genome junctions (6), agarose gel purified, and submitted for Illumina sequencing (7). NGS reads capture both the 16-bp of flanking genomic DNA as well as the transposon donor specific barcode located between the P7 and ITR2. (B) Fragments arising from transposon-plasmid junctions are removed by size selective PEG-NaCl precipitation, while the remaining fragments lack both P7 annealing sites and Mme I sites for ligation of the Illumina sequencing primer adapter. These fragments are therefore not amplified in step (6) of 4A. (C) By performing the size-selective precipitation on a 1 kb DNA ladder, we show that small 300 bp fragments of DNA are retained in the solution (SN), while larger DNA is precipitated (P). (D) Six transposon donor constructs were multiplexed and designed to attenuate expression of genes proximal to the insertion site according to the regulatory elements located at the ends of the transposon backbone. Each donor can be identified from NGS reads by the unique 3 bp barcode.

Techniques Used: Next-Generation Sequencing, Isolation, Molecular Weight, Plasmid Preparation, Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Purification, Ligation, Amplification, Construct, Expressing

Reduction of transposon-plasmid junction NGS reads with flanking Not I restriction sites. (A) Inverse PCR was used to amplify the ITR2 transposon junctions for twelve colonies as has been described [ 39 ]. Three out of twelve of these colonies also contained transposon-plasmid junctions (~160 bp DNA band). This ratio increased to seven out of twelve when the canonical ITR sequence was altered to incorporate a MmeI recognition site (Additional file 1 : Figure S2). Results are representative of multiple independent experimental replicates. (B) The putative mechanism for transposase catalyzed integration of transposon-plasmid junctions may involve engagement of non-contiguous ITR repeats (dashed lines), resulting in chromosomally integrated transposon multimers. In contrast, when both ITR sequences are optimal, contiguous ITRs are most frequently mobilized (solid lines). (C) Colors are used to identify the positions of the sequences in this drawing. To selectively remove transposon-plasmid junctions, we introduced two Not I sites into the transposon construct that flanked the MmeI modified ITR2. In addition, we included a P7 Illumina sequencing primer site with a unique 3-bp DNA barcode to identify the P out promoter that faces outward from ITR1 during NGS sequencing. (D) After first digesting gDNA with Not I, the transposon-plasmid junction content was substantially reduced in comparison to Figure 3A.
Figure Legend Snippet: Reduction of transposon-plasmid junction NGS reads with flanking Not I restriction sites. (A) Inverse PCR was used to amplify the ITR2 transposon junctions for twelve colonies as has been described [ 39 ]. Three out of twelve of these colonies also contained transposon-plasmid junctions (~160 bp DNA band). This ratio increased to seven out of twelve when the canonical ITR sequence was altered to incorporate a MmeI recognition site (Additional file 1 : Figure S2). Results are representative of multiple independent experimental replicates. (B) The putative mechanism for transposase catalyzed integration of transposon-plasmid junctions may involve engagement of non-contiguous ITR repeats (dashed lines), resulting in chromosomally integrated transposon multimers. In contrast, when both ITR sequences are optimal, contiguous ITRs are most frequently mobilized (solid lines). (C) Colors are used to identify the positions of the sequences in this drawing. To selectively remove transposon-plasmid junctions, we introduced two Not I sites into the transposon construct that flanked the MmeI modified ITR2. In addition, we included a P7 Illumina sequencing primer site with a unique 3-bp DNA barcode to identify the P out promoter that faces outward from ITR1 during NGS sequencing. (D) After first digesting gDNA with Not I, the transposon-plasmid junction content was substantially reduced in comparison to Figure 3A.

Techniques Used: Plasmid Preparation, Next-Generation Sequencing, Inverse PCR, Sequencing, Construct, Modification

19) Product Images from "Sequencing of lariat termini in S. cerevisiae reveals 5′ splice sites, branch points, and novel splicing events"

Article Title: Sequencing of lariat termini in S. cerevisiae reveals 5′ splice sites, branch points, and novel splicing events

Journal: RNA

doi: 10.1261/rna.052829.115

LIT-seq: a strategy for sequencing the intronome. ( A ) Fate of an excised intron in wild-type DBR1 and mutant dbr1 Δ strains. In wild-type cells, the lariat RNA is debranched and degraded by exonucleases. In dbr1 Δ cells, lariat RNAs accumulate
Figure Legend Snippet: LIT-seq: a strategy for sequencing the intronome. ( A ) Fate of an excised intron in wild-type DBR1 and mutant dbr1 Δ strains. In wild-type cells, the lariat RNA is debranched and degraded by exonucleases. In dbr1 Δ cells, lariat RNAs accumulate

Techniques Used: Sequencing, Mutagenesis

20) Product Images from "Transcriptome Analysis of Gerbera hybrida Including in silico Confirmation of Defense Genes Found"

Article Title: Transcriptome Analysis of Gerbera hybrida Including in silico Confirmation of Defense Genes Found

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2016.00247

Workflow of transcriptome sequencing for four parents . (i) Leaves and floral buds of the four gerbera genotypes used to isolate RNA; (ii) Mixed cDNA libraries of four genotypes sequenced on an Illumina platform; (iii) Raw reads used for pre-processing to trim adapter sequences and to filter reads with low quality; (iv) Transcripts of SP1 assembled as first step toward reference transcriptome construction; (v) Transcripts of other genotypes mapped to reference to yield consensus contigs named “Cap3Contigs_All” for SNP detection and annotation.
Figure Legend Snippet: Workflow of transcriptome sequencing for four parents . (i) Leaves and floral buds of the four gerbera genotypes used to isolate RNA; (ii) Mixed cDNA libraries of four genotypes sequenced on an Illumina platform; (iii) Raw reads used for pre-processing to trim adapter sequences and to filter reads with low quality; (iv) Transcripts of SP1 assembled as first step toward reference transcriptome construction; (v) Transcripts of other genotypes mapped to reference to yield consensus contigs named “Cap3Contigs_All” for SNP detection and annotation.

Techniques Used: Sequencing

21) Product Images from "Novel Insights into Selection for Antibiotic Resistance in Complex Microbial Communities"

Article Title: Novel Insights into Selection for Antibiotic Resistance in Complex Microbial Communities

Journal: mBio

doi: 10.1128/mBio.00969-18

Heat map showing average ( n = 3) detected beta-lactam resistance gene subtype relative abundance (resistance gene number normalized with 16S rRNA copy number), following 8 days of culture with cefotaxime. Only genes detected with the ARGs-OAP pipeline are shown.
Figure Legend Snippet: Heat map showing average ( n = 3) detected beta-lactam resistance gene subtype relative abundance (resistance gene number normalized with 16S rRNA copy number), following 8 days of culture with cefotaxime. Only genes detected with the ARGs-OAP pipeline are shown.

Techniques Used:

Selection coefficients ( n = 5) for each cefotaxime concentration, which equal the natural log of resistance gene prevalence ( bla CTX-M gene/16S rRNA copy number) at day 0 and day 8. Circles, selection coefficients from low-concentration experiment; squares, selection coefficients from high-concentration experiment. Selection coefficients of > 0 indicate positive selection.
Figure Legend Snippet: Selection coefficients ( n = 5) for each cefotaxime concentration, which equal the natural log of resistance gene prevalence ( bla CTX-M gene/16S rRNA copy number) at day 0 and day 8. Circles, selection coefficients from low-concentration experiment; squares, selection coefficients from high-concentration experiment. Selection coefficients of > 0 indicate positive selection.

Techniques Used: Selection, Concentration Assay

22) Product Images from "Transcriptomic and GC-MS Metabolomic Analyses Reveal the Sink Strength Changes during Petunia Anther Development"

Article Title: Transcriptomic and GC-MS Metabolomic Analyses Reveal the Sink Strength Changes during Petunia Anther Development

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19040955

The qRT-PCR validation of DEGs. The relative expression levels of 18 transcription factors ( A ), 14 starch and sucrose metabolism pathways ( B ) and 6 photosynthesis related genes ( C ). The left Y axis represents the relative transcript amount obtained by qRT-PCR. The right Y axis represents the fragments per kb per million fragments (FPKM) value of each gene using RNA-Seq analysis. Error bars indicate the standard errors. ( D ) Correlation analysis of the gene expression ratios between qRT-PCR and RNA-seq.
Figure Legend Snippet: The qRT-PCR validation of DEGs. The relative expression levels of 18 transcription factors ( A ), 14 starch and sucrose metabolism pathways ( B ) and 6 photosynthesis related genes ( C ). The left Y axis represents the relative transcript amount obtained by qRT-PCR. The right Y axis represents the fragments per kb per million fragments (FPKM) value of each gene using RNA-Seq analysis. Error bars indicate the standard errors. ( D ) Correlation analysis of the gene expression ratios between qRT-PCR and RNA-seq.

Techniques Used: Quantitative RT-PCR, Expressing, RNA Sequencing Assay

23) Product Images from "RTS,S/AS01 malaria vaccine mismatch observed among Plasmodium falciparum isolates from southern and central Africa and globally"

Article Title: RTS,S/AS01 malaria vaccine mismatch observed among Plasmodium falciparum isolates from southern and central Africa and globally

Journal: Scientific Reports

doi: 10.1038/s41598-018-24585-8

RTS,S Amino Acid Changes and Positions. The 84 amino acids (positions 288–371) comprising the C-terminal amplicon are represented by columns in the bar-chart. The percentage of samples sharing the 3D7 amino acid are represented in pale yellow. Non-3D7 amino acid alternatives are represented in descending order of frequency in dark blue, red, light blue, or orange. Below the bar-chart, the 3D7 amino acid sequence is shown, with positions corresponding to the coordinates above. The substitutions at each of the 84 positions are enumerated below the 3D7 sequence.
Figure Legend Snippet: RTS,S Amino Acid Changes and Positions. The 84 amino acids (positions 288–371) comprising the C-terminal amplicon are represented by columns in the bar-chart. The percentage of samples sharing the 3D7 amino acid are represented in pale yellow. Non-3D7 amino acid alternatives are represented in descending order of frequency in dark blue, red, light blue, or orange. Below the bar-chart, the 3D7 amino acid sequence is shown, with positions corresponding to the coordinates above. The substitutions at each of the 84 positions are enumerated below the 3D7 sequence.

Techniques Used: Amplification, Sequencing

24) Product Images from "Direct Targets of CodY in Staphylococcus aureus ▿ ▿ †"

Article Title: Direct Targets of CodY in Staphylococcus aureus ▿ ▿ †

Journal: Journal of Bacteriology

doi: 10.1128/JB.00220-10

Protocol for genome-wide identification of CodY binding sites. Briefly, gDNA was sheared by sonication. Adapters were ligated to the sheared DNA and then gel purified to obtain a DNA library containing fragments of 400 to 500 bp in length. The DNA library was then subjected to PCR amplification using adapter-specific primers to generate enough DNA for the pull-down experiment. A 200 nM concentration of His-tagged CodY or 200 nM His-tagged Acn was incubated with 50 μg sheared, adapter-ligated DNA and the effector molecules (2 mM GTP and 10 mM ILV). Protein-DNA complexes were purified with a Co 2+ resin. Following elution of the protein from the resin, the DNA was isolated, PCR amplified again, and subjected to analysis with a Illumina Genome Analyzer II.
Figure Legend Snippet: Protocol for genome-wide identification of CodY binding sites. Briefly, gDNA was sheared by sonication. Adapters were ligated to the sheared DNA and then gel purified to obtain a DNA library containing fragments of 400 to 500 bp in length. The DNA library was then subjected to PCR amplification using adapter-specific primers to generate enough DNA for the pull-down experiment. A 200 nM concentration of His-tagged CodY or 200 nM His-tagged Acn was incubated with 50 μg sheared, adapter-ligated DNA and the effector molecules (2 mM GTP and 10 mM ILV). Protein-DNA complexes were purified with a Co 2+ resin. Following elution of the protein from the resin, the DNA was isolated, PCR amplified again, and subjected to analysis with a Illumina Genome Analyzer II.

Techniques Used: Genome Wide, Binding Assay, Sonication, Purification, Polymerase Chain Reaction, Amplification, Concentration Assay, Incubation, Isolation

25) Product Images from "In Situ Field Sequencing and Life Detection in Remote (79°26′N) Canadian High Arctic Permafrost Ice Wedge Microbial Communities"

Article Title: In Situ Field Sequencing and Life Detection in Remote (79°26′N) Canadian High Arctic Permafrost Ice Wedge Microbial Communities

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2017.02594

Microbial Activity Microassay (Ecolog plate) Bacterial diversity. Bacterial reads from Ecolog metagenome sequenced using the MinION rapid kit compared with Bacterial composition inferred from amplicon sequencing of 16S rRNA gene.
Figure Legend Snippet: Microbial Activity Microassay (Ecolog plate) Bacterial diversity. Bacterial reads from Ecolog metagenome sequenced using the MinION rapid kit compared with Bacterial composition inferred from amplicon sequencing of 16S rRNA gene.

Techniques Used: Activity Assay, Amplification, Sequencing

Ice Wedge soil bacterial community composition detected by the MinION. Bacterial reads from ice wedge soil metagenomes sequenced using the MinION rapid and low input kit compared with Bacterial composition inferred from amplicon sequencing of 16S rRNA gene.
Figure Legend Snippet: Ice Wedge soil bacterial community composition detected by the MinION. Bacterial reads from ice wedge soil metagenomes sequenced using the MinION rapid and low input kit compared with Bacterial composition inferred from amplicon sequencing of 16S rRNA gene.

Techniques Used: Amplification, Sequencing

26) Product Images from "A Barcode Screen for Epigenetic Regulators Reveals a Role for the NuB4/HAT-B Histone Acetyltransferase Complex in Histone Turnover"

Article Title: A Barcode Screen for Epigenetic Regulators Reveals a Role for the NuB4/HAT-B Histone Acetyltransferase Complex in Histone Turnover

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1002284

Combining Epi-ID with RITE to screen for histone turnover mutants. Each mutant in the yeast deletion library contains at the location of the deleted gene a common selectable marker gene (KanMX; black box) flanked by two unique barcodes: UpTag and DownTag (U/D). A set of deletion mutants was crossed with an H3-HAT7 RITE strain to switch epitope tags on histone H3 and monitor replacement of old by new histones in mutants (histone turnover library). Following a RITE assay and ChIP (HA and T7) on a pool of mutants, barcode abundance in each ChIP experiment was measured by deep sequencing. After normalizing the datasets, histone turnover at each barcode was calculated by taking the ratio of new/old (T7/HA) histone ChIP signals. Predicted results of mutants with higher and lower turnover are indicated.
Figure Legend Snippet: Combining Epi-ID with RITE to screen for histone turnover mutants. Each mutant in the yeast deletion library contains at the location of the deleted gene a common selectable marker gene (KanMX; black box) flanked by two unique barcodes: UpTag and DownTag (U/D). A set of deletion mutants was crossed with an H3-HAT7 RITE strain to switch epitope tags on histone H3 and monitor replacement of old by new histones in mutants (histone turnover library). Following a RITE assay and ChIP (HA and T7) on a pool of mutants, barcode abundance in each ChIP experiment was measured by deep sequencing. After normalizing the datasets, histone turnover at each barcode was calculated by taking the ratio of new/old (T7/HA) histone ChIP signals. Predicted results of mutants with higher and lower turnover are indicated.

Techniques Used: Mutagenesis, Marker, Chromatin Immunoprecipitation, Sequencing

Epi-ID can identify histone turnover mutants. (A) Scheme of experimental set-up. (B–E) Comparison of new/old H3 ratios (T7/HA) of UpTags and DownTags and at two time points (one day; t = 1d, and 3 days; t = 3d), with Pearson correlations of 0.57, 0.87, 0.71, 0.52 for panels B–E, respectively. (F) Deletion mutants with low variation in histone turnover between UpTag and DownTag barcodes and between two different time points (SD
Figure Legend Snippet: Epi-ID can identify histone turnover mutants. (A) Scheme of experimental set-up. (B–E) Comparison of new/old H3 ratios (T7/HA) of UpTags and DownTags and at two time points (one day; t = 1d, and 3 days; t = 3d), with Pearson correlations of 0.57, 0.87, 0.71, 0.52 for panels B–E, respectively. (F) Deletion mutants with low variation in histone turnover between UpTag and DownTag barcodes and between two different time points (SD

Techniques Used:

27) Product Images from "Genome-Centric Analysis of Microbial Populations Enriched by Hydraulic Fracture Fluid Additives in a Coal Bed Methane Production Well"

Article Title: Genome-Centric Analysis of Microbial Populations Enriched by Hydraulic Fracture Fluid Additives in a Coal Bed Methane Production Well

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2016.00731

Map of the Surat Basin (Queensland, Australia) showing the locations of CBM production wells sampled for metagenomic sequencing . Map modified from Hamilton et al. ( 2014 ).
Figure Legend Snippet: Map of the Surat Basin (Queensland, Australia) showing the locations of CBM production wells sampled for metagenomic sequencing . Map modified from Hamilton et al. ( 2014 ).

Techniques Used: Sequencing, Modification

28) Product Images from "Genome-Wide Fitness and Genetic Interactions Determined by Tn-seq, a High-Throughput Massively Parallel Sequencing Method for Microorganisms"

Article Title: Genome-Wide Fitness and Genetic Interactions Determined by Tn-seq, a High-Throughput Massively Parallel Sequencing Method for Microorganisms

Journal: Current protocols in microbiology

doi: 10.1002/9780471729259.mc01e03s36

Detailed schema of how the magellan6 -specific primers and adapter combine to result in a 120-bp DNA fragment that can be sequenced on an Illumina Genome Analyzer II (GAII) platform. AP-B_bc-ACAC (AP-B) and AP-A_bc-ACAC (AP-A) are two oligos that make
Figure Legend Snippet: Detailed schema of how the magellan6 -specific primers and adapter combine to result in a 120-bp DNA fragment that can be sequenced on an Illumina Genome Analyzer II (GAII) platform. AP-B_bc-ACAC (AP-B) and AP-A_bc-ACAC (AP-A) are two oligos that make

Techniques Used:

29) Product Images from "The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation"

Article Title: The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation

Journal: BMC Genomics

doi: 10.1186/s12864-015-1354-2

Transcriptome assembly workflow and alignment to D. rerio reference proteome. A . RNA was extracted from brain and spinal cord tissue of adult A. leptorhynchus, fragmented and barcoded, and strand-specific cDNA libraries were created for Illumina sequencing. Reads were trimmed using several strategies and then normalized in silico prior to de novo assembly with Trinity. Transcript reconstruction was performed using several strategies and then benchmarked using BLAST to maximize transcripts aligning to a D. rerio reference proteome. The best assembly was then further annotated. B . Out of the transcripts from the entire A. leptorhynchus assembly with any alignment to a D. rerio reference protein, most transcripts aligned to
Figure Legend Snippet: Transcriptome assembly workflow and alignment to D. rerio reference proteome. A . RNA was extracted from brain and spinal cord tissue of adult A. leptorhynchus, fragmented and barcoded, and strand-specific cDNA libraries were created for Illumina sequencing. Reads were trimmed using several strategies and then normalized in silico prior to de novo assembly with Trinity. Transcript reconstruction was performed using several strategies and then benchmarked using BLAST to maximize transcripts aligning to a D. rerio reference proteome. The best assembly was then further annotated. B . Out of the transcripts from the entire A. leptorhynchus assembly with any alignment to a D. rerio reference protein, most transcripts aligned to

Techniques Used: Sequencing, In Silico

30) Product Images from "A Molecular Approach to the Sexing of the Triple Burial at the Upper Paleolithic Site of Dolní Věstonice"

Article Title: A Molecular Approach to the Sexing of the Triple Burial at the Upper Paleolithic Site of Dolní Věstonice

Journal: PLoS ONE

doi: 10.1371/journal.pone.0163019

The triple burial of Dolní Věstonice, Moravia, dated to around 31,000 years before present. From left to right: DV 13, DV 15, DV 14.
Figure Legend Snippet: The triple burial of Dolní Věstonice, Moravia, dated to around 31,000 years before present. From left to right: DV 13, DV 15, DV 14.

Techniques Used:

31) Product Images from "Small RNA Sequencing in Cells and Exosomes Identifies eQTLs and 14q32 as a Region of Active Export"

Article Title: Small RNA Sequencing in Cells and Exosomes Identifies eQTLs and 14q32 as a Region of Active Export

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.116.036137

A large miRNA cluster on chromosome 14q32 is exported in exosomes. (A) Diagram of the 14q32 locus, which contains two miRNA clusters denoted as cluster A and cluster B that comprise 15 and 74 mature miRNAs, respectively. These miRNA clusters are flanked by lincRNAs and separated by a lincRNA and an snoRNA cluster. (B) MA plot of our miRNA differential expression results ( n = 34) with miRNAs from the larger miRNA cluster on 14q32 circled in dark blue. DESeq2 uses independent filtering to reduce the number of explicit differential expression tests it runs ( Love et al. 2014 ). miRNAs that were not differentially expressed are depicted in light gray if they were removed by independent filtering and in dark gray otherwise. Significantly differentially expressed miRNAs (FDR = 1%) are colored in red. (C and D) Replication of the overrepresentation in exosomes of miRNAs from the large cluster on 14q32 using HeLa cell data ( n = 5) from Honegger et al. (2015) (C) and B cell line data ( n = 6) from Koppers-Lalic et al. (2014) (D). Note that the Koppers-Lalic et al. data were tested for differential expression using EdgeR, so the x -axis is in counts per million (instead of in DESeq2 normalized counts). Since only miRNAs that were explicitly tested for differential expression were reported, no light gray points appear in D.
Figure Legend Snippet: A large miRNA cluster on chromosome 14q32 is exported in exosomes. (A) Diagram of the 14q32 locus, which contains two miRNA clusters denoted as cluster A and cluster B that comprise 15 and 74 mature miRNAs, respectively. These miRNA clusters are flanked by lincRNAs and separated by a lincRNA and an snoRNA cluster. (B) MA plot of our miRNA differential expression results ( n = 34) with miRNAs from the larger miRNA cluster on 14q32 circled in dark blue. DESeq2 uses independent filtering to reduce the number of explicit differential expression tests it runs ( Love et al. 2014 ). miRNAs that were not differentially expressed are depicted in light gray if they were removed by independent filtering and in dark gray otherwise. Significantly differentially expressed miRNAs (FDR = 1%) are colored in red. (C and D) Replication of the overrepresentation in exosomes of miRNAs from the large cluster on 14q32 using HeLa cell data ( n = 5) from Honegger et al. (2015) (C) and B cell line data ( n = 6) from Koppers-Lalic et al. (2014) (D). Note that the Koppers-Lalic et al. data were tested for differential expression using EdgeR, so the x -axis is in counts per million (instead of in DESeq2 normalized counts). Since only miRNAs that were explicitly tested for differential expression were reported, no light gray points appear in D.

Techniques Used: Expressing

Cells and exosomes cluster by their miRNA and piRNA expression profiles. Hierarchical clustering of samples by the Spearman correlation coefficients of (A) miRNA and (B) piRNA expression. Samples cluster by compartment, confirming that cells and exosomes have distinct expression profiles. On average, the correlations between cell samples are higher than between exosome samples for both miRNA (0.83 vs. 0.80) and piRNA (0.72 vs. 0.61) (two-sided Wilcoxon rank sum test, p
Figure Legend Snippet: Cells and exosomes cluster by their miRNA and piRNA expression profiles. Hierarchical clustering of samples by the Spearman correlation coefficients of (A) miRNA and (B) piRNA expression. Samples cluster by compartment, confirming that cells and exosomes have distinct expression profiles. On average, the correlations between cell samples are higher than between exosome samples for both miRNA (0.83 vs. 0.80) and piRNA (0.72 vs. 0.61) (two-sided Wilcoxon rank sum test, p

Techniques Used: Expressing

Shared miRNA eQTL between cells and exosomes. (A) Table of all miRNAs with an eQTL at FDR ≤ 20% in either cells or exosomes. The four miRNAs that pass the FDR threshold in both cells and exosomes are marked with a dagger and depicted in (B and C). (B and C) Putative shared miRNA eQTLs. The normalized expression levels of the 11 children are shown in cells and exosomes for both products of hsa-miR-151a (B) and hsa-miR-335 (C). The expression values are segregated by their inherited paternal haplotype, denoted as 0 or 1. The maternal haplotypes are not depicted because they did not show a strong association with expression.
Figure Legend Snippet: Shared miRNA eQTL between cells and exosomes. (A) Table of all miRNAs with an eQTL at FDR ≤ 20% in either cells or exosomes. The four miRNAs that pass the FDR threshold in both cells and exosomes are marked with a dagger and depicted in (B and C). (B and C) Putative shared miRNA eQTLs. The normalized expression levels of the 11 children are shown in cells and exosomes for both products of hsa-miR-151a (B) and hsa-miR-335 (C). The expression values are segregated by their inherited paternal haplotype, denoted as 0 or 1. The maternal haplotypes are not depicted because they did not show a strong association with expression.

Techniques Used: Expressing

LCL exosome isolation procedure yields vesicles characteristic of exosomes. (A) Flow diagram of the exosome isolation procedure. All centrifugations were performed at 4°. (B) Transmission electron microscopy of isolated LCL exosomes. Four arrowheads denote isolated examples. Bar, 100 nm. (C) Example NanoSight tracing of LCL exosomes from a representative sample. For that sample, the maximal concentration of exosomes was at 107 nm diameter, as indicated by the dashed line. (D) Western blots of 50 µg total protein lysates from LCLs or their isolated exosomes hybridized with HSP70-specific (left) or calnexin-specific (right) antibodies. Arrowheads indicate expected bands at 70 and 90 kDa, respectively.
Figure Legend Snippet: LCL exosome isolation procedure yields vesicles characteristic of exosomes. (A) Flow diagram of the exosome isolation procedure. All centrifugations were performed at 4°. (B) Transmission electron microscopy of isolated LCL exosomes. Four arrowheads denote isolated examples. Bar, 100 nm. (C) Example NanoSight tracing of LCL exosomes from a representative sample. For that sample, the maximal concentration of exosomes was at 107 nm diameter, as indicated by the dashed line. (D) Western blots of 50 µg total protein lysates from LCLs or their isolated exosomes hybridized with HSP70-specific (left) or calnexin-specific (right) antibodies. Arrowheads indicate expected bands at 70 and 90 kDa, respectively.

Techniques Used: Isolation, Flow Cytometry, Transmission Assay, Electron Microscopy, Concentration Assay, Western Blot

Cells and exosomes differ in their small RNA profiles. (A) Small RNA composition of cells and exosomes averaged over the 17 individuals. Error bars show the SD. Paired two-sided t -tests were used to compare the cell and exosome proportions for each miRNA type and the p -values for the six tests were corrected by the Bonferroni method. Asterisks denote the significance of the corrected p -values: *** p
Figure Legend Snippet: Cells and exosomes differ in their small RNA profiles. (A) Small RNA composition of cells and exosomes averaged over the 17 individuals. Error bars show the SD. Paired two-sided t -tests were used to compare the cell and exosome proportions for each miRNA type and the p -values for the six tests were corrected by the Bonferroni method. Asterisks denote the significance of the corrected p -values: *** p

Techniques Used:

32) Product Images from "A highly robust and optimized sequence-based approach for genetic polymorphism discovery and genotyping in large plant populations"

Article Title: A highly robust and optimized sequence-based approach for genetic polymorphism discovery and genotyping in large plant populations

Journal: TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik

doi: 10.1007/s00122-016-2736-9

Workflow of modified RAD-seq library construction. a shearing the cellular DNA into fragments, b ligating the adapters to fragment ends, c pooling of samples and fragment size selection, d second round of digestion to remove the DNA fragments from rRNA genes and chloroplast sequence, e PCR amplification, f second round of fragment size selection
Figure Legend Snippet: Workflow of modified RAD-seq library construction. a shearing the cellular DNA into fragments, b ligating the adapters to fragment ends, c pooling of samples and fragment size selection, d second round of digestion to remove the DNA fragments from rRNA genes and chloroplast sequence, e PCR amplification, f second round of fragment size selection

Techniques Used: Modification, Selection, Sequencing, Polymerase Chain Reaction, Amplification

33) Product Images from "High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases"

Article Title: High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Journal: RNA

doi: 10.1261/rna.054809.115

Other classes of small noncoding RNAs identified as full-length mature transcripts in human plasma by TGIRT-seq. ( A ) IGV screen shots showing coverage plots (CP; above ) and alignments ( below ) of reads mapping to small ncRNAs loci in RNA-seq data sets
Figure Legend Snippet: Other classes of small noncoding RNAs identified as full-length mature transcripts in human plasma by TGIRT-seq. ( A ) IGV screen shots showing coverage plots (CP; above ) and alignments ( below ) of reads mapping to small ncRNAs loci in RNA-seq data sets

Techniques Used: RNA Sequencing Assay

Percentage of TGIRT-seq reads from total plasma RNA data sets mapping to different categories of genomic features. RNA-seq data sets were constructed by using TeI4c RT for total plasma RNA prepared by the Direct-zol method and either not treated (NT;
Figure Legend Snippet: Percentage of TGIRT-seq reads from total plasma RNA data sets mapping to different categories of genomic features. RNA-seq data sets were constructed by using TeI4c RT for total plasma RNA prepared by the Direct-zol method and either not treated (NT;

Techniques Used: RNA Sequencing Assay, Construct

TGIRT-seq of plasma RNA samples
Figure Legend Snippet: TGIRT-seq of plasma RNA samples

Techniques Used:

Tissue expression profiles for mature miRNAs in plasma. The figure shows tissue expression profiles of the mature miRNAs identified by TGIRT-Seq in total plasma RNA prepared by the Direct-zol method with on-column DNase I treatment (OCD; combined DS7–10).
Figure Legend Snippet: Tissue expression profiles for mature miRNAs in plasma. The figure shows tissue expression profiles of the mature miRNAs identified by TGIRT-Seq in total plasma RNA prepared by the Direct-zol method with on-column DNase I treatment (OCD; combined DS7–10).

Techniques Used: Expressing

Human plasma RNA is enriched in intron and antisense sequences compared with whole-cell RNAs. Reads mapping to protein-coding genes were analyzed to assess coverage across different regions and both DNA strands in RNA-seq data sets constructed with TGIRT
Figure Legend Snippet: Human plasma RNA is enriched in intron and antisense sequences compared with whole-cell RNAs. Reads mapping to protein-coding genes were analyzed to assess coverage across different regions and both DNA strands in RNA-seq data sets constructed with TGIRT

Techniques Used: RNA Sequencing Assay, Construct

TGIRT-seq overview. ( A ) RNA-seq library construction via TGIRT template-switching. TGIRT template-switching reverse transcription reactions use an initial template–primer substrate comprised of an RNA oligonucleotide, which contains an Illumina
Figure Legend Snippet: TGIRT-seq overview. ( A ) RNA-seq library construction via TGIRT template-switching. TGIRT template-switching reverse transcription reactions use an initial template–primer substrate comprised of an RNA oligonucleotide, which contains an Illumina

Techniques Used: RNA Sequencing Assay

TGIRT-seq identifies full-length mature tRNAs and tRNA fragments in human plasma. ( A ) Relative abundance of tRNAs identified in RNA-seq data sets constructed with TeI4c RT for total plasma RNA prepared by the Direct-zol method without (NT; combined DS1–3)
Figure Legend Snippet: TGIRT-seq identifies full-length mature tRNAs and tRNA fragments in human plasma. ( A ) Relative abundance of tRNAs identified in RNA-seq data sets constructed with TeI4c RT for total plasma RNA prepared by the Direct-zol method without (NT; combined DS1–3)

Techniques Used: RNA Sequencing Assay, Construct

34) Product Images from "RNA degradation by the plant RNA exosome involves both phosphorolytic and hydrolytic activities"

Article Title: RNA degradation by the plant RNA exosome involves both phosphorolytic and hydrolytic activities

Journal: Nature Communications

doi: 10.1038/s41467-017-02066-2

Exo9 activity is involved in processing or degradation of 5.8S rRNA precursors. a High density mapping of 5.8S rRNA precursors by 3′RACE-seq. Density profiles of 5.8S rRNA precursors degradation intermediates are shown for positions +4 to +28, +1 corresponding to the first nucleotide after the mature 5.8S rRNA (see Supplementary Fig. 5 ). Two replicates are shown in black and orange. The presence of the endogenous RRP41 or the complementation of the rrp41 mutations by RRP41 WT or RRP41 Pi-Cat- , respectively, is indicated at the top of the panels. The Col-0, rrp6L2 , RRP44KD rrp6L2 , or mtr4 genetic background is indicated on the left. Numbering of each panel refers to the lane numbers of the northern blot shown in c . b Diagram of the 5.8S rRNA processing intermediates. Numbers refer to the transcription start site. Vertical arrows above the diagram indicate endonucleolytic processing sites. Key steps leading to the maturation of the 5.8S rRNA are sketched below. The location of the hybridization oligonucleotides O5 and O6 is shown by a magenta arrow. The location of the oligonucleotides used for 3´RACE-seq is shown by blue arrows. O2 was used to map mature 5.8S rRNA mature ends (Supplementary Fig. 5 ), O3 to map 3′ ends of 5.8S rRNA precursors in a . c Northern blot analysis of the accumulation of 5.8S rRNA precursors and mature 5.8S rRNA upon inactivation of Exo9’s activity. A portion of the ethidium bromide (Etbr)-stained gel is used as loading control. Lane numbers refer to the panels in a
Figure Legend Snippet: Exo9 activity is involved in processing or degradation of 5.8S rRNA precursors. a High density mapping of 5.8S rRNA precursors by 3′RACE-seq. Density profiles of 5.8S rRNA precursors degradation intermediates are shown for positions +4 to +28, +1 corresponding to the first nucleotide after the mature 5.8S rRNA (see Supplementary Fig. 5 ). Two replicates are shown in black and orange. The presence of the endogenous RRP41 or the complementation of the rrp41 mutations by RRP41 WT or RRP41 Pi-Cat- , respectively, is indicated at the top of the panels. The Col-0, rrp6L2 , RRP44KD rrp6L2 , or mtr4 genetic background is indicated on the left. Numbering of each panel refers to the lane numbers of the northern blot shown in c . b Diagram of the 5.8S rRNA processing intermediates. Numbers refer to the transcription start site. Vertical arrows above the diagram indicate endonucleolytic processing sites. Key steps leading to the maturation of the 5.8S rRNA are sketched below. The location of the hybridization oligonucleotides O5 and O6 is shown by a magenta arrow. The location of the oligonucleotides used for 3´RACE-seq is shown by blue arrows. O2 was used to map mature 5.8S rRNA mature ends (Supplementary Fig. 5 ), O3 to map 3′ ends of 5.8S rRNA precursors in a . c Northern blot analysis of the accumulation of 5.8S rRNA precursors and mature 5.8S rRNA upon inactivation of Exo9’s activity. A portion of the ethidium bromide (Etbr)-stained gel is used as loading control. Lane numbers refer to the panels in a

Techniques Used: Activity Assay, Northern Blot, Hybridization, Staining

Exo9 activity participates in the elimination of rRNA maturation by-products. a Diagram of the 5′ ETS and its degradation intermediates. A portion of the 35S rRNA precursor comprising the 5′ ETS is drawn at the top. Numbers refer to the transcription start site. Vertical arrows above the diagram indicate processing sites. Key steps leading to the elimination of the 5′ ETS are sketched below. The location of the hybridization oligonucleotide O4 used for Northern analysis is shown by a magenta arrow. The location of the oligonucleotide O1 used for 3’RACE-seq is shown by a blue arrow. b Northern blot analysis of Exo9’s specific in vivo substrates during the elimination of the 5′ ETS. The main 5′ ETS degradation intermediates are noted as P-P’ and P-P1 on the right. Two exposures of the lower part of the blot are shown. A portion of the Ethidium bromide (Etbr)-stained gel is used as control for loading. Lane numbers at the bottom refer to the panels shown in c – f . c – f High density mapping of 3′ extremities of P-P1 degradation intermediates by 3´RACE-Seq. Density profiles are shown for positions +140 to +200, +1 corresponding to the first nucleotide of the P-P’ fragment. Two biological replicates are shown in black and orange, respectively. The presence of endogenous RRP41 or the complementation of the rrp41 mutations by RRP41 WT or RRP41 Pi-Cat- , respectively, is indicated at the top of the panels. The Col-0, rrp6L2 , RRP44KD rrp6L2 or mtr4 genetic backgrounds are indicated on the left in c , d , e , and f , respectively. Numbering of each panel refers to the lane numbers of the northern blot shown in b
Figure Legend Snippet: Exo9 activity participates in the elimination of rRNA maturation by-products. a Diagram of the 5′ ETS and its degradation intermediates. A portion of the 35S rRNA precursor comprising the 5′ ETS is drawn at the top. Numbers refer to the transcription start site. Vertical arrows above the diagram indicate processing sites. Key steps leading to the elimination of the 5′ ETS are sketched below. The location of the hybridization oligonucleotide O4 used for Northern analysis is shown by a magenta arrow. The location of the oligonucleotide O1 used for 3’RACE-seq is shown by a blue arrow. b Northern blot analysis of Exo9’s specific in vivo substrates during the elimination of the 5′ ETS. The main 5′ ETS degradation intermediates are noted as P-P’ and P-P1 on the right. Two exposures of the lower part of the blot are shown. A portion of the Ethidium bromide (Etbr)-stained gel is used as control for loading. Lane numbers at the bottom refer to the panels shown in c – f . c – f High density mapping of 3′ extremities of P-P1 degradation intermediates by 3´RACE-Seq. Density profiles are shown for positions +140 to +200, +1 corresponding to the first nucleotide of the P-P’ fragment. Two biological replicates are shown in black and orange, respectively. The presence of endogenous RRP41 or the complementation of the rrp41 mutations by RRP41 WT or RRP41 Pi-Cat- , respectively, is indicated at the top of the panels. The Col-0, rrp6L2 , RRP44KD rrp6L2 or mtr4 genetic backgrounds are indicated on the left in c , d , e , and f , respectively. Numbering of each panel refers to the lane numbers of the northern blot shown in b

Techniques Used: Activity Assay, Hybridization, Northern Blot, In Vivo, Staining

35) Product Images from "Systematic comparison of small RNA library preparation protocols for next-generation sequencing"

Article Title: Systematic comparison of small RNA library preparation protocols for next-generation sequencing

Journal: BMC Genomics

doi: 10.1186/s12864-018-4491-6

a Predicted secondary structures of the synthetic sRNAs 1–6 used in this study ( Methods ). The free energies at 28 °C are indicated for each sRNA without or with 2’ OMe. Nucleotide substitutions introduced to distinguish between the unmodified RNAs (RNA1–6) and the 2’OMe variants (RNA-OMe1–6) are indicated in red. These nucleotide substitutions did not alter the predicted secondary structures. The absence or presence of 2’ OMe modification is indicated by “-”or “+” signs, respectively. b Predicted secondary structures of RNAs1–6 ligated with the Illumina 3′ adapter. The ligation junctions are indicated by green arrows. c Predicted secondary structures of RNAs1–6 ligated with both the Illumina 3′ and 5′ adapter. The 3′ ligation junctions are indicated by green arrows, the 5′ ligation junctions are indicated by red arrows. Note that for 3′ adapter ligation the structures in ( b ) should be considered and for subsequent 5′ adapter ligation the structures in ( c )
Figure Legend Snippet: a Predicted secondary structures of the synthetic sRNAs 1–6 used in this study ( Methods ). The free energies at 28 °C are indicated for each sRNA without or with 2’ OMe. Nucleotide substitutions introduced to distinguish between the unmodified RNAs (RNA1–6) and the 2’OMe variants (RNA-OMe1–6) are indicated in red. These nucleotide substitutions did not alter the predicted secondary structures. The absence or presence of 2’ OMe modification is indicated by “-”or “+” signs, respectively. b Predicted secondary structures of RNAs1–6 ligated with the Illumina 3′ adapter. The ligation junctions are indicated by green arrows. c Predicted secondary structures of RNAs1–6 ligated with both the Illumina 3′ and 5′ adapter. The 3′ ligation junctions are indicated by green arrows, the 5′ ligation junctions are indicated by red arrows. Note that for 3′ adapter ligation the structures in ( b ) should be considered and for subsequent 5′ adapter ligation the structures in ( c )

Techniques Used: Modification, Ligation

36) Product Images from "The draft genome sequence of cork oak"

Article Title: The draft genome sequence of cork oak

Journal: Scientific Data

doi: 10.1038/sdata.2018.69

Illumina DNA sequence data pre-processing workflow. The pipeline included removal of low quality reads, as well as reads containing adapter sequences and undetermined nucleotides. The reads that remained were subsequently mapped to a set of chloroplast and mitochondrion genomes to remove the reads derived from these plastid genomes.
Figure Legend Snippet: Illumina DNA sequence data pre-processing workflow. The pipeline included removal of low quality reads, as well as reads containing adapter sequences and undetermined nucleotides. The reads that remained were subsequently mapped to a set of chloroplast and mitochondrion genomes to remove the reads derived from these plastid genomes.

Techniques Used: Sequencing, Derivative Assay

37) Product Images from "MicroRNA transcriptome analysis of porcine vital organ responses to immunosuppressive porcine cytomegalovirus infection"

Article Title: MicroRNA transcriptome analysis of porcine vital organ responses to immunosuppressive porcine cytomegalovirus infection

Journal: Virology Journal

doi: 10.1186/s12985-018-0922-x

Scatter plot of the high-throughput sequencing data. a – e The scatter plot shows the variations in miRNA expression profiles between PCMV-infected and uninfected lung, liver, spleen, kidney and thymus. The default fold change value is 2.0 (top and bottom green lines)
Figure Legend Snippet: Scatter plot of the high-throughput sequencing data. a – e The scatter plot shows the variations in miRNA expression profiles between PCMV-infected and uninfected lung, liver, spleen, kidney and thymus. The default fold change value is 2.0 (top and bottom green lines)

Techniques Used: Next-Generation Sequencing, Expressing, Infection

GO annotation of target genes of DE miRNAs. GO functional analysis indicating the regulatory role of DE miRNAs in different organs during PCMV infection. a – e Target genes of DE miRNAs in PCMV-infected lung, liver, spleen, kidney and thymus
Figure Legend Snippet: GO annotation of target genes of DE miRNAs. GO functional analysis indicating the regulatory role of DE miRNAs in different organs during PCMV infection. a – e Target genes of DE miRNAs in PCMV-infected lung, liver, spleen, kidney and thymus

Techniques Used: Functional Assay, Infection

DE miRNAs between uninfected and PCMV-infected tissue samples. a – e Venn diagrams of the distribution of miRNAs between uninfected and PCMV-infected lung, liver, spleen, kidney and thymus samples. In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls ( p
Figure Legend Snippet: DE miRNAs between uninfected and PCMV-infected tissue samples. a – e Venn diagrams of the distribution of miRNAs between uninfected and PCMV-infected lung, liver, spleen, kidney and thymus samples. In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls ( p

Techniques Used: Infection

Heat map and hierarchical clustering of the miRNA high-throughput sequencing data. Heat map of the expression level of miRNAs in PCMV-infected and uninfected lung, thymus, kidney, spleen and liver samples. A red line indicates a higher expression level and a blue line indicates a lower expression level
Figure Legend Snippet: Heat map and hierarchical clustering of the miRNA high-throughput sequencing data. Heat map of the expression level of miRNAs in PCMV-infected and uninfected lung, thymus, kidney, spleen and liver samples. A red line indicates a higher expression level and a blue line indicates a lower expression level

Techniques Used: Next-Generation Sequencing, Expressing, Infection

38) Product Images from "MicroRNA transcriptome analysis of porcine vital organ responses to immunosuppressive porcine cytomegalovirus infection"

Article Title: MicroRNA transcriptome analysis of porcine vital organ responses to immunosuppressive porcine cytomegalovirus infection

Journal: Virology Journal

doi: 10.1186/s12985-018-0922-x

Scatter plot of the high-throughput sequencing data. a – e The scatter plot shows the variations in miRNA expression profiles between PCMV-infected and uninfected lung, liver, spleen, kidney and thymus. The default fold change value is 2.0 (top and bottom green lines)
Figure Legend Snippet: Scatter plot of the high-throughput sequencing data. a – e The scatter plot shows the variations in miRNA expression profiles between PCMV-infected and uninfected lung, liver, spleen, kidney and thymus. The default fold change value is 2.0 (top and bottom green lines)

Techniques Used: Next-Generation Sequencing, Expressing, Infection

GO annotation of target genes of DE miRNAs. GO functional analysis indicating the regulatory role of DE miRNAs in different organs during PCMV infection. a – e Target genes of DE miRNAs in PCMV-infected lung, liver, spleen, kidney and thymus
Figure Legend Snippet: GO annotation of target genes of DE miRNAs. GO functional analysis indicating the regulatory role of DE miRNAs in different organs during PCMV infection. a – e Target genes of DE miRNAs in PCMV-infected lung, liver, spleen, kidney and thymus

Techniques Used: Functional Assay, Infection

DE miRNAs between uninfected and PCMV-infected tissue samples. a – e Venn diagrams of the distribution of miRNAs between uninfected and PCMV-infected lung, liver, spleen, kidney and thymus samples. In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls ( p
Figure Legend Snippet: DE miRNAs between uninfected and PCMV-infected tissue samples. a – e Venn diagrams of the distribution of miRNAs between uninfected and PCMV-infected lung, liver, spleen, kidney and thymus samples. In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls ( p

Techniques Used: Infection

Heat map and hierarchical clustering of the miRNA high-throughput sequencing data. Heat map of the expression level of miRNAs in PCMV-infected and uninfected lung, thymus, kidney, spleen and liver samples. A red line indicates a higher expression level and a blue line indicates a lower expression level
Figure Legend Snippet: Heat map and hierarchical clustering of the miRNA high-throughput sequencing data. Heat map of the expression level of miRNAs in PCMV-infected and uninfected lung, thymus, kidney, spleen and liver samples. A red line indicates a higher expression level and a blue line indicates a lower expression level

Techniques Used: Next-Generation Sequencing, Expressing, Infection

39) Product Images from "Cost-effective, high-throughput, single-haplotype iterative mapping and sequencing for complex genomic structures"

Article Title: Cost-effective, high-throughput, single-haplotype iterative mapping and sequencing for complex genomic structures

Journal: Nature protocols

doi: 10.1038/nprot.2018.019

Overview of SHIMS 2.0 protocol. A timeline of a single iteration of the SHIMS 2.0 protocol, showing the major protocol steps, with key quality controls on the right. During a single week-long iteration, 192 clones are processed in parallel, and the resulting draft clone sequences are used to identify sequence family variants (SFVs) that distinguish paralogous ampliconic sequences. A single technician can proceed from a list of clones to completed Illumina libraries in 5 days. After a 2-day long MiSeq run, a bioinformatics specialist assembles demultiplexed fastq sequences into draft clone assemblies and identifies SFVs to select clones for the next iteration.
Figure Legend Snippet: Overview of SHIMS 2.0 protocol. A timeline of a single iteration of the SHIMS 2.0 protocol, showing the major protocol steps, with key quality controls on the right. During a single week-long iteration, 192 clones are processed in parallel, and the resulting draft clone sequences are used to identify sequence family variants (SFVs) that distinguish paralogous ampliconic sequences. A single technician can proceed from a list of clones to completed Illumina libraries in 5 days. After a 2-day long MiSeq run, a bioinformatics specialist assembles demultiplexed fastq sequences into draft clone assemblies and identifies SFVs to select clones for the next iteration.

Techniques Used: Clone Assay, Sequencing

40) Product Images from "Global transcriptional analysis of Burkholderia pseudomallei high and low biofilm producers reveals insights into biofilm production and virulence"

Article Title: Global transcriptional analysis of Burkholderia pseudomallei high and low biofilm producers reveals insights into biofilm production and virulence

Journal: BMC Genomics

doi: 10.1186/s12864-015-1692-0

The B. pseudomallei high biofilm producer, UM5, also results in faster killing kinetics and over-expression of biofilm-associated genes compared to a second low biofilm producing isolate, UM2. a Biofilm index of UM2 and UM5. b qRT-PCR analysis of B. pseudomallei genes from seven functional categories differentially expressed by RNA-Seq analysis. The results are from a representative of three reproducible independent experiments. c Killing assay of C. elegans infected with UM2 (black line, closed square), UM5 (black line, closed triangle) and B. thailandensis (black line, open square). The graph shows the mean ± SD of three replicates (30 worms/replicate) from a representative of two independent experiments. d Mice (n = 5) were challenged intraperitonealy with a lethal dose of B. pseudomallei UM5 (triangle) or UM2 (square) and their survival was monitored. Mice challenged with UM5 succumbed to disease significantly faster (within 24 h) than those challenged with UM2 [Logrank (Mantel-Cox) test, p -value = 0.0084]
Figure Legend Snippet: The B. pseudomallei high biofilm producer, UM5, also results in faster killing kinetics and over-expression of biofilm-associated genes compared to a second low biofilm producing isolate, UM2. a Biofilm index of UM2 and UM5. b qRT-PCR analysis of B. pseudomallei genes from seven functional categories differentially expressed by RNA-Seq analysis. The results are from a representative of three reproducible independent experiments. c Killing assay of C. elegans infected with UM2 (black line, closed square), UM5 (black line, closed triangle) and B. thailandensis (black line, open square). The graph shows the mean ± SD of three replicates (30 worms/replicate) from a representative of two independent experiments. d Mice (n = 5) were challenged intraperitonealy with a lethal dose of B. pseudomallei UM5 (triangle) or UM2 (square) and their survival was monitored. Mice challenged with UM5 succumbed to disease significantly faster (within 24 h) than those challenged with UM2 [Logrank (Mantel-Cox) test, p -value = 0.0084]

Techniques Used: Over Expression, Quantitative RT-PCR, Functional Assay, RNA Sequencing Assay, Infection, Mouse Assay

B. pseudomallei biofilm development transcriptome profile. a Expression profiles of modulated-genes according to functional categories. Transcript expression of log 2 fold level are depicted by the histogram. The height of the bars correspond to the degree of expression level. Red and green bars represent up-and down-regulation in relative expression levels, respectively. b qRT-PCR analysis of eleven B. pseudomallei genes from seven functional categories differentially expressed as determined by RNA-Seq. The results are from a representative of three reproducible independent experiments
Figure Legend Snippet: B. pseudomallei biofilm development transcriptome profile. a Expression profiles of modulated-genes according to functional categories. Transcript expression of log 2 fold level are depicted by the histogram. The height of the bars correspond to the degree of expression level. Red and green bars represent up-and down-regulation in relative expression levels, respectively. b qRT-PCR analysis of eleven B. pseudomallei genes from seven functional categories differentially expressed as determined by RNA-Seq. The results are from a representative of three reproducible independent experiments

Techniques Used: Expressing, Functional Assay, Quantitative RT-PCR, RNA Sequencing Assay

Related Articles

Sample Prep:

Article Title: Identification of piggyBac-mediated insertions in Plasmodium berghei by next generation sequencing
Article Snippet: .. A PCR-free paired-end sequencing library with the 300 bp average length of DNA fragments (ranging from 200 to 400 bp) was prepared from ~10 μg total DNA using Illumina’s sample preparation kit, and sequenced with a paired-end module. ..

Infection:

Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs
Article Snippet: .. When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ). ..

Adsorption:

Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs
Article Snippet: .. When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ). ..

Real-time Polymerase Chain Reaction:

Article Title: Detection of novel syntrophic acetate‐oxidizing bacteria from biogas processes by continuous acetate enrichment approaches
Article Snippet: .. A combination of molecular methods, including Illumina sequencing of 16S rRNA genes, quantitative polymerase chain reaction (qPCR) and terminal restriction fragment length polymorphism (T‐RFLP) analysis, was used to identify microbial structure patterns over time and to quantify abundant species. ..

Polymerase Chain Reaction:

Article Title: Identification of piggyBac-mediated insertions in Plasmodium berghei by next generation sequencing
Article Snippet: .. A PCR-free paired-end sequencing library with the 300 bp average length of DNA fragments (ranging from 200 to 400 bp) was prepared from ~10 μg total DNA using Illumina’s sample preparation kit, and sequenced with a paired-end module. ..

Article Title: Monitored eCLIP: high accuracy mapping of RNA-protein interactions
Article Snippet: .. To sort the reads into the categories of short and long cDNA fragments, we used cutadapt after PCR duplicate removal with the following options: cutadapt -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG –m 20 –untrimmed-output = my_sample_long_fragments.fastq my_sample.fastq > my_sample_short_fragments.fastq Untrimmed reads correspond to long fragments that were not fully sequenced and thus lack the Illumina 3′ end adapter. ..

other:

Article Title: Dynamic transition of chemolithotrophic sulfur-oxidizing bacteria in response to amendment with nitrate in deposited marine sediments
Article Snippet: In addition, the libraries of 16S rRNA genes were located far from those of the transcripts, implying that only selected members of the microbial communities expressed 16S rRNA.

Article Title: Exploring the bacteriome in anthropophilic ticks: To investigate the vectors for diagnosis
Article Snippet: Variations in techniques, target regions of the 16S rRNA gene, reference taxonomic databases or source of tick samples may hinder comparisons.

Activity Assay:

Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs
Article Snippet: .. When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ). ..

Terminal Restriction Fragment Length Polymorphism:

Article Title: Detection of novel syntrophic acetate‐oxidizing bacteria from biogas processes by continuous acetate enrichment approaches
Article Snippet: .. A combination of molecular methods, including Illumina sequencing of 16S rRNA genes, quantitative polymerase chain reaction (qPCR) and terminal restriction fragment length polymorphism (T‐RFLP) analysis, was used to identify microbial structure patterns over time and to quantify abundant species. ..

Sequencing:

Article Title: Identification of piggyBac-mediated insertions in Plasmodium berghei by next generation sequencing
Article Snippet: .. A PCR-free paired-end sequencing library with the 300 bp average length of DNA fragments (ranging from 200 to 400 bp) was prepared from ~10 μg total DNA using Illumina’s sample preparation kit, and sequenced with a paired-end module. ..

Article Title: Detection of novel syntrophic acetate‐oxidizing bacteria from biogas processes by continuous acetate enrichment approaches
Article Snippet: .. A combination of molecular methods, including Illumina sequencing of 16S rRNA genes, quantitative polymerase chain reaction (qPCR) and terminal restriction fragment length polymorphism (T‐RFLP) analysis, was used to identify microbial structure patterns over time and to quantify abundant species. ..

Article Title: Quantitative Interactor Screening with next-generation Sequencing (QIS-Seq) identifies Arabidopsis thaliana MLO2 as a target of the Pseudomonas syringae type III effector HopZ2
Article Snippet: .. Supplementary Material Additional file 1 Illumina sequencing of cDNA libraries and interactors . .. Table showing the prey cDNA library used for the yeast two-hybrid screening, the number of Illumina cycles, the number of quality clusters, and the number of bases for each bait or the cDNA library.

Article Title: The Serum Resistome of a Globally Disseminated Multidrug Resistant Uropathogenic Escherichia coli Clone
Article Snippet: .. This oligonucleotide incorporates the Illumina sequencing primer-binding site into transposon specific DNA fragments, enabling the use of the standard Illumina sequencing primer and eliminating the need to design and optimize another sequencing primer for each new transposon sequence. .. The 6-bp barcode immediately after the sequencing primer-binding site allows 12-sample multiplexing within one lane.

Agarose Gel Electrophoresis:

Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs
Article Snippet: .. When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Illumina Inc hiseq 2000 s pair end sequencing technology
    Hiseq 2000 S Pair End Sequencing Technology, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiseq 2000 s pair end sequencing technology/product/Illumina Inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiseq 2000 s pair end sequencing technology - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    91
    Illumina Inc t4 rna ligase 2 deletion mutant epicentre
    T4 Rna Ligase 2 Deletion Mutant Epicentre, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 deletion mutant epicentre/product/Illumina Inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 deletion mutant epicentre - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    89
    Illumina Inc its2 sequences
    Its2 Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 sequences/product/Illumina Inc
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    its2 sequences - by Bioz Stars, 2020-05
    89/100 stars
      Buy from Supplier

    99
    Illumina Inc miseq reporter software
    Miseq Reporter Software, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/miseq reporter software/product/Illumina Inc
    Average 99 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    miseq reporter software - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results