aconitase 2 (Cell Signaling Technology Inc)


Structured Review

Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells"
Article Title: Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells
Journal: Stem Cells International
doi: 10.1155/2022/3674931

Figure Legend Snippet: Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
Techniques Used: Expressing, Cell Culture, Western Blot, Produced, Activity Assay, Marker, Standard Deviation
aconitase 2 (Cell Signaling Technology Inc)


Structured Review

Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells"
Article Title: Energy Metabolism and Lipidome Are Highly Regulated during Osteogenic Differentiation of Dental Follicle Cells
Journal: Stem Cells International
doi: 10.1155/2022/3674931

Figure Legend Snippet: Expression of glycolysis and citric acid cycle markers during osteogenic differentiation of DFCs. (a) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for one, seven, 14, and 28 days before protein expression of the glycolysis markers hexokinase I, hexokinase II, phosphofructokinase, glycerinaldehyd-3-phosphat-dehydrogenase (GAPDH), pyruvate kinase M1/2, pyruvate kinase M2, and lactate dehydrogenase A, and protein expression of the citric acid cycle markers aconitase 2, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, dihydrolipoamide succinyltransferase (DLST), fumarase, citrase synthase, mitochondrial pyruvate carrier 1, and mitochondrial pyruvate carrier 2 were determined by western blot analysis. Quantification results and statistical analysis are shown in the Supplementary Table . (b–d) DFCs were cultured in osteogenic differentiation medium (ODM), BMP2 differentiation medium, or control medium (DMEM) for seven days before the amount of produced L-lactate (b) and hexokinase activity (c) were determined as markers of glycolysis and malate dehydrogenase activity was measured (d) as marker of citric acid cycle. Results are shown as means + standard deviation, and Student's t -test was performed to compare differentiation medium with control medium. ∗∗ p < 0.01, ∗∗∗ p < 0.001.
Techniques Used: Expressing, Cell Culture, Western Blot, Produced, Activity Assay, Marker, Standard Deviation
anti aconitase 2 aco2 antibody (Cell Signaling Technology Inc)


Structured Review

Anti Aconitase 2 Aco2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti aconitase 2 aco2 antibody/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "Breast Cancer Selective Disruption of Actin Cytoskeleton by Diallyl Trisulfide"
Article Title: Breast Cancer Selective Disruption of Actin Cytoskeleton by Diallyl Trisulfide
Journal: Journal of Cancer Prevention
doi: 10.15430/JCP.2022.27.2.101

Figure Legend Snippet: (A) Reactome pathway enrichment analysis of downregulated genes by DATS treatment in MCF-10A and SK-BR-3 cell lines. (B) Immunoblot analysis for ACO2 and DLST in MCF-10A and SK-BR-3 cells treated with DMSO (control) or indicated doses of DATS for specified time points. The numbers above bands represent fold change in expression relative to corresponding DMSO-treated controls. (C) Quantification of ACO2 and DLST expression in SK-BR-3 cells. Results combined from three independent experiments are shown as mean ± SD (n = 3) and statistical analysis was done by one-way ANOVA followed by Dunnett’s test. DATS, diallyl trisulfide; DMSO, dimethyl sulfoxide, DLST, dihydrolipoamide S-succinyltransferase; ACO2, aconitase 2; HDR, Homology directed repair; ATR, ataxia telangiectasia and Rad3 related; AP, abasic sites; PCNA, proliferating cell nuclear antigen.
Techniques Used: Western Blot, Expressing
anti aconitase 2 (Cell Signaling Technology Inc)


Structured Review
Anti Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase (Cell Signaling Technology Inc)


Structured Review
5 3 Forward Reverse Aconitase 2 Aco2 Tctctaacaacctgctcatcgg Tcatctccaatcaccacccacc Acyl Coenzyme A Dehydrogenase, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5 3 forward reverse aconitase 2 aco2 tctctaacaacctgctcatcgg tcatctccaatcaccacccacc acyl coenzyme a dehydrogenase/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
aconitase 2 (Cell Signaling Technology Inc)


Structured Review
Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
aconitase 2 (Cell Signaling Technology Inc)


Structured Review
Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
aconitase 2 (Cell Signaling Technology Inc)


Structured Review

Aconitase 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"
Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency
Journal: Cell chemical biology
doi: 10.1016/j.chembiol.2017.04.009

Figure Legend Snippet: Key Resources Table
Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay
aconitase 2 aco2 rabbit polyclonal (Cell Signaling Technology Inc)


Structured Review

Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"
Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency
Journal: Cell chemical biology
doi: 10.1016/j.chembiol.2017.04.009

Figure Legend Snippet: Key Resources Table
Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay
aconitase 2 aco2 rabbit polyclonal (Cell Signaling Technology Inc)


Structured Review

Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Images
1) Product Images from "The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency"
Article Title: The Mammalian Malonyl-CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency
Journal: Cell chemical biology
doi: 10.1016/j.chembiol.2017.04.009

Figure Legend Snippet: Key Resources Table
Techniques Used: Magnetic Beads, Recombinant, Proliferation Assay, XF Assay, CyQUANT Assay, Activity Assay, Expressing, Plasmid Preparation, Transfection, Clone Assay
aconitase 2 aco2 rabbit polyclonal (Cell Signaling Technology Inc)


Structured Review
Aconitase 2 Aco2 Rabbit Polyclonal, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aconitase 2 aco2 rabbit polyclonal/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99