Clone Assay:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Flow Cytometry:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Amplification:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Expressing:Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Isolation:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
TA Cloning:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Sequencing:Article Title: Genome-wide copy number variation (CNV) in patients with autoimmune Addison's disease
Article Snippet: .. Copy number assay for UGT2B28 was designed by Applied Biosystems based on the gene's sequence (ugt2b28_CCGJPAM). ..
Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Article Title: Exosomal MicroRNA-221-3p Confers Adriamycin Resistance in Breast Cancer Cells by Targeting PIK3R1
Article Snippet: .. The sequencing platform was GPL570 [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array. .. Next, differential analysis on gene expression in the two cell lines was conducted using the limma microarray package, with the differentially expressed genes (DEGs) subsequently screened out using the threshold of |log Fold Change| > 2 and p -value < 0.05.
Article Title: Clinical phenotypes associated with the Complement Factor H Y402H variant in age-related macular degeneration
Article Snippet: .. For sequence analysis, amplicons were treated with ExoSAP-IT (USB), then cycle-sequenced using the Big Dye Terminator Ready Reaction Mix (ABI) and nested primers in the forward (5’-tcattgttatggtcctag) and reverse (5’-catgtaactgtggtctgcgc) directions, and analyzed by capillary-electrophoresis on a 3130xl Genetic Analyzer running SeqScape software (ABI). ..
shRNA:Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
DNA Sequencing:Article Title: The Arcanobacterium (Actinomyces) pyogenes Plasmid pAP1 Is a Member of the pIJ101/pJV1 Family of Rolling Circle Replication Plasmids
Article Snippet: .. The complete nucleotide sequences of both strands of pAP1 were determined by the Automated DNA Sequencing Service of the Laboratory of Molecular Systematics and Evolution at The University of Arizona by using a 373A DNA sequencer (Applied Biosystems Inc.). .. Sequence data were compiled by use of the Sequencher program (GeneCodes, Ann Arbor, Mich.).
Mass Spectrometry:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Tandem Mass Spectroscopy:Article Title: Ribbon α-Conotoxin KTM Exhibits Potent Inhibition of Nicotinic Acetylcholine Receptors
Article Snippet: .. MS/MS fragmentation for sequence analysis was achieved using a Velos Pro Dual-Pressure Linear Ion Trap mass spectrometer (Thermo Scientific) coupled to a Nanoscale LC system at a flow rate of 300 nL/min. ..
Polymerase Chain Reaction:Article Title: Sequence Instability in the Proviral Long Terminal Repeat and gag Regions from Peripheral Blood and Tissue-Derived Leukocytes of FIV-Infected Cats during the Late Asymptomatic Phase
Article Snippet: .. Sequence Instability of the Proviral LTR and gag Isolated from PBMC and PLN-Derived Leukocytes The FIV LTR was PCR amplified from DNA extracted from PBMCs (as described above) and cloned using pCR2.1 TA cloning kit (Invitrogen) as previously described [ ]. .. Amplified plasmid DNA was purified using a commercial kit (Wizard Plus SV Minipreps DNA Purification System, Promega, Madison, WI) and sequenced by a local vendor (Davis Sequencing, Davis, CA, USA).
Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Plasmid Preparation:Article Title: Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase
Article Snippet: .. The coding sequence of Ugene (Ugene-p/Ugene-q, ) and UNG2 ( ) was PCR amplified and cloned into the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, Carlsbad, CA) to generate COOH-terminal V5-tagged Ugene/UNG2 expression vectors. .. The primer sequences for constructing the vectors are as follows: for Ugene, forward 5′-ACC TCA TCC TTC CTG CGA CG-3′ and reverse 5′-TCT AAT ACA CTC CTC TGC TGA GAT-3′; for UNG2, forward 5′-ATG GGC GTC TTC TGC CTT G-3′ and reverse 5′-CAG CTC CTT CCA GTC AAT G-3′.
Software:Article Title: Nucleolar Enrichment of Brain Proteins with Critical Roles in Human Neurodevelopment *
Article Snippet: .. To generate shRNAs against rat Larp7 and Emg1 each mRNA sequence was analyzed using shRNA design software (rnaidesigner.lifetechnologies.com) followed by off-target exclusion using Blastn (NCBI). .. Oligonucleotides were designed: Larp7–1: 5′gatccccgccagtcagcacattcgatttcaagagaatcgaatgtgctgactggcttttta3′, Larp7–2: 5′gatccccgctaatcaccaaagctgagttcaagagactcagctttggtgattagcttttta3′, Larp7–3: 5′gatccccggccaaagctaaagaagagttcaagagactcttctttagctttggccttttta3′, Emg1–1: 5′gatcccccttacgagctactcaactgttcaagagacagttgagtagctcgtaagttttta3′, Emg1–2: 5′gatccccgaatgtgctcattgaagtgttcaagagacacttcaatgagcacattctttta3′ together with their complementary counterparts, annealed and subcloned into the pSuper vector (Oligoengine) digested with BglII and HindIII.
Article Title: Clinical phenotypes associated with the Complement Factor H Y402H variant in age-related macular degeneration
Article Snippet: .. For sequence analysis, amplicons were treated with ExoSAP-IT (USB), then cycle-sequenced using the Big Dye Terminator Ready Reaction Mix (ABI) and nested primers in the forward (5’-tcattgttatggtcctag) and reverse (5’-catgtaactgtggtctgcgc) directions, and analyzed by capillary-electrophoresis on a 3130xl Genetic Analyzer running SeqScape software (ABI). ..
|