|
Covaris
2a micro vortex xw 80a 2800 r 2a Micro Vortex Xw 80a 2800 R, supplied by Covaris, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2a micro vortex xw 80a 2800 r/product/Covaris Average 86 stars, based on 1 article reviews
2a micro vortex xw 80a 2800 r - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Exosome Diagnostics
ogd r treated neuro 2a cells Ogd R Treated Neuro 2a Cells, supplied by Exosome Diagnostics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ogd r treated neuro 2a cells/product/Exosome Diagnostics Average 86 stars, based on 1 article reviews
ogd r treated neuro 2a cells - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Millipore
lamp 2a ko pb f ccactgagaggctaatctggctatg genotyping pb r tcactggttccctaactgactatgc Lamp 2a Ko Pb F Ccactgagaggctaatctggctatg Genotyping Pb R Tcactggttccctaactgactatgc, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lamp 2a ko pb f ccactgagaggctaatctggctatg genotyping pb r tcactggttccctaactgactatgc/product/Millipore Average 86 stars, based on 1 article reviews
lamp 2a ko pb f ccactgagaggctaatctggctatg genotyping pb r tcactggttccctaactgactatgc - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
SPSS Inc
2a b right eye left eye a b c d e f g h i j k l m n o p q r s t 2a B Right Eye Left Eye A B C D E F G H I J K L M N O P Q R S T, supplied by SPSS Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2a b right eye left eye a b c d e f g h i j k l m n o p q r s t/product/SPSS Inc Average 86 stars, based on 1 article reviews
2a b right eye left eye a b c d e f g h i j k l m n o p q r s t - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Nextera AS
index first pcr nextera 2a r gtctcgtgggctcggagatgtgtataagagacag 1st tnr gtaatacgactcactatagggtctagag second pcr Index First Pcr Nextera 2a R Gtctcgtgggctcggagatgtgtataagagacag 1st Tnr Gtaatacgactcactatagggtctagag Second Pcr, supplied by Nextera AS, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/index first pcr nextera 2a r gtctcgtgggctcggagatgtgtataagagacag 1st tnr gtaatacgactcactatagggtctagag second pcr/product/Nextera AS Average 86 stars, based on 1 article reviews
index first pcr nextera 2a r gtctcgtgggctcggagatgtgtataagagacag 1st tnr gtaatacgactcactatagggtctagag second pcr - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Abmart Inc
5 ht 2a r 5 Ht 2a R, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 ht 2a r/product/Abmart Inc Average 86 stars, based on 1 article reviews
5 ht 2a r - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Jackson Immuno
igg r pe Igg R Pe, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igg r pe/product/Jackson Immuno Average 95 stars, based on 1 article reviews
igg r pe - by Bioz Stars,
2025-07
95/100 stars
|
Buy from Supplier |
|
Revvity
2a r nl 2a R Nl, supplied by Revvity, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2a r nl/product/Revvity Average 86 stars, based on 1 article reviews
2a r nl - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
|
Kyowa Hakko Kirin Korea Co Ltd
a 2a r antagonist istradefylline A 2a R Antagonist Istradefylline, supplied by Kyowa Hakko Kirin Korea Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a 2a r antagonist istradefylline/product/Kyowa Hakko Kirin Korea Co Ltd Average 86 stars, based on 1 article reviews
a 2a r antagonist istradefylline - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |