swai  (New England Biolabs)

Journal: Nature protocols

Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

doi: 10.1038/nprot.2010.131

Figure Lengend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

Article Snippet: Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) !

Techniques: Amplification, Sequencing, Plasmid Preparation, Clone Assay