Review





Similar Products

95
MedChemExpress 17 aag
NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 <t>inhibitor</t> <t>17-AAG</t> or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.
17 Aag, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc13001059-80-46-47?v=MedChemExpress
Average 95 stars, based on 1 article reviews
17 aag - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

99
New England Biolabs acaggaaacgtcgaaccgac aag
NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 <t>inhibitor</t> <t>17-AAG</t> or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.
Acaggaaacgtcgaaccgac Aag, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/bio_rxiv__64898__2026__03__12__710951-290-20-28?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
acaggaaacgtcgaaccgac aag - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre wildtype forward gca aag aga cct cat ctg tgg a
NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 <t>inhibitor</t> <t>17-AAG</t> or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.
Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc13122704-28-0-13?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre mutant forward caa aag cgc tct gaa gtt cct
NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 <t>inhibitor</t> <t>17-AAG</t> or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.
Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc13122704-27-0-12?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

95
Selleck Chemicals 17 aag
Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence <t>(17-AAG).</t> Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control
17 Aag, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc13018494-312-24-30?v=Selleck+Chemicals
Average 95 stars, based on 1 article reviews
17 aag - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

86
Proteostasis Therapeutics 17 aag tanespimycin
Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence <t>(17-AAG).</t> Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control
17 Aag Tanespimycin, supplied by Proteostasis Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc13027136-65-16-13?v=Proteostasis+Therapeutics
Average 86 stars, based on 1 article reviews
17 aag tanespimycin - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

95
MedChemExpress aag
The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 <t>by</t> <t>17‐AAG</t> caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.
Aag, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc12962871-220-8-12?v=MedChemExpress
Average 95 stars, based on 1 article reviews
aag - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

96
MedChemExpress 17 aag inhibitor
The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 <t>by</t> <t>17‐AAG</t> caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.
17 Aag Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc12907857-248-8-13?v=MedChemExpress
Average 96 stars, based on 1 article reviews
17 aag inhibitor - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
MedChemExpress aag treatments
The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 <t>by</t> <t>17‐AAG</t> caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.
Aag Treatments, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/pmc12907857-248-1-13?v=MedChemExpress
Average 96 stars, based on 1 article reviews
aag treatments - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

Image Search Results


NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 inhibitor 17-AAG or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.

Journal: Journal of Advanced Research

Article Title: Negative pressure mechanical signal increases the phosphorylation of eNOS Ser1177 by upregulating HSP90 expression to promote wound angiogenesis

doi: 10.1016/j.jare.2025.07.041

Figure Lengend Snippet: NPWT modulates the biological behavior of HDMECs by regulating HSP90. (A) Volcano plot of differentially expressed proteins in the different groups of HDMECs. (B) Pie chart of differential protein cellular localization. (C) Heatmap of differentially expressed proteins in HDMECs from various groups. (D) GO analysis of upregulated proteins in HDMECs treated with NPWT. (E) mRNA expression of HSP90 after the application of siRNA. (F) CCK8 assay was used to measure the proliferation rate of HDMECs across different groups. n = 8. (G, H) Migration and lumen formation of HDMECs in each group after the application of the HSP90 inhibitor 17-AAG or siHSP90. n = 3. Scale bar = 200 µm. (I) Changes in NO levels in HDMECs across different groups. n = 3. Scale bar = 50 µm. (J) Variations in ROS levels across different groups. n = 3. Scale bar = 50 µm. (K, L) Apoptosis and necrosis levels of HDMECs in different groups. n = 3. Scale bar = 100 µm.

Article Snippet: Primary human dermal microvascular endothelial cells (HDMECs) were isolated from cryopreserved human dermal tissue via established methods [ ] and cultured in ECM (Sciencell) at 37 °C with 5 % CO 2 for 24 h. The cells in the corresponding groups were treated with 0.5 mM 17-AAG (MCE) or 0.5 mM 666–15 (MCE).

Techniques: Expressing, CCK-8 Assay, Migration

Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence (17-AAG). Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control

Journal: Molecular Biomedicine

Article Title: Nuclear prostaglandin E synthase 3 promotes hepatocellular carcinoma growth with immunosuppressive macrophage polarization via the SP1/TGF-β axis

doi: 10.1186/s43556-026-00431-6

Figure Lengend Snippet: Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence (17-AAG). Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control

Article Snippet: Inhibitor Treatment: Pathway dependency was validated using Rapamycin (100 nM; Selleck Chemicals, Houston, TX, USA), ITD-1 (5 μM; Cat. No. S6713; Selleck Chemicals), or 17-AAG (0.5 μM; Cat. No. S1141; Selleck Chemicals).

Techniques: Drug discovery, Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Purification, Mutagenesis, ChIP-qPCR, Chromatin Immunoprecipitation, Expressing, Negative Control, shRNA, Activity Assay, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Activation Assay, Western Blot, Knockdown, Over Expression, Enzyme-linked Immunosorbent Assay, Control, Two Tailed Test, Real-time Polymerase Chain Reaction, Small Interfering RNA

The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 by 17‐AAG caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 by 17‐AAG caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Western Blot, Control, Reverse Transcription Polymerase Chain Reaction, Light Microscopy, Staining

Inhibiting PDH, GLS1 and Hsp90 by the combination of CPI‐613+BPTES+17‐AAG gave rise to enhanced senolysis on senescent fibroblasts as well as the therapy‐induced senescent tumor cells. (A, B) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating (A) and senescent (B) BJ cells. For the dose of each compound in use, see the results 2.7 section for more details. ** p < 0.01 by Student's t ‐test. (C, D) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent lung adenocarcinoma A549 cells. *** p < 0.001 by Student's t ‐test. (E, F) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent cervical carcinoma HeLa cells. *** p < 0.001 by Student's t ‐test. (G) The morphological changes of senescent BJ induced by IR, senescent A549 and HeLa cells induced by Dox at the indicated time of CPI‐613+BPTES+17‐AAG treatment under the light microscopy. The senescent cells without treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) The schematic summarization of our findings. The activities of TCA cycle and chaperones are reduced in DNA damage induced senescent cells. Co‐inhibiting Hsp90 and TCA cycle with 17‐AAG+CPI‐613+BPTES combination leads to enhanced selective elimination of senescent cells, hinting TCA cycle and glutaminolysis are novel and potent targets for senolysis.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: Inhibiting PDH, GLS1 and Hsp90 by the combination of CPI‐613+BPTES+17‐AAG gave rise to enhanced senolysis on senescent fibroblasts as well as the therapy‐induced senescent tumor cells. (A, B) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating (A) and senescent (B) BJ cells. For the dose of each compound in use, see the results 2.7 section for more details. ** p < 0.01 by Student's t ‐test. (C, D) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent lung adenocarcinoma A549 cells. *** p < 0.001 by Student's t ‐test. (E, F) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent cervical carcinoma HeLa cells. *** p < 0.001 by Student's t ‐test. (G) The morphological changes of senescent BJ induced by IR, senescent A549 and HeLa cells induced by Dox at the indicated time of CPI‐613+BPTES+17‐AAG treatment under the light microscopy. The senescent cells without treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) The schematic summarization of our findings. The activities of TCA cycle and chaperones are reduced in DNA damage induced senescent cells. Co‐inhibiting Hsp90 and TCA cycle with 17‐AAG+CPI‐613+BPTES combination leads to enhanced selective elimination of senescent cells, hinting TCA cycle and glutaminolysis are novel and potent targets for senolysis.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Light Microscopy, Staining

CPI‐613+BPTES+17‐AAG combination treatment reduced the p21 positive senescent cells and alleviated the physical dysfunctions in aged mice. (A) The experimental design for generating aged mice induced by D‐galactose via intraperitoneal injection and the combination treatment in the aged mice. For the dose of each compound in use, see the methods section for more details. (B) Representative images of aging mice on day 5 after the last combination treatment, the dull and shaggy coat hair and wrinkle formation observed in the aged mice were ameliorated in the treated mice. (C, D) Representative images of p21 stained liver, kidney, and lung tissues from aged mice with or without combination treatment and the quantification of p21 positive cells in liver, kidney, and lung tissues. The red arrows indicate the p21 positive cells, the scale bar stands for 30 μm. Data were presented as means ± SD, p value was calculated by two‐tailed Student's t ‐test. (E–G) Spleens dissected from 7 mice with or without combination treatment were displayed. The surface area and weight of spleens from each mouse group were measured and plotted in F‐G. The surface area of each spleen was calculated using the following formula: S = 5 × (0.524 × L × W × T) 2/3 . (H–M) Physical function measurements in aged mice with or without treatment with CPI‐613+BPTES+17‐AAG combination. Changes in body weight (H), food intake (I), grip strength (J), time on the rotarod (K), running distance on the treadmill (L), and treadmill endurance (M) were plotted. Results are shown as box‐and‐whisker plots with the median shown as a line in the middle, whiskers indicate the smallest and largest values. n = 7, 4 female and 3 male. g, gram; KJ, kilojoule; m, meter; N, Newton; s, second. p values were calculated by the two‐sided Welch's t ‐test and displayed on each plot.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: CPI‐613+BPTES+17‐AAG combination treatment reduced the p21 positive senescent cells and alleviated the physical dysfunctions in aged mice. (A) The experimental design for generating aged mice induced by D‐galactose via intraperitoneal injection and the combination treatment in the aged mice. For the dose of each compound in use, see the methods section for more details. (B) Representative images of aging mice on day 5 after the last combination treatment, the dull and shaggy coat hair and wrinkle formation observed in the aged mice were ameliorated in the treated mice. (C, D) Representative images of p21 stained liver, kidney, and lung tissues from aged mice with or without combination treatment and the quantification of p21 positive cells in liver, kidney, and lung tissues. The red arrows indicate the p21 positive cells, the scale bar stands for 30 μm. Data were presented as means ± SD, p value was calculated by two‐tailed Student's t ‐test. (E–G) Spleens dissected from 7 mice with or without combination treatment were displayed. The surface area and weight of spleens from each mouse group were measured and plotted in F‐G. The surface area of each spleen was calculated using the following formula: S = 5 × (0.524 × L × W × T) 2/3 . (H–M) Physical function measurements in aged mice with or without treatment with CPI‐613+BPTES+17‐AAG combination. Changes in body weight (H), food intake (I), grip strength (J), time on the rotarod (K), running distance on the treadmill (L), and treadmill endurance (M) were plotted. Results are shown as box‐and‐whisker plots with the median shown as a line in the middle, whiskers indicate the smallest and largest values. n = 7, 4 female and 3 male. g, gram; KJ, kilojoule; m, meter; N, Newton; s, second. p values were calculated by the two‐sided Welch's t ‐test and displayed on each plot.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Injection, Staining, Two Tailed Test, Whisker Assay