snap capture magnetic beads  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    SNAP Capture Magnetic Beads
    Description:
    SNAP Capture Magnetic Beads 2ml
    Catalog Number:
    S9145S
    Price:
    215
    Size:
    2 ml
    Category:
    Protein Purification Kit Components
    Buy from Supplier


    Structured Review

    New England Biolabs snap capture magnetic beads
    SNAP Capture Magnetic Beads
    SNAP Capture Magnetic Beads 2ml
    https://www.bioz.com/result/snap capture magnetic beads/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    snap capture magnetic beads - by Bioz Stars, 2019-06
    95/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Caenorhabditis elegans Galectins LEC-6 and LEC-10 Interact with Similar Glycoconjugates in the Intestine
    Article Snippet: 100 μl of SNAP-capture magnetic beads (NEB S9145) (with a coupling capacity of 0.5 mg/ml for SNAP protein) were washed twice in immobilization buffer (50 mm Tris-Cl, pH 7.5, 100 mm NaCl, 1 mm DTT, and 0.1% Tween 20). .. After immobilizing the SNAP-tagged galectin onto the SNAP-capture magnetic beads, the beads were washed three times with immobilization buffer followed by two washes in RIPA buffer (1% Nonidet P-40, 20 mm Tris, pH 7.5, 1 mm EDTA, 1% Triton, 0.1% sodium deoxycholate, 0.1% SDS, 150 mm NaCl).

    Amplification:

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: The purified amplicons were eluted in 15 μL of water where 3 μL was subjected to gel electrophoresis to verify amplification. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins.

    Incubation:

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min. .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min.

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min. .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min.

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: The human breast cancer tissue microarray samples (BR804, BC08013a, and BR10010a) were purchased from US Biomax Inc (Rockville, MD). .. COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA). .. For proteomic analysis, bound proteins were released by trypsin digestion.

    Article Title: Super-resolution imaging and tracking of protein–protein interactions in sub-diffraction cellular space
    Article Snippet: 50 ml cultures (OD(600)=0.5) were harvested and lysed. .. Cleared cell lysates were incubated for different time with 100 μl Snap capture beads (NEB) to pull down MreB interacting proteins. .. The specific interaction between MreB and EF-Tu was then verified by western blotting using an EF-Tu antibody (Hucult Biotech).

    Article Title: Lis1 has two opposing modes of regulating cytoplasmic dynein
    Article Snippet: Dynein was imaged every 1 sec for a total of 5 sec. Each sample was imaged at 4 different fields of view. .. Sixteen µL of magnetic SNAP-Capture beads (NEB) were incubated with increasing concentrations of SNAP-Lis1 (0–600 nM) in modified TEV buffer for 1 hour at room temperature with agitation. .. The supernatant was removed, the beads were washed with 1 ml of modified TEV buffer followed by 1 ml of TEV buffer supplemented with 1 mM DTT, 0.1% NP40, 2 mM MgCl2 , 1 mM ATP, and 1 mM NaVO4 .

    Mass Spectrometry:

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA). .. COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA).

    BIA-KA:

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Modification:

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: For affinity purification, we used a modified protocol from Zlatic et al. ( ). .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min.

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: For affinity purification, we used a modified protocol from Zlatic et al. ( ). .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min.

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: To detect gene-specific methylation, the isothermal recombinase polymerase amplification [ ] (RPA, TwistDx, UK) was employed to amplify the GSTP1 locus with primers described above in a modified RPA protocol. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins.

    Article Title: Lis1 has two opposing modes of regulating cytoplasmic dynein
    Article Snippet: Dynein was imaged every 1 sec for a total of 5 sec. Each sample was imaged at 4 different fields of view. .. Sixteen µL of magnetic SNAP-Capture beads (NEB) were incubated with increasing concentrations of SNAP-Lis1 (0–600 nM) in modified TEV buffer for 1 hour at room temperature with agitation. .. The supernatant was removed, the beads were washed with 1 ml of modified TEV buffer followed by 1 ml of TEV buffer supplemented with 1 mM DTT, 0.1% NP40, 2 mM MgCl2 , 1 mM ATP, and 1 mM NaVO4 .

    Western Blot:

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA). .. Resulting peptides were analyzed on a Thermo LTQ Orbitrap XL mass spectrometer (Thermo Scientific, Waltham, MA), and the resulting mass spectra were analyzed by Inspect search.

    Recombinase Polymerase Amplification:

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: Briefly, 1 μL of gDNA from the above step was used for each 12.5 μL RPA reaction supplemented with 10 μM biotin-14-dUTP and 7 mM MgOAc at 37 °C for 15 min. After amplification, 12.5 μL of Agencourt AMPure XP bead solution was used to remove excess biotin and purify amplicons. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins.

    Transfection:

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: The human breast cancer tissue microarray samples (BR804, BC08013a, and BR10010a) were purchased from US Biomax Inc (Rockville, MD). .. COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA). .. For proteomic analysis, bound proteins were released by trypsin digestion.

    Magnetic Beads:

    Article Title: Global cellular response to chemotherapy-induced apoptosis
    Article Snippet: Purified RNA pellet was resuspended in 100 µl RNAse-free water. .. Total RNA concentration (as shown in ) was measured spectrophotometrically using a NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher, Waltham, MA, USA). mRNA was further purified by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA). .. Total RNA samples were diluted with 500 µl of kit Lysis/Binding buffer and bound to of equilibrated beads (100 µl bead slurry used).

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: For affinity purification, we used a modified protocol from Zlatic et al. ( ). .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min. .. The clarified supernatant was removed and the beads were incubated overnight in an end-over-end rocker at 4°C in a buffer containing 3% BSA, 10 mM HEPES, 5 mM MgSO4 , 1 mM DTT, 25 mM NaCl, and protease inhibitors at pH 7.4.

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: For affinity purification, we used a modified protocol from Zlatic et al. ( ). .. SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min. .. The clarified supernatant was removed and the beads were incubated overnight in an end-over-end rocker at 4°C in a buffer containing 3% BSA, 10 mM HEPES, 5 mM MgSO4 , 1 mM DTT, 25 mM NaCl, and protease inhibitors at pH 7.4.

    Article Title: Caenorhabditis elegans Galectins LEC-6 and LEC-10 Interact with Similar Glycoconjugates in the Intestine
    Article Snippet: The constructs were then injected at a concentration of 10 μg/ml along with 50 μg/ml of pRF4 as a co-transformation marker to generate transgenic animals carrying extra chromosomal arrays. .. 100 μl of SNAP-capture magnetic beads (NEB S9145) (with a coupling capacity of 0.5 mg/ml for SNAP protein) were washed twice in immobilization buffer (50 mm Tris-Cl, pH 7.5, 100 mm NaCl, 1 mm DTT, and 0.1% Tween 20). .. The equilibrated beads were then added to 200 μl of immobilization buffer containing 200 μg of active SNAP-tagged galectin supplemented with an additional 1 mm of DTT and incubated for an hour at room temperature with rotation.

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: ESR1 forward and reverse primers were GTTCGTCCTGGGACTGCACTTGCTCCCGTC and AGATGCTTTGGTGTGGAGGGTCATGGTCATGGT, respectively. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins. .. After collecting DNA-bound beads with a magnet and three 1× PBS washes, 50 μL of TMB substrate solution was allowed to react with the captured HRP and absorbance readings were taken after a 15-min incubation.

    Article Title: Dynein Engages and Disassembles Cytosol-Localized Simian Virus 40 To Promote Infection
    Article Snippet: The generation of the GFP IC2 N237 plasmid is described in reference , and the source of IC2SNAP-3×FLAG and GFP p62HALO-3×FLAG is Michael Cianfrocco (University of Michigan). .. Nocodazole, Triton X-100, dithiothreitol (DTT), and phenylmethanesulfonyl fluoride (PMSF) were purchased from Sigma; SNAP capture magnetic beads, from New England BioLabs (Ipswich, MA); protein G-conjugated magnetic beads and dithiobis(succinimidyl propionate) (DSP), from Thermo Fisher (Rockford, IL); ciliobrevin D and digitonin, from EMD Millipore (San Diego, CA). .. SV40 was purified as described previously ( ).

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: For B-cell analysis, proteomics were performed at each time point, while ribosome profiling and mRNA-seq analysis were performed in biological duplicate on the baseline sample alone as the cells are not perturbed during the time course. .. Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Generated:

    Article Title: Super-resolution imaging and tracking of protein–protein interactions in sub-diffraction cellular space
    Article Snippet: Snap-tagged MreB strain was generated by lambda red recombination. .. Cleared cell lysates were incubated for different time with 100 μl Snap capture beads (NEB) to pull down MreB interacting proteins.

    Affinity Purification:

    Article Title: The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length
    Article Snippet: Paragraph title: SNAP affinity purification ... SNAP magnetic beads (Cat. No. S9145S; New England Biolabs) were prepared as follows: for each strain, 40 μl of the SNAP magnetic beads were spun down at room temperature using a bench-top minicentrifuge at top speed (14,000 × g ) for 1 min.

    Binding Assay:

    Article Title: Lis1 has two opposing modes of regulating cytoplasmic dynein
    Article Snippet: Paragraph title: Lis1 affinity capture to determine Lis1-dynein binding affinities ... Sixteen µL of magnetic SNAP-Capture beads (NEB) were incubated with increasing concentrations of SNAP-Lis1 (0–600 nM) in modified TEV buffer for 1 hour at room temperature with agitation.

    Nucleic Acid Electrophoresis:

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: The purified amplicons were eluted in 15 μL of water where 3 μL was subjected to gel electrophoresis to verify amplification. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins.

    Pull Down Assay:

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: Paragraph title: SNAP Pull-Down Assay and Proteomic Analysis ... COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA).

    Methylation:

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: To detect gene-specific methylation, the isothermal recombinase polymerase amplification [ ] (RPA, TwistDx, UK) was employed to amplify the GSTP1 locus with primers described above in a modified RPA protocol. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins.

    Isolation:

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: For B-cell analysis, proteomics were performed at each time point, while ribosome profiling and mRNA-seq analysis were performed in biological duplicate on the baseline sample alone as the cells are not perturbed during the time course. .. Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Purification:

    Article Title: Global cellular response to chemotherapy-induced apoptosis
    Article Snippet: Purified RNA pellet was resuspended in 100 µl RNAse-free water. .. Total RNA concentration (as shown in ) was measured spectrophotometrically using a NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher, Waltham, MA, USA). mRNA was further purified by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA). .. Total RNA samples were diluted with 500 µl of kit Lysis/Binding buffer and bound to of equilibrated beads (100 µl bead slurry used).

    Article Title: Colorimetric detection of both total genomic and loci-specific DNA methylation from limited DNA inputs
    Article Snippet: ESR1 forward and reverse primers were GTTCGTCCTGGGACTGCACTTGCTCCCGTC and AGATGCTTTGGTGTGGAGGGTCATGGTCATGGT, respectively. .. To detect amplicons colorimetrically, 1 μL of purified amplicons was reacted with 20 μL SA-HRP (1/2000 dilution in 1× PBS) and SA magnetic beads (1/20 dilution in 1× PBS, NEB) for 5 mins. .. After collecting DNA-bound beads with a magnet and three 1× PBS washes, 50 μL of TMB substrate solution was allowed to react with the captured HRP and absorbance readings were taken after a 15-min incubation.

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: For B-cell analysis, proteomics were performed at each time point, while ribosome profiling and mRNA-seq analysis were performed in biological duplicate on the baseline sample alone as the cells are not perturbed during the time course. .. Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Lysis:

    Article Title: Global cellular response to chemotherapy-induced apoptosis
    Article Snippet: Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following manufacturer’s protocol; lysis was performed by passing 20x through a 22½ gauge needle. .. Total RNA concentration (as shown in ) was measured spectrophotometrically using a NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher, Waltham, MA, USA). mRNA was further purified by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA).

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Plasmid Preparation:

    Article Title: Unraveling the Role of KIAA1199, a Novel Endoplasmic Reticulum Protein, in Cancer Cell Migration
    Article Snippet: The human breast cancer tissue microarray samples (BR804, BC08013a, and BR10010a) were purchased from US Biomax Inc (Rockville, MD). .. COS-1 cells transiently transfected with a control plasmid containing a SNAP tag or KIAA1199-SNAP plasmids were lysed, followed by incubation with SNAP beads (New England Biolabs, Ipswich, MA). .. For proteomic analysis, bound proteins were released by trypsin digestion.

    Spectrophotometry:

    Article Title: Global cellular response to chemotherapy-induced apoptosis
    Article Snippet: Purified RNA pellet was resuspended in 100 µl RNAse-free water. .. Total RNA concentration (as shown in ) was measured spectrophotometrically using a NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher, Waltham, MA, USA). mRNA was further purified by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA). .. Total RNA samples were diluted with 500 µl of kit Lysis/Binding buffer and bound to of equilibrated beads (100 µl bead slurry used).

    Concentration Assay:

    Article Title: Global cellular response to chemotherapy-induced apoptosis
    Article Snippet: Purified RNA pellet was resuspended in 100 µl RNAse-free water. .. Total RNA concentration (as shown in ) was measured spectrophotometrically using a NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher, Waltham, MA, USA). mRNA was further purified by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA). .. Total RNA samples were diluted with 500 µl of kit Lysis/Binding buffer and bound to of equilibrated beads (100 µl bead slurry used).

    Article Title: Time-Resolved Proteomics Extends Ribosome Profiling-Based Measurements of Protein Synthesis Dynamics
    Article Snippet: Total RNA was extracted either by Trizol (Life Technologies) per manufacturer protocol or using QIAgen RNeasy kit (QIAgen, Germantown, MD, USA). mRNA was further purified from isolated total RNA by poly(A) separation using Oligo (dT)25 Magnetic Beads kit (New England BioLabs, Ipswich, MA, USA) per manufacturer protocol. .. Total RNA and mRNA concentration was measured either by NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher) or QuantiFluor RNA assay (Promega, Santa Clara, CA, USA).

    Staining:

    Article Title: Lis1 has two opposing modes of regulating cytoplasmic dynein
    Article Snippet: Sixteen µL of magnetic SNAP-Capture beads (NEB) were incubated with increasing concentrations of SNAP-Lis1 (0–600 nM) in modified TEV buffer for 1 hour at room temperature with agitation. .. 20 nM Dyn(variant)-M was incubated with the beads conjugated to Lis1 for 30 min at room temperature with agitation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs snap capture magnetic beads
    Snap Capture Magnetic Beads, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snap capture magnetic beads/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    snap capture magnetic beads - by Bioz Stars, 2019-06
    95/100 stars
      Buy from Supplier

    Image Search Results