Structured Review

TaKaRa actin isoforms
Expression of actin <t>isoforms</t> during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.
Actin Isoforms, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/actin isoforms/product/TaKaRa
Average 88 stars, based on 1 article reviews
Price from $9.99 to $1999.99
actin isoforms - by Bioz Stars, 2020-08
88/100 stars

Images

1) Product Images from "The role of actin isoforms in somatic embryogenesis in Norway spruce"

Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

Journal: BMC Plant Biology

doi: 10.1186/1471-2229-10-89

Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.
Figure Legend Snippet: Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.
Figure Legend Snippet: Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.

Techniques Used: Binding Assay, Sequencing

Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.
Figure Legend Snippet: Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.

Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction

Related Articles

Isolation:

Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce
Article Snippet: .. Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA). .. In case of Pa3 isoform, the isolation of missing ends was not successful by any of the methods.

Amplification:

Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce
Article Snippet: .. Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA). .. In case of Pa3 isoform, the isolation of missing ends was not successful by any of the methods.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    TaKaRa actin isoforms
    Expression of actin <t>isoforms</t> during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.
    Actin Isoforms, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/actin isoforms/product/TaKaRa
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    actin isoforms - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    91
    TaKaRa tet inducible constitutive active akt isoforms
    Effect of forced expression of <t>Akt</t> <t>isoforms</t> (CA-Akt) on PRL and IGFBP1 expression. mRNA expression of either PRL (A) IGFBP1 (B) were quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 <t>Tet-On</t> vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline) or cells were allowed to decidualize for 24h before doxycycline was added (cAMP+MPA+Doxycycline 24H). Cells were lysed after three days and qRT-PCR analyses were performed to quantify PRL or IGBP1 expression. β-actin mRNA expression was used as control for qPCR results. (C) Akt 1, Akt2 and Akt3 expression was quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline). Cells were lysed after three days and qRT-PCR analyses were performed to quantify Akt1, Akt2 or Akt3 expression. β-actin mRNA expression was used as control for qPCR results. Data are means ± SEM three independent experiments. Different letters represent significantly different means (p
    Tet Inducible Constitutive Active Akt Isoforms, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet inducible constitutive active akt isoforms/product/TaKaRa
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tet inducible constitutive active akt isoforms - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    TaKaRa active human isoform adar2a
    Effect of forced expression of <t>Akt</t> <t>isoforms</t> (CA-Akt) on PRL and IGFBP1 expression. mRNA expression of either PRL (A) IGFBP1 (B) were quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 <t>Tet-On</t> vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline) or cells were allowed to decidualize for 24h before doxycycline was added (cAMP+MPA+Doxycycline 24H). Cells were lysed after three days and qRT-PCR analyses were performed to quantify PRL or IGBP1 expression. β-actin mRNA expression was used as control for qPCR results. (C) Akt 1, Akt2 and Akt3 expression was quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline). Cells were lysed after three days and qRT-PCR analyses were performed to quantify Akt1, Akt2 or Akt3 expression. β-actin mRNA expression was used as control for qPCR results. Data are means ± SEM three independent experiments. Different letters represent significantly different means (p
    Active Human Isoform Adar2a, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/active human isoform adar2a/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    active human isoform adar2a - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

    Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Binding Assay, Sequencing

    Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of forced expression of Akt isoforms (CA-Akt) on PRL and IGFBP1 expression. mRNA expression of either PRL (A) IGFBP1 (B) were quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline) or cells were allowed to decidualize for 24h before doxycycline was added (cAMP+MPA+Doxycycline 24H). Cells were lysed after three days and qRT-PCR analyses were performed to quantify PRL or IGBP1 expression. β-actin mRNA expression was used as control for qPCR results. (C) Akt 1, Akt2 and Akt3 expression was quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline). Cells were lysed after three days and qRT-PCR analyses were performed to quantify Akt1, Akt2 or Akt3 expression. β-actin mRNA expression was used as control for qPCR results. Data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Journal: PLoS ONE

    Article Title: Regulation of the PI3K/Akt pathway during decidualization of endometrial stromal cells

    doi: 10.1371/journal.pone.0177387

    Figure Lengend Snippet: Effect of forced expression of Akt isoforms (CA-Akt) on PRL and IGFBP1 expression. mRNA expression of either PRL (A) IGFBP1 (B) were quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline) or cells were allowed to decidualize for 24h before doxycycline was added (cAMP+MPA+Doxycycline 24H). Cells were lysed after three days and qRT-PCR analyses were performed to quantify PRL or IGBP1 expression. β-actin mRNA expression was used as control for qPCR results. (C) Akt 1, Akt2 and Akt3 expression was quantified following three days treatments. HIESC cells transfected with either Akt1, Akt2 or Akt3 Tet-On vectors were subjected to decidualization using cAMP (0.5 mM) and MPA (10μM). They were then either concomitantly treated with doxycycline (1μg/mL) in order to induce the expression of the constitutive Akt isoform construct (cAMP+MPA+Doxycycline). Cells were lysed after three days and qRT-PCR analyses were performed to quantify Akt1, Akt2 or Akt3 expression. β-actin mRNA expression was used as control for qPCR results. Data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Article Snippet: Production of HIESC cell lines with Tet-inducible constitutive active Akt isoforms All three myristoylated Akt isoforms were cloned separately into pLVX-Tet3G-puro vector (Clontech) by InFusion Cloning (NEB).

    Techniques: Expressing, Transfection, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    Expression of Akt isoform, total Akt and pAkt during induction of decidualization. Cells were incubated in the presence or absence of cAMP (0.5 mM) and MPA (10μM) for a total of nine days. Total protein and RNA were then extracted. (A) Western blot was performed to quantify the change in specific Akt isoforms levels as well as total Akt levels. pAkt(ser473) was used to assess Akt activation β-actin was used as loading control. (B) Cells were counted after three days in either control media or under cAMP (0.5 mM) and MPA (10μM) treatment to assess the effect of decidualization on proliferation. Trypan blue exclusion dye was used to assess the number of dead cells in the samples. (C) Cells were incubated in the presence of cAMP (0.5 mM) and MPA (10μM) treatment for three days; they were then counted; an equal amount of cells were lysed and subsequently loaded to perform Western blot analysis. Changes in total Akt, specific Akt isoforms as well as phosphorylated Akt (ser473) was quantified. (D) Cells were incubated in the presence of either cAMP (0.5 mM), MPA (10μM) or a combination of both. Cells were lysed after three days and total proteins were extracted. Western blot was performed to quantify the change in total Akt, pAkt(ser473), Par-4 or FoxO1; β-actin was used as loading control. All blots shown are from one representative experiment. All graphics represent Western blot densitometric analysis. All data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Journal: PLoS ONE

    Article Title: Regulation of the PI3K/Akt pathway during decidualization of endometrial stromal cells

    doi: 10.1371/journal.pone.0177387

    Figure Lengend Snippet: Expression of Akt isoform, total Akt and pAkt during induction of decidualization. Cells were incubated in the presence or absence of cAMP (0.5 mM) and MPA (10μM) for a total of nine days. Total protein and RNA were then extracted. (A) Western blot was performed to quantify the change in specific Akt isoforms levels as well as total Akt levels. pAkt(ser473) was used to assess Akt activation β-actin was used as loading control. (B) Cells were counted after three days in either control media or under cAMP (0.5 mM) and MPA (10μM) treatment to assess the effect of decidualization on proliferation. Trypan blue exclusion dye was used to assess the number of dead cells in the samples. (C) Cells were incubated in the presence of cAMP (0.5 mM) and MPA (10μM) treatment for three days; they were then counted; an equal amount of cells were lysed and subsequently loaded to perform Western blot analysis. Changes in total Akt, specific Akt isoforms as well as phosphorylated Akt (ser473) was quantified. (D) Cells were incubated in the presence of either cAMP (0.5 mM), MPA (10μM) or a combination of both. Cells were lysed after three days and total proteins were extracted. Western blot was performed to quantify the change in total Akt, pAkt(ser473), Par-4 or FoxO1; β-actin was used as loading control. All blots shown are from one representative experiment. All graphics represent Western blot densitometric analysis. All data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Article Snippet: Production of HIESC cell lines with Tet-inducible constitutive active Akt isoforms All three myristoylated Akt isoforms were cloned separately into pLVX-Tet3G-puro vector (Clontech) by InFusion Cloning (NEB).

    Techniques: Expressing, Incubation, Western Blot, Activation Assay

    In vitro modulation of PI3K/Akt pathway with the induction of decidualization. Induction of decidualization was induced with cAMP (0.5 mM) and MPA (10μM) for 48h, then MG132 was added and incubated for another 24h. (A) Treatment using Mg132 increased total ubiquitination, both in control conditions and decidualized cells, indicating that the Mg132 was effective at inhibiting proteasomal degradation. (B) Total Akt and pAkt levels were measured by Western blot. (C) Individual Akt isoforms levels were assessed by Western blot. β-actin was used as loading control. Blots shown are from one representative experiment. Graphics represent Western blot densitometric analysis. (D) RT-PCR was performed for each Akt isoforms to evaluate change in mRNA transcription. Data represent means ± SEM for three independent experiments. β-actin was used as an internal control. Image shown are from one representative experiment. Graphics represent densitometric analysis. All data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Journal: PLoS ONE

    Article Title: Regulation of the PI3K/Akt pathway during decidualization of endometrial stromal cells

    doi: 10.1371/journal.pone.0177387

    Figure Lengend Snippet: In vitro modulation of PI3K/Akt pathway with the induction of decidualization. Induction of decidualization was induced with cAMP (0.5 mM) and MPA (10μM) for 48h, then MG132 was added and incubated for another 24h. (A) Treatment using Mg132 increased total ubiquitination, both in control conditions and decidualized cells, indicating that the Mg132 was effective at inhibiting proteasomal degradation. (B) Total Akt and pAkt levels were measured by Western blot. (C) Individual Akt isoforms levels were assessed by Western blot. β-actin was used as loading control. Blots shown are from one representative experiment. Graphics represent Western blot densitometric analysis. (D) RT-PCR was performed for each Akt isoforms to evaluate change in mRNA transcription. Data represent means ± SEM for three independent experiments. β-actin was used as an internal control. Image shown are from one representative experiment. Graphics represent densitometric analysis. All data are means ± SEM three independent experiments. Different letters represent significantly different means (p

    Article Snippet: Production of HIESC cell lines with Tet-inducible constitutive active Akt isoforms All three myristoylated Akt isoforms were cloned separately into pLVX-Tet3G-puro vector (Clontech) by InFusion Cloning (NEB).

    Techniques: In Vitro, Incubation, Western Blot, Reverse Transcription Polymerase Chain Reaction