Clone Assay:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Flow Cytometry:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Amplification:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Expressing:Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Isolation:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
TA Cloning:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Sequencing:Article Title: Genome-wide copy number variation (CNV) in patients with autoimmune Addison's disease
Article Snippet: .. Copy number assay for UGT2B28 was designed by Applied Biosystems based on the gene's sequence (ugt2b28_CCGJPAM). ..
Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Article Title: Exosomal MicroRNA-221-3p Confers Adriamycin Resistance in Breast Cancer Cells by Targeting PIK3R1
Article Snippet: .. The sequencing platform was GPL570 [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array. .. Next, differential analysis on gene expression in the two cell lines was conducted using the limma microarray package, with the differentially expressed genes (DEGs) subsequently screened out using the threshold of |log Fold Change| > 2 and p -value < 0.05.
Article Title: Clinical phenotypes associated with the Complement Factor H Y402H variant in age-related macular degeneration
Article Snippet: .. For sequence analysis, amplicons were treated with ExoSAP-IT (USB), then cycle-sequenced using the Big Dye Terminator Ready Reaction Mix (ABI) and nested primers in the forward (5’-tcattgttatggtcctag) and reverse (5’-catgtaactgtggtctgcgc) directions, and analyzed by capillary-electrophoresis on a 3130xl Genetic Analyzer running SeqScape software (ABI). ..
shRNA:Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
DNA Sequencing:Article Title: The Arcanobacterium (Actinomyces) pyogenes Plasmid pAP1 Is a Member of the pIJ101/pJV1 Family of Rolling Circle Replication Plasmids
Article Snippet: .. The complete nucleotide sequences of both strands of pAP1 were determined by the Automated DNA Sequencing Service of the Laboratory of Molecular Systematics and Evolution at The University of Arizona by using a 373A DNA sequencer (Applied Biosystems Inc.). .. Sequence data were compiled by use of the Sequencher program (GeneCodes, Ann Arbor, Mich.).
Mass Spectrometry:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Tandem Mass Spectroscopy:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Polymerase Chain Reaction:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Plasmid Preparation:Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Software:Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
Article Title: Clinical phenotypes associated with the Complement Factor H Y402H variant in age-related macular degeneration
Article Snippet: .. For sequence analysis, amplicons were treated with ExoSAP-IT (USB), then cycle-sequenced using the Big Dye Terminator Ready Reaction Mix (ABI) and nested primers in the forward (5’-tcattgttatggtcctag) and reverse (5’-catgtaactgtggtctgcgc) directions, and analyzed by capillary-electrophoresis on a 3130xl Genetic Analyzer running SeqScape software (ABI). ..
|
Thermo Fisher is a verified supplier 
![Functional characterization of the PKS19 cluster, a putative polyketide biosynthetic gene cluster that is unique to F. fujikuroi . (A) Position and organization of the PKS19 gene cluster on F. fujikuroi chromosome VIII, GC content, distribution of active histone marks, and gene expression in the PKS19 cluster. Histone marks are described in the legend for Figure 3 . Expression data are from microarray analysis of wild-type F. fujikuroi (strain IMI58289). Values are log 2 change in expression in a high versus low-nitrogen medium. H3K9ac and gene expression are correlated, as both are increased in the high-nitrogen medium. Some genes exhibited increased levels of H3K4me2 in the high-nitrogen medium, which also suggests transcription. (B) Chemical analysis of the SM product(s) of the PKS19 cluster. The traces show the combined extracted ion chromatograms for metabolites with molecular formulas [C 12 H 16 O 4 +H] + , [C 12 H 18 O 5 +H] + and [C 12 H 18 O 4 +H] + determined by <t>HPLC-FTMS</t> of culture fluids from F. fujikuroi strains: IMI58289, wild-type strain; OE::TF, a strain over-expressing the transcription factor encoded by FFUJ_12242; OE::PKS19, a strain over-expressing the PKS19 gene FFUJ_12239; and OE::TF/OE::PKS19, a strain over-expressing both FFUJ-12242 and FFUJ_12239. (C) Northern blot analysis of PKS19 cluster genes in strains IMI58289 (WT), OE::TF, OE::PKS19 and OE::TF/OE::PKS19. (D) UV spectra of metabolites corresponding to peaks 1 through 4 from chromatograms shown in C. The similar spectra of the metabolites suggest structural similarity.](https://storage.googleapis.com/bioz_article_images/PMC3694855/ppat.1003475.g014.jpg)
![Location of the NRPS/APS biosynthetic gene cluster on F. fujikuroi chromosome I, levels of histone modifications and gene expression within and flanking the cluster, and production of metabolites following overexpression of cluster genes APS2 and APS8 . A : Synteny between the apicidin gene cluster in F. semitectum [105] and the apicidin-like gene cluster in F. fujikuroi . B : Histone modifications and gene expression in and flanking the cluster. Histone marks are described in the legend to Figure 3 . Expression data were derived from microarray experiments in low and high nitrogen and are plotted as the changes in log 2 expression values in high-nitrogen medium compared to low-nitrogen medium. H3K9ac and gene expression are overall correlated, as both are increased under high nitrogen conditions. In some genes increased H3K4me2 was observed, also suggesting transcription. C : Chemical analysis of the product of the unique PKS19 gene cluster. The traces show the extracted ion chromatograms for [C 34 H 48 O 6 N 5 +H] + (first line) and [C 35 H 42 O 7 N 5 +H] + (second to fourth line) determined by HPLC-FTMS of an apicidin standard (first line) and of culture fluids from F. fujikuroi IMI58289, OE::APS8 and the OE::APS2/OE::APS8 mutant. D : UV spectra of apicidin and the apicidin-like compound. The similar spectra suggest a structural similarity.](https://storage.googleapis.com/bioz_article_images/PMC3694855/ppat.1003475.g013.jpg)