bhk 21 ccl 10 cells  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC bhk 21 ccl 10 cells
    Bhk 21 Ccl 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bhk 21 ccl 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bhk 21 ccl 10 cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    mcf 10 a cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC mcf 10 a cells
    Mcf 10 A Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcf 10 a cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mcf 10 a cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    ipsc263 10 ips cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC ipsc263 10 ips cells
    KEY RESOURCES TABLE
    Ipsc263 10 Ips Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ipsc263 10 ips cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ipsc263 10 ips cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    1) Product Images from "Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon"

    Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon

    Journal: Cell stem cell

    doi: 10.1016/j.stem.2023.10.002

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Transduction, Virus, Recombinant, Membrane, Transfection, SYBR Green Assay, Luminex, Enzyme-linked Immunosorbent Assay, Modification, Electron Microscopy, In Vitro, In Vivo, Irradiation, Sequencing, Plasmid Preparation, Software

    c only low passage number p2 10 cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC c only low passage number p2 10 cells
    C Only Low Passage Number P2 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c only low passage number p2 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c only low passage number p2 10 cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    bhk 21 atcc ccl 10 cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC bhk 21 atcc ccl 10 cells
    Bhk 21 Atcc Ccl 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bhk 21 atcc ccl 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bhk 21 atcc ccl 10 cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    svec4 10 cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC svec4 10 cells
    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) <t>SVEC4-10</t> EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.
    Svec4 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/svec4 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    svec4 10 cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    1) Product Images from "Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response"

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    Journal: The EMBO Journal

    doi: 10.1038/s44318-024-00044-1

    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.
    Figure Legend Snippet: ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.

    Techniques Used: CRISPR, Isolation, Fractionation

    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 8 or 24 h. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Graphs shows presence of mtDNA relative to genomic DNA in n = 3 independent experiments, error bars represent s.e.m. ( C ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 or 24 h. Nuclei were stained using Hoechst, and mitochondria with Mitotracker Green. Images are representative of three independent experiments. Scale bar is 20 μm. ( D ) SVEC4-10 cells treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser. Lysates for blotted for ubiquitin (UBCJ2), SMAC, TOM20, HSP60 and Actin. ( E ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were stained for ubiquitin (FK2) and mitochondrial COXIV. Images are representative of three independent experiments. Images are maximum projections of Z-stacks with a scale bar of 20 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localised ubiquitin puncta. Graph displays mean values ± s.e.m. (error bar) of n = 3 independent experiments. ( G ) U2OS EMPTY CRISPR , ATG5 CRISPR and ATG7 CRISPR expressing YFP-Parkin were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Mitochondrial depletion was assessed by blotting for various mitochondrial proteins. Data information: ( A , D , G ) blots are representative of three independent experiments. Statistics for all experiments were performed using two-way ANOVA with Tukey correction. * P < 0.05, ** P < 0.01, **** P < 0.0001. .
    Figure Legend Snippet: ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 8 or 24 h. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Graphs shows presence of mtDNA relative to genomic DNA in n = 3 independent experiments, error bars represent s.e.m. ( C ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 or 24 h. Nuclei were stained using Hoechst, and mitochondria with Mitotracker Green. Images are representative of three independent experiments. Scale bar is 20 μm. ( D ) SVEC4-10 cells treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser. Lysates for blotted for ubiquitin (UBCJ2), SMAC, TOM20, HSP60 and Actin. ( E ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were stained for ubiquitin (FK2) and mitochondrial COXIV. Images are representative of three independent experiments. Images are maximum projections of Z-stacks with a scale bar of 20 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localised ubiquitin puncta. Graph displays mean values ± s.e.m. (error bar) of n = 3 independent experiments. ( G ) U2OS EMPTY CRISPR , ATG5 CRISPR and ATG7 CRISPR expressing YFP-Parkin were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Mitochondrial depletion was assessed by blotting for various mitochondrial proteins. Data information: ( A , D , G ) blots are representative of three independent experiments. Statistics for all experiments were performed using two-way ANOVA with Tukey correction. * P < 0.05, ** P < 0.01, **** P < 0.0001. .

    Techniques Used: CRISPR, Staining, Isolation, Expressing

    ( A ) Volcano plot of ubiquitylated proteins in SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. The experiment performed with n = 4 independent repeats. Statistical analysis determining significance (coloured dots) was through using Student’s t test. Plot generated in RStudio. ( B ) Pie chart of ubiquitylated peptides categorised into mitochondrial compartments. Categorisation of peptides was performed using MitoCarta 3.0, UniProt and ProteinAtlas. ( C ) Cellular distribution of all hits from the isolated ubiquitin remnant-containing peptides. Categorisation using MitoCarta 3.0, UniProt and ProteinAtlas. ( D ) GO-term cellular compartment analysis of proteins with increased ubiquitylation after MOMP. Statistical analysis was performed with Fisher’s exact test with corrected with false discovery rate. Graphs shows the top ten most significant hits. .
    Figure Legend Snippet: ( A ) Volcano plot of ubiquitylated proteins in SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. The experiment performed with n = 4 independent repeats. Statistical analysis determining significance (coloured dots) was through using Student’s t test. Plot generated in RStudio. ( B ) Pie chart of ubiquitylated peptides categorised into mitochondrial compartments. Categorisation of peptides was performed using MitoCarta 3.0, UniProt and ProteinAtlas. ( C ) Cellular distribution of all hits from the isolated ubiquitin remnant-containing peptides. Categorisation using MitoCarta 3.0, UniProt and ProteinAtlas. ( D ) GO-term cellular compartment analysis of proteins with increased ubiquitylation after MOMP. Statistical analysis was performed with Fisher’s exact test with corrected with false discovery rate. Graphs shows the top ten most significant hits. .

    Techniques Used: Generated, Isolation

    ( A ) SVEC4-10 cells treated with for 1 or 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), K63- and K48-specific ubiquitin were used. Blots representative for three independent experiments. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 h. Stained for K63-ubiquitin and mitochondrial COXIV. Images are maximum projections of Z-stacks with a scale bar of 20 μm and are representative of three independent experiments. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial localised K63-ubiquitin puncta. Statistics performed using two-way ANOVA with Tukey correction. ( D ) SVEC4-10 cells expressing doxycycline-inducible K63 or M1-UBDs. Cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Images are representative of three independent experiments with a scale bar of 50 μm. ( E ) Quantification of ( D ) showing the percentage of SVEC4-10 cells with mitochondrial localised GFP-UBDs. Also includes the quantification of U2OS cells expressing doxycycline-inducible K63- or M1-UBDs treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Statistics were performed using multiple unpaired t tests. Data information: ( C , E ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .
    Figure Legend Snippet: ( A ) SVEC4-10 cells treated with for 1 or 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), K63- and K48-specific ubiquitin were used. Blots representative for three independent experiments. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 h. Stained for K63-ubiquitin and mitochondrial COXIV. Images are maximum projections of Z-stacks with a scale bar of 20 μm and are representative of three independent experiments. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial localised K63-ubiquitin puncta. Statistics performed using two-way ANOVA with Tukey correction. ( D ) SVEC4-10 cells expressing doxycycline-inducible K63 or M1-UBDs. Cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Images are representative of three independent experiments with a scale bar of 50 μm. ( E ) Quantification of ( D ) showing the percentage of SVEC4-10 cells with mitochondrial localised GFP-UBDs. Also includes the quantification of U2OS cells expressing doxycycline-inducible K63- or M1-UBDs treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Statistics were performed using multiple unpaired t tests. Data information: ( C , E ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Techniques Used: Isolation, Fractionation, CRISPR, Staining, Expressing

    ( A ) Timelapse of U2OS cells expressing GFP-NEMO. Cells were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria and nuclei are visualised using PkMito DeepRed and Hoechst, respectively. Cells were treated for 1 h with images taken every 10 min. Image is representative for three independent experiments. Scale bar is 20 μm. ( B ) U2OS cells expressing GFP-NEMO treated with treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh were quantified for mitochondrial localised GFP-NEMO puncta over time. Puncta are calculated using ImageJ/Fiji “trainable Weka segmentation plug-in”. The graph is representative of three biological repeats and shows the mean +/− s.e.m. (error bars) of five fields of view taken over time. ( C ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( D ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial COXIV. Scale bar is 20 μm. Images are maximum projections of Z-stacks and are representative for three independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with mitochondrial localised GFP-NEMO puncta. ( F ) U2OS cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Scale bar is 20 μm and images are representative for three independent experiments. ( G ) Quantification of ( F ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( H ) Parental SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Scale bar is 50 μm and images are representative for three independent experiments. ( I ) Quantification of ( H ) showing the GFP+ cells with nuclear translocation of p65. Data information: ( E , G , I ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics are performed using two-way ANOVA with Tukey correction. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .
    Figure Legend Snippet: ( A ) Timelapse of U2OS cells expressing GFP-NEMO. Cells were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria and nuclei are visualised using PkMito DeepRed and Hoechst, respectively. Cells were treated for 1 h with images taken every 10 min. Image is representative for three independent experiments. Scale bar is 20 μm. ( B ) U2OS cells expressing GFP-NEMO treated with treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh were quantified for mitochondrial localised GFP-NEMO puncta over time. Puncta are calculated using ImageJ/Fiji “trainable Weka segmentation plug-in”. The graph is representative of three biological repeats and shows the mean +/− s.e.m. (error bars) of five fields of view taken over time. ( C ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( D ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial COXIV. Scale bar is 20 μm. Images are maximum projections of Z-stacks and are representative for three independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with mitochondrial localised GFP-NEMO puncta. ( F ) U2OS cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Scale bar is 20 μm and images are representative for three independent experiments. ( G ) Quantification of ( F ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( H ) Parental SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Scale bar is 50 μm and images are representative for three independent experiments. ( I ) Quantification of ( H ) showing the GFP+ cells with nuclear translocation of p65. Data information: ( E , G , I ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics are performed using two-way ANOVA with Tukey correction. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Techniques Used: Expressing, Isolation, CRISPR, Translocation Assay

    ( A ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( B ) SVEC4-10 cells pre-treated with 2 μΜ TAK-243 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Blots are representative for four independent experiments. ( C ) Upper: SVEC4-10 cells expressing GFP-NEMO were pre-treated for 1 h with 2 μΜ TAK-243 followed by 1 h treatment of 10 μΜ ABT-737, 10 μΜ S63845, 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Cells were immunostained for TOM20 and ubiquitin (FK2). Scale bar is 50 μm and images are representative for three independent experiments. Lower : quantification showing the percentage of cells with mitochondrial localised GFP-NEMO and ubiquitin puncta. ( D ) SVEC4-10 cells pre-treated with 1 μΜ MLN4924 (NAE inhibitor) for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Blots are representative for two independent experiments. ( E ) SVEC4-10 cells expressing GFP-NEMO pre-treated with 1 μΜ MLN4924 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments and are shown with a 50 μm scale bar. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Data information: graphs in ( C , F ) display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001.
    Figure Legend Snippet: ( A ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( B ) SVEC4-10 cells pre-treated with 2 μΜ TAK-243 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Blots are representative for four independent experiments. ( C ) Upper: SVEC4-10 cells expressing GFP-NEMO were pre-treated for 1 h with 2 μΜ TAK-243 followed by 1 h treatment of 10 μΜ ABT-737, 10 μΜ S63845, 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Cells were immunostained for TOM20 and ubiquitin (FK2). Scale bar is 50 μm and images are representative for three independent experiments. Lower : quantification showing the percentage of cells with mitochondrial localised GFP-NEMO and ubiquitin puncta. ( D ) SVEC4-10 cells pre-treated with 1 μΜ MLN4924 (NAE inhibitor) for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Blots are representative for two independent experiments. ( E ) SVEC4-10 cells expressing GFP-NEMO pre-treated with 1 μΜ MLN4924 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments and are shown with a 50 μm scale bar. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Data information: graphs in ( C , F ) display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001.

    Techniques Used: Isolation, Expressing, Translocation Assay

    ( A ) MEF Tnf -/- /Hoip +/+ and Tnf -/- /Hoip -/- expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 5 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative of three independent experiments. ( B ) Quantification of A showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistical analysis was performed using two-way ANOVA with Tukey correction. ( C ) Validation of SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO. Lysates were blotted for NEMO and α-tubulin. ( D ) SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Images are representative of two independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with nuclear translocation of p65. Graph displays mean values ± s.e.m. (error bars) of n = 2 independent experiments. **** P < 0.0001.
    Figure Legend Snippet: ( A ) MEF Tnf -/- /Hoip +/+ and Tnf -/- /Hoip -/- expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 5 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative of three independent experiments. ( B ) Quantification of A showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistical analysis was performed using two-way ANOVA with Tukey correction. ( C ) Validation of SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO. Lysates were blotted for NEMO and α-tubulin. ( D ) SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Images are representative of two independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with nuclear translocation of p65. Graph displays mean values ± s.e.m. (error bars) of n = 2 independent experiments. **** P < 0.0001.

    Techniques Used: Expressing, Translocation Assay, Transfection

    ( A ) Lysates of U2OS, SVEC4-10 and SHSHY-5Y cells were blotted for Parkin and Actin. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing GFP-NEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( D ) SVEC4-10 EMPTY CRISPR , MUL1 CRISPR , MARCH5 CRISPR and MUL1/MARCH5 CRISPR treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Lysates were blotted for p-ΙκΒα, ΙκΒα, MARCH5 and Actin. Blots are representative of three independent experiments. KO-scores of MUL1 and MARCH5 are calculated via ICE analysis. ( E ) SVEC4-10 EMPTY CRISPR and MUL1/MARCH5 CRISPR cells expressing GFP-NEMO treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (UBCJ2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( G ) SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( H ) Quantification of ( G ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( I ) SVEC4-10 EMPTY CRISPR and NIK CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Images are immunostained with mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( J ) Quantification of ( I ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO. Data information: ( C , F , H , J ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001. .
    Figure Legend Snippet: ( A ) Lysates of U2OS, SVEC4-10 and SHSHY-5Y cells were blotted for Parkin and Actin. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing GFP-NEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( D ) SVEC4-10 EMPTY CRISPR , MUL1 CRISPR , MARCH5 CRISPR and MUL1/MARCH5 CRISPR treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Lysates were blotted for p-ΙκΒα, ΙκΒα, MARCH5 and Actin. Blots are representative of three independent experiments. KO-scores of MUL1 and MARCH5 are calculated via ICE analysis. ( E ) SVEC4-10 EMPTY CRISPR and MUL1/MARCH5 CRISPR cells expressing GFP-NEMO treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (UBCJ2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( G ) SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( H ) Quantification of ( G ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( I ) SVEC4-10 EMPTY CRISPR and NIK CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Images are immunostained with mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( J ) Quantification of ( I ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO. Data information: ( C , F , H , J ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001. .

    Techniques Used: CRISPR, Expressing, Translocation Assay

    ( A ) Validation of PINK1 knockout in SVEC4-10 cells with or without GFP-NEMO expression using genomic PCR and ICE (inference of CRISPR edits) analysis. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing YFP-Parkin were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or for 3 h with 10 μΜ CCCP. Mitochondria were immunostained with HSP60 and DAPI. Images are representative of two independent experiments and displayed with 50 μm scale bar. ( C ) Validation of MUL1 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( D ) Validation of MARCH5 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( E ) Validation of SVEC4-10 XIAP CRISPR cells with and without GFP-NEMO expression using western blot. Lysates were blotted for XIAP and Actin. ( F ) Tnf , Kc , and Ccl5 expression of SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD for 3 h. Graph is representative of three independent experiments. ( G ) Validation of NIK knockout in GFP-NEMO expressing SVEC4-10 EMPTY CRISPR and NIK CRISPR cells. Cells were treated for 2 h with 10 μM MG-132. Lysates were blotted for NIK and actin.
    Figure Legend Snippet: ( A ) Validation of PINK1 knockout in SVEC4-10 cells with or without GFP-NEMO expression using genomic PCR and ICE (inference of CRISPR edits) analysis. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing YFP-Parkin were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or for 3 h with 10 μΜ CCCP. Mitochondria were immunostained with HSP60 and DAPI. Images are representative of two independent experiments and displayed with 50 μm scale bar. ( C ) Validation of MUL1 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( D ) Validation of MARCH5 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( E ) Validation of SVEC4-10 XIAP CRISPR cells with and without GFP-NEMO expression using western blot. Lysates were blotted for XIAP and Actin. ( F ) Tnf , Kc , and Ccl5 expression of SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD for 3 h. Graph is representative of three independent experiments. ( G ) Validation of NIK knockout in GFP-NEMO expressing SVEC4-10 EMPTY CRISPR and NIK CRISPR cells. Cells were treated for 2 h with 10 μM MG-132. Lysates were blotted for NIK and actin.

    Techniques Used: Knock-Out, Expressing, CRISPR, Western Blot

    ( A ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GAPDH were used. ( B ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments in which the percentage of cells with mitochondrial localisation of GFP-NEMO was analysed. ( C ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 and 5 μΜ antimycin A or 3 μΜ erastin. ROS levels were determined using MitoSOX Red via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( D ) SVEC4-10 cells were treated with 0.5, 1, 5, 10 and 20 μΜ erastin. Mitochondrial calcium was measured using Rhod2-AM via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( E ) SVEC4-10 cells were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GADPH were used. ( F ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments showing the percentage of cells with mitochondrial localisation of GFP-NEMO, error bars represent s.e.m. ( G ) EMPTY CRISPR and BAX/BAK CRISPR validation of SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO. Lysates for blotted for BAX, BAK and α-tubulin. ( H ) SVEC4-10 EMPTY CRISPR and SVEC4-10 BAX/BAK CRISPR cells treated with 10 μΜ ABT-737 and 10 μΜ S63845 or treated with 2.5 or 10 μΜ raptinal. Caspase-dependency of death was assessed using 30 μΜ Q-VD-OPh. Cell viability was measured using Sytox Green exclusion. Graphs are representative of two independent experiments and display the mean and s.e.m. of two replicates. ( I ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR. Two repeats of Fig. . Data information: ( A , E ) blots are representative for three independent experiments. Statistics performed using two-way ANOVA with Tukey correction. *** P < 0.001, **** P < 0.0001.
    Figure Legend Snippet: ( A ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GAPDH were used. ( B ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments in which the percentage of cells with mitochondrial localisation of GFP-NEMO was analysed. ( C ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 and 5 μΜ antimycin A or 3 μΜ erastin. ROS levels were determined using MitoSOX Red via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( D ) SVEC4-10 cells were treated with 0.5, 1, 5, 10 and 20 μΜ erastin. Mitochondrial calcium was measured using Rhod2-AM via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( E ) SVEC4-10 cells were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GADPH were used. ( F ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments showing the percentage of cells with mitochondrial localisation of GFP-NEMO, error bars represent s.e.m. ( G ) EMPTY CRISPR and BAX/BAK CRISPR validation of SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO. Lysates for blotted for BAX, BAK and α-tubulin. ( H ) SVEC4-10 EMPTY CRISPR and SVEC4-10 BAX/BAK CRISPR cells treated with 10 μΜ ABT-737 and 10 μΜ S63845 or treated with 2.5 or 10 μΜ raptinal. Caspase-dependency of death was assessed using 30 μΜ Q-VD-OPh. Cell viability was measured using Sytox Green exclusion. Graphs are representative of two independent experiments and display the mean and s.e.m. of two replicates. ( I ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR. Two repeats of Fig. . Data information: ( A , E ) blots are representative for three independent experiments. Statistics performed using two-way ANOVA with Tukey correction. *** P < 0.001, **** P < 0.0001.

    Techniques Used: Isolation, Fractionation, Expressing, Confocal Microscopy, Flow Cytometry, CRISPR, Quantitative RT-PCR

    ( A ) SVEC4-10 cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative of three independent experiments displayed with a 50 μm scale bar. ( B ) SVEC EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 µM ABT-737, 10 µM S63845 and 30 µM Q-VD-OPh or 2.5 µM raptinal and 30 µM Q-VD-OPh. Graphs show the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained stained for p65 and DAPI. Images are representative of three independent experiments. Scale bar is 50 μm. ( D ) Quantification of ( C ) showing the percentage of cells with nuclear translocation of p65. ( E ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR, graphs are representative for three independent experiments. Data information: ( B , D ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Dunnett correction. **** P < 0.0001. .
    Figure Legend Snippet: ( A ) SVEC4-10 cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative of three independent experiments displayed with a 50 μm scale bar. ( B ) SVEC EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 µM ABT-737, 10 µM S63845 and 30 µM Q-VD-OPh or 2.5 µM raptinal and 30 µM Q-VD-OPh. Graphs show the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained stained for p65 and DAPI. Images are representative of three independent experiments. Scale bar is 50 μm. ( D ) Quantification of ( C ) showing the percentage of cells with nuclear translocation of p65. ( E ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR, graphs are representative for three independent experiments. Data information: ( B , D ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Dunnett correction. **** P < 0.0001. .

    Techniques Used: Expressing, CRISPR, Staining, Translocation Assay, Quantitative RT-PCR

    cell line mcf 10 a  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC cell line mcf 10 a
    Cell Line Mcf 10 A, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell line mcf 10 a/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cell line mcf 10 a - by Bioz Stars, 2024-04
    86/100 stars

    Images

    themurine endothelial cell line svec4 10  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC themurine endothelial cell line svec4 10
    Themurine Endothelial Cell Line Svec4 10, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/themurine endothelial cell line svec4 10/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    themurine endothelial cell line svec4 10 - by Bioz Stars, 2024-04
    86/100 stars

    Images

    murine endothelial cell line svec4 10  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC murine endothelial cell line svec4 10
    a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in <t>SVEC4-10</t> cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.
    Murine Endothelial Cell Line Svec4 10, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine endothelial cell line svec4 10/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    murine endothelial cell line svec4 10 - by Bioz Stars, 2024-04
    86/100 stars

    Images

    1) Product Images from "TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer"

    Article Title: TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer

    Journal: Nature Communications

    doi: 10.1038/s41467-023-43743-9

    a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.
    Figure Legend Snippet: a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.

    Techniques Used: Expressing, FACS, Immunofluorescence, Over Expression, Cell Culture, Labeling, Two Tailed Test

    a Representative images and quantifications of SVEC4-10 cells that migrated towards Hepa1-6- Cgas or Ctrl cells in Transwell assays ( n = 5). b Transendothelial migration (TEM) of mouse splenic lymphocytes through SVEC4-10 cell barrier with cGAMP pre-treatment or not ( n = 3). c TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pre-treatment of CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). d Protein levels of Sting in splenic lymphocytes from Sting −/− or WT mice. Representative of n = 3 independent experiments. e TEM of Sting −/− or WT mice-derived lymphocytes through SVEC4-10 cell barrier ( n = 3). f , g Flow cytometric analysis and mean fluorescence intensity (MFI) of surface VE-Cad in SVEC4-10 cells after cGAMP treatment ( f ) ( n = 3), co-cultured with Hepa1-6- Cgas or Ctrl cells ( g ) ( n = 3). h mRNA levels of indicated genes in SVEC4-10 cells after cGAMP treatment ( n = 3). i mRNA levels of indicated genes in SVEC4-10 cells co-cultured with Hepa1-6- Cgas or Ctrl cells ( n = 3). j mRNA levels of indicated genes in SVEC4-10 cells with Sting knocked out (sg Sting ) or Ctrl cells (sgCtrl) ( n = 3). P values are calculated using unpaired Student’s t test ( a – c , e – j ). ns, not significant. Source data are provided as a Source Data file.
    Figure Legend Snippet: a Representative images and quantifications of SVEC4-10 cells that migrated towards Hepa1-6- Cgas or Ctrl cells in Transwell assays ( n = 5). b Transendothelial migration (TEM) of mouse splenic lymphocytes through SVEC4-10 cell barrier with cGAMP pre-treatment or not ( n = 3). c TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pre-treatment of CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). d Protein levels of Sting in splenic lymphocytes from Sting −/− or WT mice. Representative of n = 3 independent experiments. e TEM of Sting −/− or WT mice-derived lymphocytes through SVEC4-10 cell barrier ( n = 3). f , g Flow cytometric analysis and mean fluorescence intensity (MFI) of surface VE-Cad in SVEC4-10 cells after cGAMP treatment ( f ) ( n = 3), co-cultured with Hepa1-6- Cgas or Ctrl cells ( g ) ( n = 3). h mRNA levels of indicated genes in SVEC4-10 cells after cGAMP treatment ( n = 3). i mRNA levels of indicated genes in SVEC4-10 cells co-cultured with Hepa1-6- Cgas or Ctrl cells ( n = 3). j mRNA levels of indicated genes in SVEC4-10 cells with Sting knocked out (sg Sting ) or Ctrl cells (sgCtrl) ( n = 3). P values are calculated using unpaired Student’s t test ( a – c , e – j ). ns, not significant. Source data are provided as a Source Data file.

    Techniques Used: Migration, Derivative Assay, Fluorescence, Cell Culture

    a Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with genes related to cGAS-STING, vascular stabilization, endothelial-T cell interaction, and pericyte/T cell chemotaxis in HCC from TCGA dataset ( n = 371). b Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with CD8 + T cell infiltration in HCC from TCGA dataset through TIMER and MCP-counter ( n = 371). c GSEA (Panther pathway analysis) of LRRC8C in liver cancer from TCGA ( n = 371). d Protein levels of Cgas and Lrrc8c in Hepa1-6- Cgas cells with Lrrc8c knocked down by siRNA (Hepa1-6- Cgas -si Lrrc8c ) or Ctrl cells (Hepa1-6- Cgas -siCtrl). e Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 4). f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 3). h Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment. i mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). j Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells. k mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells ( n = 3). l mRNA levels of indicated genes in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells (n = 3). m mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). n mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells (n = 3). P values are calculated using two-tailed unpaired Student’s t test ( e , g , i , k–n ). ns, not significant. Representative of n = 3 independent experiments ( d , f , h , j ). Source data are provided as a Source Data file.
    Figure Legend Snippet: a Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with genes related to cGAS-STING, vascular stabilization, endothelial-T cell interaction, and pericyte/T cell chemotaxis in HCC from TCGA dataset ( n = 371). b Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with CD8 + T cell infiltration in HCC from TCGA dataset through TIMER and MCP-counter ( n = 371). c GSEA (Panther pathway analysis) of LRRC8C in liver cancer from TCGA ( n = 371). d Protein levels of Cgas and Lrrc8c in Hepa1-6- Cgas cells with Lrrc8c knocked down by siRNA (Hepa1-6- Cgas -si Lrrc8c ) or Ctrl cells (Hepa1-6- Cgas -siCtrl). e Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 4). f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 3). h Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment. i mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). j Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells. k mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells ( n = 3). l mRNA levels of indicated genes in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells (n = 3). m mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). n mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells (n = 3). P values are calculated using two-tailed unpaired Student’s t test ( e , g , i , k–n ). ns, not significant. Representative of n = 3 independent experiments ( d , f , h , j ). Source data are provided as a Source Data file.

    Techniques Used: Chemotaxis Assay, Two Tailed Test

    a , b Cgas mRNA ( a ) and protein ( b ) levels in VC-treated Hepa1-6 cells ( n = 3). c Cgas protein level in Hepa1-6 cells-derived tumor after VC or Sora treatment for 2 weeks. d Immunofluorescence costaining of dsDNA, HSP60, and DAPI in VC-treated Hepa1-6 cells. Scale bars, 5 μm. e Cgas mRNA level in VC-treated Hepa1-6 cells following NAC pretreatment ( n = 3). f Cgas mRNA level in VC-treated Hepa1-6 sh Tet2 cells and shCtrl cells ( n = 3). g Cgas mRNA level in VC-treated Hepa1-6 cells following TFMB-2-HG pretreatment ( n = 3). h Intercellular and extracellular cGAMP levels from VC-treated Hepa1-6 cells ( n = 4). i Pyrosequencing analysis and quantification of the promoter methylation status of Cgas in VC-treated Hepa1-6 cells ( n = 3). j Immunofluorescence staining and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6 cells after VC treatment ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. k , l mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( k ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( l ) ( n = 3). m – o TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pretreatment of CM from Hepa1-6 cells ( m ), Hepa1-6 sg Cgas cells ( n ), or Hepa1-6 sh Tet2 cells ( o ) treated with VC or not ( n = 3). p Flow cytometric analysis and MFI of surface VE-Cad in SVEC4-10-GFP cells co-cultured with Hepa1-6 cells after VC treatment ( n = 3). q – t , mRNA levels of VE-Cad ( q , r ) and indicated genes ( s , t ) in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( q , s ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( r , t ) ( n = 3). P values are calculated using two-tailed unpaired Student’s t test ( a , e – h, j , k – t ) and paired Student’s t test ( i ). ns, not significant. Representative of n = 3 independent experiments ( b – d ). Source data are provided as a Source Data file.
    Figure Legend Snippet: a , b Cgas mRNA ( a ) and protein ( b ) levels in VC-treated Hepa1-6 cells ( n = 3). c Cgas protein level in Hepa1-6 cells-derived tumor after VC or Sora treatment for 2 weeks. d Immunofluorescence costaining of dsDNA, HSP60, and DAPI in VC-treated Hepa1-6 cells. Scale bars, 5 μm. e Cgas mRNA level in VC-treated Hepa1-6 cells following NAC pretreatment ( n = 3). f Cgas mRNA level in VC-treated Hepa1-6 sh Tet2 cells and shCtrl cells ( n = 3). g Cgas mRNA level in VC-treated Hepa1-6 cells following TFMB-2-HG pretreatment ( n = 3). h Intercellular and extracellular cGAMP levels from VC-treated Hepa1-6 cells ( n = 4). i Pyrosequencing analysis and quantification of the promoter methylation status of Cgas in VC-treated Hepa1-6 cells ( n = 3). j Immunofluorescence staining and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6 cells after VC treatment ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. k , l mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( k ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( l ) ( n = 3). m – o TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pretreatment of CM from Hepa1-6 cells ( m ), Hepa1-6 sg Cgas cells ( n ), or Hepa1-6 sh Tet2 cells ( o ) treated with VC or not ( n = 3). p Flow cytometric analysis and MFI of surface VE-Cad in SVEC4-10-GFP cells co-cultured with Hepa1-6 cells after VC treatment ( n = 3). q – t , mRNA levels of VE-Cad ( q , r ) and indicated genes ( s , t ) in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( q , s ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( r , t ) ( n = 3). P values are calculated using two-tailed unpaired Student’s t test ( a , e – h, j , k – t ) and paired Student’s t test ( i ). ns, not significant. Representative of n = 3 independent experiments ( b – d ). Source data are provided as a Source Data file.

    Techniques Used: Derivative Assay, Immunofluorescence, Methylation, Staining, Over Expression, Cell Culture, Labeling, Two Tailed Test

    cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells
    Cell Lines Bhk Cell Atcc Ccl 10 Expi293f Thermo Fisher Scientific A39250 Hek293t Cell Atcc Crl 3216 Hela Hdpp4 Hace2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells - by Bioz Stars, 2024-04
    86/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    ATCC bhk 21 ccl 10 cells
    Bhk 21 Ccl 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bhk 21 ccl 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bhk 21 ccl 10 cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC mcf 10 a cells
    Mcf 10 A Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcf 10 a cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mcf 10 a cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC ipsc263 10 ips cells
    KEY RESOURCES TABLE
    Ipsc263 10 Ips Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ipsc263 10 ips cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ipsc263 10 ips cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC c only low passage number p2 10 cells
    KEY RESOURCES TABLE
    C Only Low Passage Number P2 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c only low passage number p2 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c only low passage number p2 10 cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC bhk 21 atcc ccl 10 cells
    KEY RESOURCES TABLE
    Bhk 21 Atcc Ccl 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bhk 21 atcc ccl 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bhk 21 atcc ccl 10 cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC svec4 10 cells
    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) <t>SVEC4-10</t> EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.
    Svec4 10 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/svec4 10 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    svec4 10 cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC cell line mcf 10 a
    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) <t>SVEC4-10</t> EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.
    Cell Line Mcf 10 A, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell line mcf 10 a/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cell line mcf 10 a - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC themurine endothelial cell line svec4 10
    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) <t>SVEC4-10</t> EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.
    Themurine Endothelial Cell Line Svec4 10, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/themurine endothelial cell line svec4 10/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    themurine endothelial cell line svec4 10 - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC murine endothelial cell line svec4 10
    a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in <t>SVEC4-10</t> cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.
    Murine Endothelial Cell Line Svec4 10, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine endothelial cell line svec4 10/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    murine endothelial cell line svec4 10 - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    86
    ATCC cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells
    a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in <t>SVEC4-10</t> cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.
    Cell Lines Bhk Cell Atcc Ccl 10 Expi293f Thermo Fisher Scientific A39250 Hek293t Cell Atcc Crl 3216 Hela Hdpp4 Hace2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells - by Bioz Stars, 2024-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell stem cell

    Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon

    doi: 10.1016/j.stem.2023.10.002

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data - human fetal hemogenic and hematopoietic atlas Calvanese et al. 16 GEO: GSE162950 Reference scRNA-seq data - human fetal hematopoietic atlas Popescu et al. 51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data - human fetal hematopoietic and macrophage atlas Bian et al. 15 GEO: GSE133345 Reference scRNA-seq data - human fetal endodermal organ atlas Yu et al. 57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al. 35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al. 90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al. 91 v2.2.5 Cufflinks Trapnell et al. 92 v2.2.1 Debian Linux 64-bit “Wheezy” N/A v7.10 FastQC N/A v0.10.1 Partek ® Flow ® N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al. 93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al. 94 v1.2.7 CellChat Jin et al. 95 v1.1.3 ELeFHAnt Thorner et al. 96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 Open in a separate window KEY RESOURCES TABLE.

    Techniques: Transduction, Virus, Recombinant, Membrane, Transfection, SYBR Green Assay, Luminex, Enzyme-linked Immunosorbent Assay, Modification, Electron Microscopy, In Vitro, In Vivo, Irradiation, Sequencing, Plasmid Preparation, Software

    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 with or without 20 μΜ Q-VD-OPh. Cell death was determined using Sytox Green inclusion normalised to starting confluence. Graph is representative of three independent experiments and displays mean values ± s.e.m. (error bars) of technical triplicates. ( B ) Lysates from U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were blotted for BAX, BAK and Actin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and blotted for ubiquitin (UBCJ2), BAX, BAK, HSP60 and Actin. ( D ) SVEC4-10 cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 with or without 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and lysates were blotted for ubiquitin (UBCJ2), HSP60 and actin. ( E ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( F ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 10 μM MG-132. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. ( G ) U2OS cells were treated for 7 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Lysates were blotted for ubiquitin (UBCJ2) and GAPDH. ( H ) U2OS cells were treated for 24 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh with or without the addition of 1 μΜ TAK-243. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins and GAPDH. Data information: ( C , D , E , F , G , H ) blots are representative of three independent experiments.

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: CRISPR, Isolation, Fractionation

    ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 8 or 24 h. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Graphs shows presence of mtDNA relative to genomic DNA in n = 3 independent experiments, error bars represent s.e.m. ( C ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 or 24 h. Nuclei were stained using Hoechst, and mitochondria with Mitotracker Green. Images are representative of three independent experiments. Scale bar is 20 μm. ( D ) SVEC4-10 cells treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser. Lysates for blotted for ubiquitin (UBCJ2), SMAC, TOM20, HSP60 and Actin. ( E ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were stained for ubiquitin (FK2) and mitochondrial COXIV. Images are representative of three independent experiments. Images are maximum projections of Z-stacks with a scale bar of 20 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localised ubiquitin puncta. Graph displays mean values ± s.e.m. (error bar) of n = 3 independent experiments. ( G ) U2OS EMPTY CRISPR , ATG5 CRISPR and ATG7 CRISPR expressing YFP-Parkin were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Mitochondrial depletion was assessed by blotting for various mitochondrial proteins. Data information: ( A , D , G ) blots are representative of three independent experiments. Statistics for all experiments were performed using two-way ANOVA with Tukey correction. * P < 0.05, ** P < 0.01, **** P < 0.0001. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 8 or 24 h. Mitochondrial depletion was assessed by blotting for several mitochondrial proteins. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Graphs shows presence of mtDNA relative to genomic DNA in n = 3 independent experiments, error bars represent s.e.m. ( C ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 or 24 h. Nuclei were stained using Hoechst, and mitochondria with Mitotracker Green. Images are representative of three independent experiments. Scale bar is 20 μm. ( D ) SVEC4-10 cells treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser. Lysates for blotted for ubiquitin (UBCJ2), SMAC, TOM20, HSP60 and Actin. ( E ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were stained for ubiquitin (FK2) and mitochondrial COXIV. Images are representative of three independent experiments. Images are maximum projections of Z-stacks with a scale bar of 20 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localised ubiquitin puncta. Graph displays mean values ± s.e.m. (error bar) of n = 3 independent experiments. ( G ) U2OS EMPTY CRISPR , ATG5 CRISPR and ATG7 CRISPR expressing YFP-Parkin were treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 24 h. Mitochondrial depletion was assessed by blotting for various mitochondrial proteins. Data information: ( A , D , G ) blots are representative of three independent experiments. Statistics for all experiments were performed using two-way ANOVA with Tukey correction. * P < 0.05, ** P < 0.01, **** P < 0.0001. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: CRISPR, Staining, Isolation, Expressing

    ( A ) Volcano plot of ubiquitylated proteins in SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. The experiment performed with n = 4 independent repeats. Statistical analysis determining significance (coloured dots) was through using Student’s t test. Plot generated in RStudio. ( B ) Pie chart of ubiquitylated peptides categorised into mitochondrial compartments. Categorisation of peptides was performed using MitoCarta 3.0, UniProt and ProteinAtlas. ( C ) Cellular distribution of all hits from the isolated ubiquitin remnant-containing peptides. Categorisation using MitoCarta 3.0, UniProt and ProteinAtlas. ( D ) GO-term cellular compartment analysis of proteins with increased ubiquitylation after MOMP. Statistical analysis was performed with Fisher’s exact test with corrected with false discovery rate. Graphs shows the top ten most significant hits. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) Volcano plot of ubiquitylated proteins in SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. The experiment performed with n = 4 independent repeats. Statistical analysis determining significance (coloured dots) was through using Student’s t test. Plot generated in RStudio. ( B ) Pie chart of ubiquitylated peptides categorised into mitochondrial compartments. Categorisation of peptides was performed using MitoCarta 3.0, UniProt and ProteinAtlas. ( C ) Cellular distribution of all hits from the isolated ubiquitin remnant-containing peptides. Categorisation using MitoCarta 3.0, UniProt and ProteinAtlas. ( D ) GO-term cellular compartment analysis of proteins with increased ubiquitylation after MOMP. Statistical analysis was performed with Fisher’s exact test with corrected with false discovery rate. Graphs shows the top ten most significant hits. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Generated, Isolation

    ( A ) SVEC4-10 cells treated with for 1 or 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), K63- and K48-specific ubiquitin were used. Blots representative for three independent experiments. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 h. Stained for K63-ubiquitin and mitochondrial COXIV. Images are maximum projections of Z-stacks with a scale bar of 20 μm and are representative of three independent experiments. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial localised K63-ubiquitin puncta. Statistics performed using two-way ANOVA with Tukey correction. ( D ) SVEC4-10 cells expressing doxycycline-inducible K63 or M1-UBDs. Cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Images are representative of three independent experiments with a scale bar of 50 μm. ( E ) Quantification of ( D ) showing the percentage of SVEC4-10 cells with mitochondrial localised GFP-UBDs. Also includes the quantification of U2OS cells expressing doxycycline-inducible K63- or M1-UBDs treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Statistics were performed using multiple unpaired t tests. Data information: ( C , E ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) SVEC4-10 cells treated with for 1 or 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), K63- and K48-specific ubiquitin were used. Blots representative for three independent experiments. ( B ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells treated with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh for 3 h. Stained for K63-ubiquitin and mitochondrial COXIV. Images are maximum projections of Z-stacks with a scale bar of 20 μm and are representative of three independent experiments. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial localised K63-ubiquitin puncta. Statistics performed using two-way ANOVA with Tukey correction. ( D ) SVEC4-10 cells expressing doxycycline-inducible K63 or M1-UBDs. Cells were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Images are representative of three independent experiments with a scale bar of 50 μm. ( E ) Quantification of ( D ) showing the percentage of SVEC4-10 cells with mitochondrial localised GFP-UBDs. Also includes the quantification of U2OS cells expressing doxycycline-inducible K63- or M1-UBDs treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Statistics were performed using multiple unpaired t tests. Data information: ( C , E ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Isolation, Fractionation, CRISPR, Staining, Expressing

    ( A ) Timelapse of U2OS cells expressing GFP-NEMO. Cells were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria and nuclei are visualised using PkMito DeepRed and Hoechst, respectively. Cells were treated for 1 h with images taken every 10 min. Image is representative for three independent experiments. Scale bar is 20 μm. ( B ) U2OS cells expressing GFP-NEMO treated with treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh were quantified for mitochondrial localised GFP-NEMO puncta over time. Puncta are calculated using ImageJ/Fiji “trainable Weka segmentation plug-in”. The graph is representative of three biological repeats and shows the mean +/− s.e.m. (error bars) of five fields of view taken over time. ( C ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( D ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial COXIV. Scale bar is 20 μm. Images are maximum projections of Z-stacks and are representative for three independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with mitochondrial localised GFP-NEMO puncta. ( F ) U2OS cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Scale bar is 20 μm and images are representative for three independent experiments. ( G ) Quantification of ( F ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( H ) Parental SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Scale bar is 50 μm and images are representative for three independent experiments. ( I ) Quantification of ( H ) showing the GFP+ cells with nuclear translocation of p65. Data information: ( E , G , I ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics are performed using two-way ANOVA with Tukey correction. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) Timelapse of U2OS cells expressing GFP-NEMO. Cells were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria and nuclei are visualised using PkMito DeepRed and Hoechst, respectively. Cells were treated for 1 h with images taken every 10 min. Image is representative for three independent experiments. Scale bar is 20 μm. ( B ) U2OS cells expressing GFP-NEMO treated with treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh were quantified for mitochondrial localised GFP-NEMO puncta over time. Puncta are calculated using ImageJ/Fiji “trainable Weka segmentation plug-in”. The graph is representative of three biological repeats and shows the mean +/− s.e.m. (error bars) of five fields of view taken over time. ( C ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( D ) U2OS EMPTY CRISPR and BAX/BAK CRISPR cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial COXIV. Scale bar is 20 μm. Images are maximum projections of Z-stacks and are representative for three independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with mitochondrial localised GFP-NEMO puncta. ( F ) U2OS cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 3 h with 10 μΜ ABT-737, 2 μΜ S63845 and 20 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Scale bar is 20 μm and images are representative for three independent experiments. ( G ) Quantification of ( F ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( H ) Parental SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO, GFP-NEMOD311N or GFP-NEMOΔZF were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Scale bar is 50 μm and images are representative for three independent experiments. ( I ) Quantification of ( H ) showing the GFP+ cells with nuclear translocation of p65. Data information: ( E , G , I ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics are performed using two-way ANOVA with Tukey correction. ** P < 0.01, *** P < 0.001. **** P < 0.0001. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Expressing, Isolation, CRISPR, Translocation Assay

    ( A ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( B ) SVEC4-10 cells pre-treated with 2 μΜ TAK-243 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Blots are representative for four independent experiments. ( C ) Upper: SVEC4-10 cells expressing GFP-NEMO were pre-treated for 1 h with 2 μΜ TAK-243 followed by 1 h treatment of 10 μΜ ABT-737, 10 μΜ S63845, 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Cells were immunostained for TOM20 and ubiquitin (FK2). Scale bar is 50 μm and images are representative for three independent experiments. Lower : quantification showing the percentage of cells with mitochondrial localised GFP-NEMO and ubiquitin puncta. ( D ) SVEC4-10 cells pre-treated with 1 μΜ MLN4924 (NAE inhibitor) for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Blots are representative for two independent experiments. ( E ) SVEC4-10 cells expressing GFP-NEMO pre-treated with 1 μΜ MLN4924 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments and are shown with a 50 μm scale bar. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Data information: graphs in ( C , F ) display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001.

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using Dounce homogeniser and cellular fractions were probed with relevant antibodies. Mitochondrial localised NEMO was quantified normalising to mitochondrial content defined by HSP60 signal. ( B ) SVEC4-10 cells pre-treated with 2 μΜ TAK-243 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Blots are representative for four independent experiments. ( C ) Upper: SVEC4-10 cells expressing GFP-NEMO were pre-treated for 1 h with 2 μΜ TAK-243 followed by 1 h treatment of 10 μΜ ABT-737, 10 μΜ S63845, 30 μΜ Q-VD-OPh with or without 2 μΜ TAK-243. Cells were immunostained for TOM20 and ubiquitin (FK2). Scale bar is 50 μm and images are representative for three independent experiments. Lower : quantification showing the percentage of cells with mitochondrial localised GFP-NEMO and ubiquitin puncta. ( D ) SVEC4-10 cells pre-treated with 1 μΜ MLN4924 (NAE inhibitor) for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Blots are representative for two independent experiments. ( E ) SVEC4-10 cells expressing GFP-NEMO pre-treated with 1 μΜ MLN4924 for 1 h followed by additional 1 h treatment with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 1 μΜ MLN4924. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments and are shown with a 50 μm scale bar. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Data information: graphs in ( C , F ) display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001.

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Isolation, Expressing, Translocation Assay

    ( A ) MEF Tnf -/- /Hoip +/+ and Tnf -/- /Hoip -/- expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 5 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative of three independent experiments. ( B ) Quantification of A showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistical analysis was performed using two-way ANOVA with Tukey correction. ( C ) Validation of SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO. Lysates were blotted for NEMO and α-tubulin. ( D ) SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Images are representative of two independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with nuclear translocation of p65. Graph displays mean values ± s.e.m. (error bars) of n = 2 independent experiments. **** P < 0.0001.

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) MEF Tnf -/- /Hoip +/+ and Tnf -/- /Hoip -/- expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 5 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative of three independent experiments. ( B ) Quantification of A showing the percentage of cells with mitochondrial translocation of GFP-NEMO. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistical analysis was performed using two-way ANOVA with Tukey correction. ( C ) Validation of SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO. Lysates were blotted for NEMO and α-tubulin. ( D ) SVEC4-10, SVEC4-10 GFP-NEMO and SVEC4-10 GFP-D311N cells transfected with NTC or siNEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for p65 and DAPI. Images are representative of two independent experiments. ( E ) Quantification of ( D ) showing the percentage of cells with nuclear translocation of p65. Graph displays mean values ± s.e.m. (error bars) of n = 2 independent experiments. **** P < 0.0001.

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Expressing, Translocation Assay, Transfection

    ( A ) Lysates of U2OS, SVEC4-10 and SHSHY-5Y cells were blotted for Parkin and Actin. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing GFP-NEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( D ) SVEC4-10 EMPTY CRISPR , MUL1 CRISPR , MARCH5 CRISPR and MUL1/MARCH5 CRISPR treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Lysates were blotted for p-ΙκΒα, ΙκΒα, MARCH5 and Actin. Blots are representative of three independent experiments. KO-scores of MUL1 and MARCH5 are calculated via ICE analysis. ( E ) SVEC4-10 EMPTY CRISPR and MUL1/MARCH5 CRISPR cells expressing GFP-NEMO treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (UBCJ2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( G ) SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( H ) Quantification of ( G ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( I ) SVEC4-10 EMPTY CRISPR and NIK CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Images are immunostained with mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( J ) Quantification of ( I ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO. Data information: ( C , F , H , J ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) Lysates of U2OS, SVEC4-10 and SHSHY-5Y cells were blotted for Parkin and Actin. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing GFP-NEMO were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( C ) Quantification of ( B ) showing the percentage of cells with mitochondrial translocation of GFP-NEMO. ( D ) SVEC4-10 EMPTY CRISPR , MUL1 CRISPR , MARCH5 CRISPR and MUL1/MARCH5 CRISPR treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Lysates were blotted for p-ΙκΒα, ΙκΒα, MARCH5 and Actin. Blots are representative of three independent experiments. KO-scores of MUL1 and MARCH5 are calculated via ICE analysis. ( E ) SVEC4-10 EMPTY CRISPR and MUL1/MARCH5 CRISPR cells expressing GFP-NEMO treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (UBCJ2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( F ) Quantification of ( E ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( G ) SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative for three independent experiments with a scale bar of 50 μm. ( H ) Quantification of ( G ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( I ) SVEC4-10 EMPTY CRISPR and NIK CRISPR cells expressing GFP-NEMO were treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh for 1 h. Images are immunostained with mitochondrial TOM20 and DAPI. Images are representative for three independent experiments with a scale bar of 50 μm. ( J ) Quantification of ( I ) showing the percentage of cells with mitochondrial localisation of GFP-NEMO. Data information: ( C , F , H , J ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Tukey correction. **** P < 0.0001. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: CRISPR, Expressing, Translocation Assay

    ( A ) Validation of PINK1 knockout in SVEC4-10 cells with or without GFP-NEMO expression using genomic PCR and ICE (inference of CRISPR edits) analysis. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing YFP-Parkin were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or for 3 h with 10 μΜ CCCP. Mitochondria were immunostained with HSP60 and DAPI. Images are representative of two independent experiments and displayed with 50 μm scale bar. ( C ) Validation of MUL1 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( D ) Validation of MARCH5 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( E ) Validation of SVEC4-10 XIAP CRISPR cells with and without GFP-NEMO expression using western blot. Lysates were blotted for XIAP and Actin. ( F ) Tnf , Kc , and Ccl5 expression of SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD for 3 h. Graph is representative of three independent experiments. ( G ) Validation of NIK knockout in GFP-NEMO expressing SVEC4-10 EMPTY CRISPR and NIK CRISPR cells. Cells were treated for 2 h with 10 μM MG-132. Lysates were blotted for NIK and actin.

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) Validation of PINK1 knockout in SVEC4-10 cells with or without GFP-NEMO expression using genomic PCR and ICE (inference of CRISPR edits) analysis. ( B ) SVEC4-10 EMPTY CRISPR and PINK1 CRISPR cells expressing YFP-Parkin were treated for 1 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or for 3 h with 10 μΜ CCCP. Mitochondria were immunostained with HSP60 and DAPI. Images are representative of two independent experiments and displayed with 50 μm scale bar. ( C ) Validation of MUL1 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( D ) Validation of MARCH5 knockout in SVEC4-10 MUL1/MARCH5 CRISPR cells using genomic PCR and ICE analysis. ( E ) Validation of SVEC4-10 XIAP CRISPR cells with and without GFP-NEMO expression using western blot. Lysates were blotted for XIAP and Actin. ( F ) Tnf , Kc , and Ccl5 expression of SVEC4-10 EMPTY CRISPR and XIAP CRISPR cells treated with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD for 3 h. Graph is representative of three independent experiments. ( G ) Validation of NIK knockout in GFP-NEMO expressing SVEC4-10 EMPTY CRISPR and NIK CRISPR cells. Cells were treated for 2 h with 10 μM MG-132. Lysates were blotted for NIK and actin.

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Knock-Out, Expressing, CRISPR, Western Blot

    ( A ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GAPDH were used. ( B ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments in which the percentage of cells with mitochondrial localisation of GFP-NEMO was analysed. ( C ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 and 5 μΜ antimycin A or 3 μΜ erastin. ROS levels were determined using MitoSOX Red via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( D ) SVEC4-10 cells were treated with 0.5, 1, 5, 10 and 20 μΜ erastin. Mitochondrial calcium was measured using Rhod2-AM via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( E ) SVEC4-10 cells were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GADPH were used. ( F ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments showing the percentage of cells with mitochondrial localisation of GFP-NEMO, error bars represent s.e.m. ( G ) EMPTY CRISPR and BAX/BAK CRISPR validation of SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO. Lysates for blotted for BAX, BAK and α-tubulin. ( H ) SVEC4-10 EMPTY CRISPR and SVEC4-10 BAX/BAK CRISPR cells treated with 10 μΜ ABT-737 and 10 μΜ S63845 or treated with 2.5 or 10 μΜ raptinal. Caspase-dependency of death was assessed using 30 μΜ Q-VD-OPh. Cell viability was measured using Sytox Green exclusion. Graphs are representative of two independent experiments and display the mean and s.e.m. of two replicates. ( I ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR. Two repeats of Fig. . Data information: ( A , E ) blots are representative for three independent experiments. Statistics performed using two-way ANOVA with Tukey correction. *** P < 0.001, **** P < 0.0001.

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GAPDH were used. ( B ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 1 μΜ rotenone, 1 μΜ oligomycin, 5 μΜ antimycin A, 3 μΜ erastin or the combination 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments in which the percentage of cells with mitochondrial localisation of GFP-NEMO was analysed. ( C ) SVEC4-10 cells were treated for 2 h with 1 μΜ rotenone, 1 and 5 μΜ antimycin A or 3 μΜ erastin. ROS levels were determined using MitoSOX Red via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( D ) SVEC4-10 cells were treated with 0.5, 1, 5, 10 and 20 μΜ erastin. Mitochondrial calcium was measured using Rhod2-AM via flow cytometry. Graph displays mean values ± s.e.m. (error bars) of n = 3 independent experiments. ( E ) SVEC4-10 cells were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Mitochondria were isolated using digitonin fractionation buffer and antibodies against ubiquitin (UBCJ2), HSP60 and GADPH were used. ( F ) SVEC4-10 cells expressing GFP-NEMO were treated for 2 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh with or without 25 μM cyclosporin A. Cells were immunostained with mitochondrial TOM20 and DAPI for confocal microscopy. Graph shows the quantification of three independent experiments showing the percentage of cells with mitochondrial localisation of GFP-NEMO, error bars represent s.e.m. ( G ) EMPTY CRISPR and BAX/BAK CRISPR validation of SVEC4-10 cells and SVEC4-10 cells expressing GFP-NEMO. Lysates for blotted for BAX, BAK and α-tubulin. ( H ) SVEC4-10 EMPTY CRISPR and SVEC4-10 BAX/BAK CRISPR cells treated with 10 μΜ ABT-737 and 10 μΜ S63845 or treated with 2.5 or 10 μΜ raptinal. Caspase-dependency of death was assessed using 30 μΜ Q-VD-OPh. Cell viability was measured using Sytox Green exclusion. Graphs are representative of two independent experiments and display the mean and s.e.m. of two replicates. ( I ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR. Two repeats of Fig. . Data information: ( A , E ) blots are representative for three independent experiments. Statistics performed using two-way ANOVA with Tukey correction. *** P < 0.001, **** P < 0.0001.

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Isolation, Fractionation, Expressing, Confocal Microscopy, Flow Cytometry, CRISPR, Quantitative RT-PCR

    ( A ) SVEC4-10 cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative of three independent experiments displayed with a 50 μm scale bar. ( B ) SVEC EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 µM ABT-737, 10 µM S63845 and 30 µM Q-VD-OPh or 2.5 µM raptinal and 30 µM Q-VD-OPh. Graphs show the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained stained for p65 and DAPI. Images are representative of three independent experiments. Scale bar is 50 μm. ( D ) Quantification of ( C ) showing the percentage of cells with nuclear translocation of p65. ( E ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR, graphs are representative for three independent experiments. Data information: ( B , D ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Dunnett correction. **** P < 0.0001. .

    Journal: The EMBO Journal

    Article Title: Mitochondrial outer membrane integrity regulates a ubiquitin-dependent and NF-κB-mediated inflammatory response

    doi: 10.1038/s44318-024-00044-1

    Figure Lengend Snippet: ( A ) SVEC4-10 cells expressing GFP-NEMO were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained for ubiquitin (FK2) and mitochondrial TOM20. Images are representative of three independent experiments displayed with a 50 μm scale bar. ( B ) SVEC EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 µM ABT-737, 10 µM S63845 and 30 µM Q-VD-OPh or 2.5 µM raptinal and 30 µM Q-VD-OPh. Graphs show the percentage of cells with mitochondrial localisation of GFP-NEMO and ubiquitin. ( C ) SVEC4-10 EMPTY CRISPR and BAX/BAK CRISPR cells were treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63845 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Cells were immunostained stained for p65 and DAPI. Images are representative of three independent experiments. Scale bar is 50 μm. ( D ) Quantification of ( C ) showing the percentage of cells with nuclear translocation of p65. ( E ) SVEC4-10 cells treated for 3 h with 10 μΜ ABT-737, 10 μΜ S63856 and 30 μΜ Q-VD-OPh or 2.5 μΜ raptinal and 30 μΜ Q-VD-OPh. Expression of Kc , Tnf and Actin were validated using RT-qPCR, graphs are representative for three independent experiments. Data information: ( B , D ) graphs display mean values ± s.e.m. (error bars) of n = 3 independent experiments. Statistics were performed using two-way ANOVA with Dunnett correction. **** P < 0.0001. .

    Article Snippet: SVEC4-10 cells were purchased from ATCC.

    Techniques: Expressing, CRISPR, Staining, Translocation Assay, Quantitative RT-PCR

    a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer

    doi: 10.1038/s41467-023-43743-9

    Figure Lengend Snippet: a GSEA (Panther pathway analysis) of cGAS in liver cancer from TCGA ( n = 371). b Correlation analysis of cGAS expression in non-tumor-associated endothelial cell (non-TEC) cells with STING and ISGs expressions in paired TECs from liver cancer tissues of the same patient via magnetic-activated cell sorting (MACS) in the GSE51401 dataset ( n = 8 pairs). c STING and ISGs expressions of TECs versus normal endothelial cells (NECs) in the GSE51401 dataset ( n = 16 pairs). d Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas or Ctrl cells ( n = 4). e Representative immunofluorescence images and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6- Cgas or Ctrl cells ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells. Representative of n = 3 independent experiments. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). P values are calculated using two-tailed Pearson correlation coefficient ( b ), two-tailed paired Student’s t test ( c ) and unpaired Student’s t test ( d , e , g ). Source data are provided as a Source Data file.

    Article Snippet: The murine endothelial cell line SVEC4-10 (CRL-2181) was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA).

    Techniques: Expressing, FACS, Immunofluorescence, Over Expression, Cell Culture, Labeling, Two Tailed Test

    a Representative images and quantifications of SVEC4-10 cells that migrated towards Hepa1-6- Cgas or Ctrl cells in Transwell assays ( n = 5). b Transendothelial migration (TEM) of mouse splenic lymphocytes through SVEC4-10 cell barrier with cGAMP pre-treatment or not ( n = 3). c TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pre-treatment of CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). d Protein levels of Sting in splenic lymphocytes from Sting −/− or WT mice. Representative of n = 3 independent experiments. e TEM of Sting −/− or WT mice-derived lymphocytes through SVEC4-10 cell barrier ( n = 3). f , g Flow cytometric analysis and mean fluorescence intensity (MFI) of surface VE-Cad in SVEC4-10 cells after cGAMP treatment ( f ) ( n = 3), co-cultured with Hepa1-6- Cgas or Ctrl cells ( g ) ( n = 3). h mRNA levels of indicated genes in SVEC4-10 cells after cGAMP treatment ( n = 3). i mRNA levels of indicated genes in SVEC4-10 cells co-cultured with Hepa1-6- Cgas or Ctrl cells ( n = 3). j mRNA levels of indicated genes in SVEC4-10 cells with Sting knocked out (sg Sting ) or Ctrl cells (sgCtrl) ( n = 3). P values are calculated using unpaired Student’s t test ( a – c , e – j ). ns, not significant. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer

    doi: 10.1038/s41467-023-43743-9

    Figure Lengend Snippet: a Representative images and quantifications of SVEC4-10 cells that migrated towards Hepa1-6- Cgas or Ctrl cells in Transwell assays ( n = 5). b Transendothelial migration (TEM) of mouse splenic lymphocytes through SVEC4-10 cell barrier with cGAMP pre-treatment or not ( n = 3). c TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pre-treatment of CM from Hepa1-6- Cgas or Ctrl cells ( n = 3). d Protein levels of Sting in splenic lymphocytes from Sting −/− or WT mice. Representative of n = 3 independent experiments. e TEM of Sting −/− or WT mice-derived lymphocytes through SVEC4-10 cell barrier ( n = 3). f , g Flow cytometric analysis and mean fluorescence intensity (MFI) of surface VE-Cad in SVEC4-10 cells after cGAMP treatment ( f ) ( n = 3), co-cultured with Hepa1-6- Cgas or Ctrl cells ( g ) ( n = 3). h mRNA levels of indicated genes in SVEC4-10 cells after cGAMP treatment ( n = 3). i mRNA levels of indicated genes in SVEC4-10 cells co-cultured with Hepa1-6- Cgas or Ctrl cells ( n = 3). j mRNA levels of indicated genes in SVEC4-10 cells with Sting knocked out (sg Sting ) or Ctrl cells (sgCtrl) ( n = 3). P values are calculated using unpaired Student’s t test ( a – c , e – j ). ns, not significant. Source data are provided as a Source Data file.

    Article Snippet: The murine endothelial cell line SVEC4-10 (CRL-2181) was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA).

    Techniques: Migration, Derivative Assay, Fluorescence, Cell Culture

    a Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with genes related to cGAS-STING, vascular stabilization, endothelial-T cell interaction, and pericyte/T cell chemotaxis in HCC from TCGA dataset ( n = 371). b Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with CD8 + T cell infiltration in HCC from TCGA dataset through TIMER and MCP-counter ( n = 371). c GSEA (Panther pathway analysis) of LRRC8C in liver cancer from TCGA ( n = 371). d Protein levels of Cgas and Lrrc8c in Hepa1-6- Cgas cells with Lrrc8c knocked down by siRNA (Hepa1-6- Cgas -si Lrrc8c ) or Ctrl cells (Hepa1-6- Cgas -siCtrl). e Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 4). f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 3). h Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment. i mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). j Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells. k mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells ( n = 3). l mRNA levels of indicated genes in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells (n = 3). m mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). n mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells (n = 3). P values are calculated using two-tailed unpaired Student’s t test ( e , g , i , k–n ). ns, not significant. Representative of n = 3 independent experiments ( d , f , h , j ). Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer

    doi: 10.1038/s41467-023-43743-9

    Figure Lengend Snippet: a Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with genes related to cGAS-STING, vascular stabilization, endothelial-T cell interaction, and pericyte/T cell chemotaxis in HCC from TCGA dataset ( n = 371). b Pearson’s correlation of SLC (SLC19A1/SLC46A2) and VARC (LRRC8A-E) expressions with CD8 + T cell infiltration in HCC from TCGA dataset through TIMER and MCP-counter ( n = 371). c GSEA (Panther pathway analysis) of LRRC8C in liver cancer from TCGA ( n = 371). d Protein levels of Cgas and Lrrc8c in Hepa1-6- Cgas cells with Lrrc8c knocked down by siRNA (Hepa1-6- Cgas -si Lrrc8c ) or Ctrl cells (Hepa1-6- Cgas -siCtrl). e Intercellular and extracellular cGAMP levels from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 4). f Protein levels of markers in the Sting pathway in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells. g mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells ( n = 3). h Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment. i mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). j Protein levels of Lrrc8c and markers in the Sting pathway in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells. k mRNA levels of Ifnβ and ISGs in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells ( n = 3). l mRNA levels of indicated genes in SVEC4-10 cells after exposure to CM from Hepa1-6- Cgas -si Lrrc8c or Cgas -siCtrl cells (n = 3). m mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after cGAMP treatment ( n = 3). n mRNA levels of indicated genes in SVEC4-10-si Lrrc8c or siCtrl cells after exposure to CM from Hepa1-6- Cgas cells (n = 3). P values are calculated using two-tailed unpaired Student’s t test ( e , g , i , k–n ). ns, not significant. Representative of n = 3 independent experiments ( d , f , h , j ). Source data are provided as a Source Data file.

    Article Snippet: The murine endothelial cell line SVEC4-10 (CRL-2181) was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA).

    Techniques: Chemotaxis Assay, Two Tailed Test

    a , b Cgas mRNA ( a ) and protein ( b ) levels in VC-treated Hepa1-6 cells ( n = 3). c Cgas protein level in Hepa1-6 cells-derived tumor after VC or Sora treatment for 2 weeks. d Immunofluorescence costaining of dsDNA, HSP60, and DAPI in VC-treated Hepa1-6 cells. Scale bars, 5 μm. e Cgas mRNA level in VC-treated Hepa1-6 cells following NAC pretreatment ( n = 3). f Cgas mRNA level in VC-treated Hepa1-6 sh Tet2 cells and shCtrl cells ( n = 3). g Cgas mRNA level in VC-treated Hepa1-6 cells following TFMB-2-HG pretreatment ( n = 3). h Intercellular and extracellular cGAMP levels from VC-treated Hepa1-6 cells ( n = 4). i Pyrosequencing analysis and quantification of the promoter methylation status of Cgas in VC-treated Hepa1-6 cells ( n = 3). j Immunofluorescence staining and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6 cells after VC treatment ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. k , l mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( k ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( l ) ( n = 3). m – o TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pretreatment of CM from Hepa1-6 cells ( m ), Hepa1-6 sg Cgas cells ( n ), or Hepa1-6 sh Tet2 cells ( o ) treated with VC or not ( n = 3). p Flow cytometric analysis and MFI of surface VE-Cad in SVEC4-10-GFP cells co-cultured with Hepa1-6 cells after VC treatment ( n = 3). q – t , mRNA levels of VE-Cad ( q , r ) and indicated genes ( s , t ) in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( q , s ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( r , t ) ( n = 3). P values are calculated using two-tailed unpaired Student’s t test ( a , e – h, j , k – t ) and paired Student’s t test ( i ). ns, not significant. Representative of n = 3 independent experiments ( b – d ). Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer

    doi: 10.1038/s41467-023-43743-9

    Figure Lengend Snippet: a , b Cgas mRNA ( a ) and protein ( b ) levels in VC-treated Hepa1-6 cells ( n = 3). c Cgas protein level in Hepa1-6 cells-derived tumor after VC or Sora treatment for 2 weeks. d Immunofluorescence costaining of dsDNA, HSP60, and DAPI in VC-treated Hepa1-6 cells. Scale bars, 5 μm. e Cgas mRNA level in VC-treated Hepa1-6 cells following NAC pretreatment ( n = 3). f Cgas mRNA level in VC-treated Hepa1-6 sh Tet2 cells and shCtrl cells ( n = 3). g Cgas mRNA level in VC-treated Hepa1-6 cells following TFMB-2-HG pretreatment ( n = 3). h Intercellular and extracellular cGAMP levels from VC-treated Hepa1-6 cells ( n = 4). i Pyrosequencing analysis and quantification of the promoter methylation status of Cgas in VC-treated Hepa1-6 cells ( n = 3). j Immunofluorescence staining and quantification for Sting aggregates in SVEC4-10 cells with Sting -Cherry overexpression co-cultured with GFP-labeled Hepa1-6 cells after VC treatment ( n = 4). The white arrows represent Sting aggregates in SVEC4-10 cells. Scale bars, 50 μm. k , l mRNA levels of Ifnβ and ISGs in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( k ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( l ) ( n = 3). m – o TEM of mouse splenic lymphocytes through SVEC4-10 cell barrier with pretreatment of CM from Hepa1-6 cells ( m ), Hepa1-6 sg Cgas cells ( n ), or Hepa1-6 sh Tet2 cells ( o ) treated with VC or not ( n = 3). p Flow cytometric analysis and MFI of surface VE-Cad in SVEC4-10-GFP cells co-cultured with Hepa1-6 cells after VC treatment ( n = 3). q – t , mRNA levels of VE-Cad ( q , r ) and indicated genes ( s , t ) in SVEC4-10 cells after exposure to CM from VC-treated Hepa1-6 sg Cgas cells versus sgCtrl cells ( q , s ) or Hepa1-6 sh Tet2 cells versus shCtrl cells ( r , t ) ( n = 3). P values are calculated using two-tailed unpaired Student’s t test ( a , e – h, j , k – t ) and paired Student’s t test ( i ). ns, not significant. Representative of n = 3 independent experiments ( b – d ). Source data are provided as a Source Data file.

    Article Snippet: The murine endothelial cell line SVEC4-10 (CRL-2181) was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA).

    Techniques: Derivative Assay, Immunofluorescence, Methylation, Staining, Over Expression, Cell Culture, Labeling, Two Tailed Test