swai  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs swai
    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or <t>MluI</t> enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and <t>SwaI-digested</t> pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Swai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/swai/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    swai - by Bioz Stars, 2022-07
    94/100 stars


    1) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs swai
    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or <t>MluI</t> enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and <t>SwaI-digested</t> pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Swai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/swai/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    swai - by Bioz Stars, 2022-07
    94/100 stars
      Buy from Supplier

    Image Search Results

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Journal: Nature protocols

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    doi: 10.1038/nprot.2010.131

    Figure Lengend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Article Snippet: Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) !

    Techniques: Amplification, Sequencing, Plasmid Preparation, Clone Assay