aconitase 2  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2
    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars

    Images

    1) Product Images from "Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells"

    Article Title: Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells

    Journal: Stem Cells International

    doi: 10.1155/2022/3674931

    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
    Figure Legend Snippet: Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Techniques Used: Expressing, Cell Culture, Western Blot, Produced, Activity Assay, Marker, Standard Deviation

    aconitase 2  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2
    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars

    Images

    1) Product Images from "Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells"

    Article Title: Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells

    Journal: Stem Cells International

    doi: 10.1155/2022/3674931

    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
    Figure Legend Snippet: Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Techniques Used: Expressing, Cell Culture, Western Blot, Produced, Activity Assay, Marker, Standard Deviation

    anti aconitase 2 aco2 antibody  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc anti aconitase 2 aco2 antibody
    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for <t>ACO2</t> and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
    Anti Aconitase 2 Aco2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti aconitase 2 aco2 antibody/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti aconitase 2 aco2 antibody - by Bioz Stars, 2023-03
    93/100 stars

    Images

    1) Product Images from "Breast Cancer Selective Disruption of Actin Cytoskeleton by Diallyl Trisulfide"

    Article Title: Breast Cancer Selective Disruption of Actin Cytoskeleton by Diallyl Trisulfide

    Journal: Journal of Cancer Prevention

    doi: 10.15430/JCP.2022.27.2.101

    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for ACO2 and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
    Figure Legend Snippet: (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for ACO2 and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.

    Techniques Used: Western Blot, Expressing

    anti aconitase 2  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc anti aconitase 2
    Anti Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars

    Images

    5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Cell Signaling Technology Inc 5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase
    5 3 Forward Reverse Aconitase 2 Aco2 Tctctaacaacctgctcatcgg Tcatctccaatcaccacccacc Acyl Coenzyme A Dehydrogenase, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase - by Bioz Stars, 2023-03
    86/100 stars

    Images

    aconitase 2  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Cell Signaling Technology Inc aconitase 2
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    86/100 stars

    Images

    aconitase 2  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars

    Images

    aconitase 2  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2
    Key Resources Table
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars

    Images

    1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"

    Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency

    Journal: Cell chemical biology

    doi: 10.1016/j.chembiol.2017.04.009

    Key Resources Table
    Figure Legend Snippet: Key Resources Table

    Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay

    aconitase 2 aco2 rabbit polyclonal  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2 aco2 rabbit polyclonal
    Key Resources Table
    Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 aco2 rabbit polyclonal - by Bioz Stars, 2023-03
    93/100 stars

    Images

    1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"

    Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency

    Journal: Cell chemical biology

    doi: 10.1016/j.chembiol.2017.04.009

    Key Resources Table
    Figure Legend Snippet: Key Resources Table

    Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay

    aconitase 2 aco2 rabbit polyclonal  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Cell Signaling Technology Inc aconitase 2 aco2 rabbit polyclonal
    Key Resources Table
    Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 aco2 rabbit polyclonal - by Bioz Stars, 2023-03
    86/100 stars

    Images

    1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"

    Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency

    Journal: Cell chemical biology

    doi: 10.1016/j.chembiol.2017.04.009

    Key Resources Table
    Figure Legend Snippet: Key Resources Table

    Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay

    aconitase 2 aco2 rabbit polyclonal  (Cell Signaling Technology Inc)


    Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
    Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc aconitase 2 aco2 rabbit polyclonal
    Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 aco2 rabbit polyclonal - by Bioz Stars, 2023-03
    93/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Cell Signaling Technology Inc aconitase 2
    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
    Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc anti aconitase 2 aco2 antibody
    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for <t>ACO2</t> and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
    Anti Aconitase 2 Aco2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti aconitase 2 aco2 antibody/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti aconitase 2 aco2 antibody - by Bioz Stars, 2023-03
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc anti aconitase 2
    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for <t>ACO2</t> and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
    Anti Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti aconitase 2/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti aconitase 2 - by Bioz Stars, 2023-03
    93/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc 5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase
    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for <t>ACO2</t> and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
    5 3 Forward Reverse Aconitase 2 Aco2 Tctctaacaacctgctcatcgg Tcatctccaatcaccacccacc Acyl Coenzyme A Dehydrogenase, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase - by Bioz Stars, 2023-03
    86/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc aconitase 2 aco2 rabbit polyclonal
    Key Resources Table
    Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aconitase 2 aco2 rabbit polyclonal - by Bioz Stars, 2023-03
    93/100 stars
      Buy from Supplier

    Image Search Results


    Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table  . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Journal: Stem Cells International

    Article Title: Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells

    doi: 10.1155/2022/3674931

    Figure Lengend Snippet: Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Article Snippet: Subsequently, the membranes were incubated overnight at 4°C in a primary antibody against hypoxia-inducible factor 1-alpha (HIF-1 α ), cytochrome c, prohibitin 1, cytochrome c oxidase subunit 4 (COX IV), pyruvate dehydrogenase, succinate dehydrogenase complex subunit A (SDHA), heat shock protein 60 (HSP60), voltage-dependent anion channel (VDAC), hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, lactate dehydrogenase A, aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, mitochondrial pyruvate carrier 2, acetyl-CoA carboxylase, phospho-acetyl-CoA carboxylase (Ser79), ATP-citrate lyase, phospho-ATP-citrate lyase (Ser455), acetyl-CoA synthetase, acyl-CoA synthetase, fatty acid synthase (all Cell Signaling Technology, Danvers, MA, USA), or elongation of very long chain fatty acids protein 6 (ELOVL6) (Abcam, Cambridge, UK).

    Techniques: Expressing, Cell Culture, Western Blot, Produced, Activity Assay, Marker, Standard Deviation

    (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for ACO2 and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.

    Journal: Journal of Cancer Prevention

    Article Title: Breast Cancer Selective Disruption of Actin Cytoskeleton by Diallyl Trisulfide

    doi: 10.15430/JCP.2022.27.2.101

    Figure Lengend Snippet: (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for ACO2 and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.

    Article Snippet: Anti-aconitase 2 (ACO2) antibody and anti-dihydrolipoamide S-succinyltransferase (DLST) antibody were from Cell Signaling Technology (Danvers, MA, USA).

    Techniques: Western Blot, Expressing

    Key Resources Table

    Journal: Cell chemical biology

    Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency

    doi: 10.1016/j.chembiol.2017.04.009

    Figure Lengend Snippet: Key Resources Table

    Article Snippet: Primary antibodies used include: ACSF3 rabbit polyclonal at 1:1000 (ThermoFisher PA5-25803), heat shock chaperone 70 (HSC70) mouse monoclonal at 1:1000 (Santa Cruz sc-7298), MitoProfile total OXPHOS mouse monoclonal antibody cocktail at 1:500 (Abcam ab110413), voltage-dependent anion channel 1 (VDAC1) rabbit polyclonal at 1:1000 (Calbiochem AB10527), aconitase 2 (ACO2) rabbit polyclonal at 1:1000 (Cell Signaling 6922), α-lipoic acid rabbit polyclonal at 1:1000 (Calbiochem #437695), phospho-ACC (Ser79) rabbit polyclonal at 1:1000 (Cell Signaling 11818), total ACC rabbit polyclonal at 1:1000 (Cell Signaling 3676), malonyl-lysine rabbit monoclonal mix at 1:1000 (Cell Signaling 14942), acetyl-lysine rabbit polyclonal at 1:1000 (Cell Signaling 9441), succinyl-lysine rabbit polyclonal at 1:1000 (PTM Biolabs 401), GFP mouse monoclonal at 1:1000 (Santa Cruz sc-9996).

    Techniques: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay