agei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    AgeI
    Description:
    AgeI 1 500 units
    Catalog Number:
    R0552L
    Price:
    293
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs agei
    AgeI
    AgeI 1 500 units
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2019-07
    99/100 stars

    Images

    Related Articles

    Transduction:

    Article Title:
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Clone Assay:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Positive clones were sequenced at the Nevada Genomics Center. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. After transformation to E. coli cells, positive clones were purified and sequenced.

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the HIV-1 molecular clones NL4-3 and pTRJO.c were obtained from the AIDS Research and Reagents Program. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs).

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: The expression vector cloning strategy and antibody production were performed as previously described . .. Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Digested PCR products were ligated using the T4 DNA Ligase (NEB) into human IgG1, Igκ or Igλ expression vector.

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: First, Pvalb 5′ (170 bp) and 3′ (180 bp) homology arms were PCR generated and cloned into pSTBlue-1. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: Briefly, the HIV-1 RT mutants analyzed in this study were inserted into HIV-1 pol , with the 2100–5983 base region from HIV-1 NL4-3 sub-cloned into pCR2.1-TOPO® (Invitrogen, Carlsbad, CA, USA). .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545). .. All clones were sequence-confirmed for orientation and presence of desired mutations.

    Article Title:
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: 14-3-3γ Prevents Centrosome Amplification and Neoplastic Progression
    Article Snippet: The shRNA constructs targeting 14-3-3ε and 14-3-3γ and the shRNA resistant 14-3-3γ cDNA were described previously . .. Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs). .. The 5′ and 3′ oligonucleotides were annealed and phosphorylated at both the ends using T4 polynucleotide kinase (Fermentas).

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: Plasmid pMLM3636 (plasmid ID 43860) was obtained from Addgene, cut with BsmBI and a double-stranded DNA fragment, generated by annealing the two oligos MLM3636-1F (5′-ATCTTGTGGAAAGGACGAAACACCGGTTTTAGAGCTAGAAATAGCAAGTT) and MLM3636-1R (5′-AACTTGCTATTTCTAGCTCTAAAACCGGTGTTTCGTCCTTTCCACAAGAT), inserted via Gibson cloning. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB).

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: Note, during the cloning of the H77 polymerase gene into the Con1 backbone, the last 23 amino acids of NS5A were transferred along with NS5B, since an endonuclease restriction site between NS5A and NS5B of both Con1 and H77 was not available. .. This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector.

    Amplification:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Briefly, for generation of F26G3 IgG3-CH1.2b mAb the following PCR reactions were performed, i) PCR1 forward and reverse primers were combined with F26G3 IgG3 template, ii) PCR2 primers were combined with F26G3 IgG2b template, and iii) the resulting PCR1 and PCR2 fragments were purified, combined and amplified with PCR3 primers to generate a full length IgG3-CH1.2b PCR fragment. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes.

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: The XbaI restriction site (tctaga) was inserted in different positions of AMT1;3 (after amino acids 233, 312, 364 and 448) using Kunkel mutagenesis ( ). mcpGFP was generated by amplifying the domains of EGFP corresponding to amino acids 150–239 and 1–144 with the primer pairs EGFP-150-for /EGFP-239-rev and EGFP-1-for/EGFP-144-rev , respectively (see ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs). .. The resulting cpGFP, where the domains 150–239 and 1–144 were connected by the linker coding GGTGGS, was cloned into a pGEM-Teasy (Promega, Madison, WI).

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: Briefly, for the N-terminal P98 plus C-terminal C92 construct, SIRV2 P98 was amplified using P98-AgeI-F and P98-BsrGI-R ( and ), and STIV C92 was amplified using C92-AgeI-F and C92-BsrGI-R ( and ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: PCDNA3 smURFP/TDsmURFP/IFP1.4/IFP2.0/iRFP713 IRES eGFP vectors were digested with BsiWI and XbaI (NEB), dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified HO-1 PCR fragment. .. For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment. .. HEK293A, HT1080 (ATCC), and PC3 (ATCC) cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM, Corning) supplemented with 10% FBS (Atlanta Biologicals) + 1× Penicillin-Streptomycin (Fisher Scientific), which is referred to as growth media, on poly-D-lysine coated glass bottom culture dishes (MatTek, #P35G-0-14-C).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: The gene encoding HCV genotype 1a polymerase was amplified from the H/FL plasmid ( ) with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA) using primers 5′-GGAGCCTGG GGATCC GGATC-3′ and 5′-CCTTC ACCGGT TGGGGAGGAGG-3′ (recognition sites for BamHI and AgeI are underlined). .. This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector.

    Scaffolding:

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Stable Transfection:

    Article Title:
    Article Snippet: Paragraph title: Construction of Stable Cell Lines ... IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Synthesized:

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Short-hairpin RNA (shRNA) targeting human GMDS gene (sequence: 5’-CGTGAGGCGTATAATCTCTTT-3′) was designed and oligonucleotides were synthesized by GeneChem (Shanghai, China). .. Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA).

    Construct:

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: Paragraph title: DNA constructs ... The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the M184V mutation in reverse transcriptase (pNL4-3ΔEnv(M184V)) was kindly donated by Robert Siliciano, Johns Hopkins University. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs). .. The ∼1.5 kb fragment generated was then ligated to the ∼13 kb fragment of wild type NL4-3 after digestion with the same enzymes.

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: Paragraph title: IF-GFP-ATRX construct generation ... A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C).

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The final mPvalb targeting construct carried Pvalb 5′ and 3′ homology arms surrounding tdTomato, β-globin minigene and an FRT-flanked neomycin resistance cassette. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: Briefly, for the N-terminal P98 plus C-terminal C92 construct, SIRV2 P98 was amplified using P98-AgeI-F and P98-BsrGI-R ( and ), and STIV C92 was amplified using C92-AgeI-F and C92-BsrGI-R ( and ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: 14-3-3γ Prevents Centrosome Amplification and Neoplastic Progression
    Article Snippet: Paragraph title: Plasmids and constructs ... Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: Lentiviral plasmids were constructed into a pINDUCER11 vector containing constitutive EGFP and a tetracycline response element driving TurboRFP . .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector. .. To generate Con1/H77 variants, CTL escape mutations were engineered into the chimeric intermediate vector using a QuikChange Lightning site-directed mutagenesis kit (Stratagene).

    CTL Assay:

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector. .. The resulting plasmid, termed the Con1/H77 chimera, was then confirmed by sequencing its complete NS5B and NS3 genes.

    Electrophoresis:

    Article Title: Molecular Identification of Cryptococcus neoformans Serotypes
    Article Snippet: In a first-line identification, PCR products were subjected to separate restriction procedures with BsmFI and HpaII according to the instructions of the manufacturer (New England BioLabs Inc.). .. Digested fragments were separated by electrophoresis in agarose gel (3% in Tris-borate-EDTA buffer) stained with ethidium bromide (0.5 μg/ml) at 90 V for 3 h. PCR products with patterns compatible with the B or C serotype were further digested with the AgeI enzyme (New England BioLabs Inc.). .. For fragment length analysis, a similar amplification protocol was performed but with a fluorolabeled (6-carboxyfluorescein dye; Applied Biosystems, Courtaboeuf, France) forward primer.

    Luciferase:

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the intron-regulated HIV-based Gaussia luciferase pUCHR-inGLuc (HIVinGLuc ) was kindly donated by Gisela Heidecker, National Cancer Institute. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs).

    Cell Culture:

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB).

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Mammalian expression plasmids, cell culture, transfection, chromophore addition, and fluorescent imaging ... For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment.

    Expressing:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Positive clones were sequenced at the Nevada Genomics Center. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. After transformation to E. coli cells, positive clones were purified and sequenced.

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: All transporter and sensor constructs were inserted in the yeast expression vector pDRf1-GW, containing the f1 replication origin, GATEWAY cassette, PMA1 promoter fragment, ADH terminator, and the URA3 cassette for selection in yeast ( ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Paragraph title: Expression vector cloning and monoclonal antibody production ... Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB).

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The resulting BACs were screened by PCR and confirmed with restriction mapping and sequence analysis for correct modifications.

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA). .. Lentivirus expressing GMDS shRNA was produced as previously described [ ].

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: This HIV-1 vector was co-transfected with a vesicular stomatitis virus G protein (VSV-G) envelope expression plasmid (HCMV-G; kindly provided by J. Burns, University of California, San Diego, CA, USA), into 293T cells to produce an infectious vector virus for use in a single-cycle replication assay ( A). .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545).

    Article Title:
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Article Title: 14-3-3γ Prevents Centrosome Amplification and Neoplastic Progression
    Article Snippet: Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs). .. The annealed oligos were cloned into the pTU6 vector digested with AgeI and XhoI The shRNA cassettes was excised with EcoRI and XhoI and cloned into pEGFP-f (Clontech).

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Mammalian expression plasmids, cell culture, transfection, chromophore addition, and fluorescent imaging ... For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment.

    Modification:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The resulting BACs were screened by PCR and confirmed with restriction mapping and sequence analysis for correct modifications.

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545). .. All clones were sequence-confirmed for orientation and presence of desired mutations.

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Western Blot:

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: HIV-1 NL4-3 molecular clones with polymorphisms in the vif gene (a kind gift from E. Arts, Case Western Reserve University, Cleveland, OH, USA) were used in virus fitness assays as previously described [ , ]. .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545).

    Article Title:
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. Selection began 3 days post-transduction using 400 μg/ml G418 in 10% FBS DMEM.

    Transformation Assay:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: This fragment was TA cloned to pGEM-T easy vector and transformed to NEB 5-alpha competent E. coli cells (New England BioLabs Inc., Ipswich, MA). .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes.

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C). .. Then the backbone pEGFP vector was added for a second ligation reaction.

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Digested PCR products were ligated using the T4 DNA Ligase (NEB) into human IgG1, Igκ or Igλ expression vector.

    Derivative Assay:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment. .. For expression of exogenous fluorescent proteins, there is no problem if there is a contaminating cell line because no endogenous biology or therapeutic results are being determined.

    Transfection:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. F26G3 light chain was PCR amplified with primers ( ) and cloned to pOptiVEC-TOPO vector (Invitrogen) according to product manual.

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3.

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Mammalian expression plasmids, cell culture, transfection, chromophore addition, and fluorescent imaging ... For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment.

    DNA Ligation:

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB). .. For inducible RFP, the parental pINDUCER11 vector was co-digested with NotI and MluI restriction enzymes (NEB) to remove the shRNA cassette.

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Chromatography:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Ligation:

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C). .. A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C).

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Digested PCR products were ligated using the T4 DNA Ligase (NEB) into human IgG1, Igκ or Igλ expression vector.

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and the transformants were screened via colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: The Chinese clinical viruses were isolated from treatment-naive patients infected with the HIV-1 CRF07_BC and B′ strains circulating in China ( ). .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Introduce:

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: Briefly, the HIV-1 RT mutants analyzed in this study were inserted into HIV-1 pol , with the 2100–5983 base region from HIV-1 NL4-3 sub-cloned into pCR2.1-TOPO® (Invitrogen, Carlsbad, CA, USA). .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545). .. All clones were sequence-confirmed for orientation and presence of desired mutations.

    Generated:

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: The XbaI restriction site (tctaga) was inserted in different positions of AMT1;3 (after amino acids 233, 312, 364 and 448) using Kunkel mutagenesis ( ). mcpGFP was generated by amplifying the domains of EGFP corresponding to amino acids 150–239 and 1–144 with the primer pairs EGFP-150-for /EGFP-239-rev and EGFP-1-for/EGFP-144-rev , respectively (see ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A restriction digestion product was generated using the GenScript plasmid and enzymes, AflII and AgeI (Fragment B). .. A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C). .. Finally, BamHI and XbaI (NEB) were used to digest pEGFP-C2 plasmid, generating a backbone for insertion of the ATRX fragments.

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: First, Pvalb 5′ (170 bp) and 3′ (180 bp) homology arms were PCR generated and cloned into pSTBlue-1. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3.

    Article Title:
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: Plasmid pMLM3636 (plasmid ID 43860) was obtained from Addgene, cut with BsmBI and a double-stranded DNA fragment, generated by annealing the two oligos MLM3636-1F (5′-ATCTTGTGGAAAGGACGAAACACCGGTTTTAGAGCTAGAAATAGCAAGTT) and MLM3636-1R (5′-AACTTGCTATTTCTAGCTCTAAAACCGGTGTTTCGTCCTTTCCACAAGAT), inserted via Gibson cloning. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    DNA Sequencing:

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The resulting transformants were verified by DNA sequencing with A510-seq-F ( ). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector. .. To generate Con1/H77 variants, CTL escape mutations were engineered into the chimeric intermediate vector using a QuikChange Lightning site-directed mutagenesis kit (Stratagene).

    Polymerase Chain Reaction:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Briefly, for generation of F26G3 IgG3-CH1.2b mAb the following PCR reactions were performed, i) PCR1 forward and reverse primers were combined with F26G3 IgG3 template, ii) PCR2 primers were combined with F26G3 IgG2b template, and iii) the resulting PCR1 and PCR2 fragments were purified, combined and amplified with PCR3 primers to generate a full length IgG3-CH1.2b PCR fragment. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes.

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: The expression vector cloning strategy and antibody production were performed as previously described . .. Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Digested PCR products were ligated using the T4 DNA Ligase (NEB) into human IgG1, Igκ or Igλ expression vector.

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: First, Pvalb 5′ (170 bp) and 3′ (180 bp) homology arms were PCR generated and cloned into pSTBlue-1. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The amplicons were PCR purified and digested with BsrGI (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title:
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: Molecular Identification of Cryptococcus neoformans Serotypes
    Article Snippet: In a first-line identification, PCR products were subjected to separate restriction procedures with BsmFI and HpaII according to the instructions of the manufacturer (New England BioLabs Inc.). .. Digested fragments were separated by electrophoresis in agarose gel (3% in Tris-borate-EDTA buffer) stained with ethidium bromide (0.5 μg/ml) at 90 V for 3 h. PCR products with patterns compatible with the B or C serotype were further digested with the AgeI enzyme (New England BioLabs Inc.). .. For fragment length analysis, a similar amplification protocol was performed but with a fluorolabeled (6-carboxyfluorescein dye; Applied Biosystems, Courtaboeuf, France) forward primer.

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: PCDNA3 smURFP/TDsmURFP/IFP1.4/IFP2.0/iRFP713 IRES eGFP vectors were digested with BsiWI and XbaI (NEB), dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified HO-1 PCR fragment. .. For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment. .. HEK293A, HT1080 (ATCC), and PC3 (ATCC) cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM, Corning) supplemented with 10% FBS (Atlanta Biologicals) + 1× Penicillin-Streptomycin (Fisher Scientific), which is referred to as growth media, on poly-D-lysine coated glass bottom culture dishes (MatTek, #P35G-0-14-C).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB).

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    Imaging:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Mammalian expression plasmids, cell culture, transfection, chromophore addition, and fluorescent imaging ... For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment.

    In Vivo:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    Mutagenesis:

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: The XbaI restriction site (tctaga) was inserted in different positions of AMT1;3 (after amino acids 233, 312, 364 and 448) using Kunkel mutagenesis ( ). mcpGFP was generated by amplifying the domains of EGFP corresponding to amino acids 150–239 and 1–144 with the primer pairs EGFP-150-for /EGFP-239-rev and EGFP-1-for/EGFP-144-rev , respectively (see ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the M184V mutation in reverse transcriptase (pNL4-3ΔEnv(M184V)) was kindly donated by Robert Siliciano, Johns Hopkins University. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs). .. The ∼1.5 kb fragment generated was then ligated to the ∼13 kb fragment of wild type NL4-3 after digestion with the same enzymes.

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: Briefly, the HIV-1 RT mutants analyzed in this study were inserted into HIV-1 pol , with the 2100–5983 base region from HIV-1 NL4-3 sub-cloned into pCR2.1-TOPO® (Invitrogen, Carlsbad, CA, USA). .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545). .. All clones were sequence-confirmed for orientation and presence of desired mutations.

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: The Chinese clinical viruses were isolated from treatment-naive patients infected with the HIV-1 CRF07_BC and B′ strains circulating in China ( ). .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: pT7–αHL was described previously ( ). pT7–αHL–PLM–D8 was prepared from pT7–αHL–RL4–D8 ( ) by cassette mutagenesis. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: Paragraph title: Construction of a subgenomic replicon chimera and point mutant replicons. ... This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector.

    Isolation:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Microscopy:

    Article Title:
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. Selection began 3 days post-transduction using 400 μg/ml G418 in 10% FBS DMEM.

    Purification:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Briefly, for generation of F26G3 IgG3-CH1.2b mAb the following PCR reactions were performed, i) PCR1 forward and reverse primers were combined with F26G3 IgG3 template, ii) PCR2 primers were combined with F26G3 IgG2b template, and iii) the resulting PCR1 and PCR2 fragments were purified, combined and amplified with PCR3 primers to generate a full length IgG3-CH1.2b PCR fragment. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes.

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The endonuclease reaction mixtures were purified, and the C92 and P98 amplicons were ligated to each other using T4 DNA ligase (NEB). .. The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ).

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: The Chinese clinical viruses were isolated from treatment-naive patients infected with the HIV-1 CRF07_BC and B′ strains circulating in China ( ). .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: PCDNA3 smURFP/TDsmURFP/IFP1.4/IFP2.0/iRFP713 IRES eGFP vectors were digested with BsiWI and XbaI (NEB), dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified HO-1 PCR fragment. .. For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment. .. HEK293A, HT1080 (ATCC), and PC3 (ATCC) cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM, Corning) supplemented with 10% FBS (Atlanta Biologicals) + 1× Penicillin-Streptomycin (Fisher Scientific), which is referred to as growth media, on poly-D-lysine coated glass bottom culture dishes (MatTek, #P35G-0-14-C).

    Sequencing:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Positive clones were sequenced at the Nevada Genomics Center. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. After transformation to E. coli cells, positive clones were purified and sequenced.

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A plasmid containing internal ATRX sequence was generated using GenScript services: (5′-ggtaccTACGTCAGCTTAAGGCTTTTAAGTCTGTGTTGGCTGATATTAAGAAGGCTCATCTTGCATTGGAAGAAGACTTAAATTCCGAGTTTCGAGCGATGGATGCTGTAAACAAAGAGAAAAATACCAAAGAGCATAAAGTCATAGATGCTAAGTTTGAAACAAAAGCACGAAAAGGAGAAAAACCTTGTGCTTTGGAAAAGAAGGATATTTCAAAGTCAGAAGCTAAACTTTCAAGAAAACAGGTAGATAGTGAGCACATGCATCAGAATGTTCCAACAGAGGAACAAAGAACAAATAAAAGTACCGGTGGTGAACATaagctt-3). .. A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C).

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. Finally, the E. coli strain containing the modified BAC was treated with arabinose to induce the expression of FLP recombinase, which removed the FRT-flanked neomycin resistance cassette.

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Short-hairpin RNA (shRNA) targeting human GMDS gene (sequence: 5’-CGTGAGGCGTATAATCTCTTT-3′) was designed and oligonucleotides were synthesized by GeneChem (Shanghai, China). .. Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA).

    Article Title: Insights into a Viral Lytic Pathway from an Archaeal Virus-Host System
    Article Snippet: The ligation reaction mixture was then digested with AgeI (NEB) and ligated to the AgeI-digested del-C92-TOPO “subclone” ( ). .. The ligation reaction mixture was transformed into E. coli , and the transformants were screened via colony PCR using the Topo-seq-F and Topo-seq-R primers ( ).

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB). .. For inducible RFP, the parental pINDUCER11 vector was co-digested with NotI and MluI restriction enzymes (NEB) to remove the shRNA cassette.

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector. .. This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector.

    Selection:

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: All transporter and sensor constructs were inserted in the yeast expression vector pDRf1-GW, containing the f1 replication origin, GATEWAY cassette, PMA1 promoter fragment, ADH terminator, and the URA3 cassette for selection in yeast ( ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title:
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. HFFs were transduced with the retroviruses.

    Staining:

    Article Title: Molecular Identification of Cryptococcus neoformans Serotypes
    Article Snippet: In a first-line identification, PCR products were subjected to separate restriction procedures with BsmFI and HpaII according to the instructions of the manufacturer (New England BioLabs Inc.). .. Digested fragments were separated by electrophoresis in agarose gel (3% in Tris-borate-EDTA buffer) stained with ethidium bromide (0.5 μg/ml) at 90 V for 3 h. PCR products with patterns compatible with the B or C serotype were further digested with the AgeI enzyme (New England BioLabs Inc.). .. For fragment length analysis, a similar amplification protocol was performed but with a fluorolabeled (6-carboxyfluorescein dye; Applied Biosystems, Courtaboeuf, France) forward primer.

    Polymerase Cycling Assembly:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    Plasmid Preparation:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: Positive clones were sequenced at the Nevada Genomics Center. .. The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. After transformation to E. coli cells, positive clones were purified and sequenced.

    Article Title: Fluorescent sensors reporting the activity of ammonium transceptors in live cells
    Article Snippet: All transporter and sensor constructs were inserted in the yeast expression vector pDRf1-GW, containing the f1 replication origin, GATEWAY cassette, PMA1 promoter fragment, ADH terminator, and the URA3 cassette for selection in yeast ( ). .. The two amplified fragments were gel-purified by a commercial kit (Machery-Nagel, Düren, Germany), digested by AgeI (New England Biolabs, Ipswich, MA) and ligated by T4 DNA ligase (New England Biolabs).

    Article Title: Highly Active Antiretroviral Therapies Are Effective against HIV-1 Cell-to-Cell Transmission
    Article Snippet: The plasmid encoding the M184V mutation in reverse transcriptase (pNL4-3ΔEnv(M184V)) was kindly donated by Robert Siliciano, Johns Hopkins University. .. To generate a wild type version of the M184V mutant, the construct was digested with PspOMI and AgeI (New England Biolabs).

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: A restriction digestion product was generated using the GenScript plasmid and enzymes, AflII and AgeI (Fragment B). .. A restriction digestion product of IS10-GFP-ATRX was generated using enzymes, AgeI (NEB) and XbaI (Fragment C).

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Paragraph title: Expression vector cloning and monoclonal antibody production ... Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB).

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: Next, a β-globin minigene containing a Gad1 targeting miRNA in an intronic location was released from a previously engineered construct and inserted at the 3′ end of tdTomato into ptdTomato-N1 vector (Clontech, Mountain View, CA). .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Short-hairpin RNA (shRNA) targeting human GMDS gene (sequence: 5’-CGTGAGGCGTATAATCTCTTT-3′) was designed and oligonucleotides were synthesized by GeneChem (Shanghai, China). .. Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA). .. Lentivirus expressing GMDS shRNA was produced as previously described [ ].

    Article Title: The HIV-1 Reverse Transcriptase A62V Mutation Influences Replication Fidelity and Viral Fitness in the Context of Multi-Drug-Resistant Mutations
    Article Snippet: Briefly, the HIV-1 RT mutants analyzed in this study were inserted into HIV-1 pol , with the 2100–5983 base region from HIV-1 NL4-3 sub-cloned into pCR2.1-TOPO® (Invitrogen, Carlsbad, CA, USA). .. Site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis; Stratagene, Santa Clara, CA, USA) was performed to introduce point mutations; the region was sequenced to confirm proper introduction of mutations, and was then cloned back into the pNL4-3 MIG vector, using SbfI (2844) and AgeI (3486) restriction enzyme sites (New England Biolabs, Ipswich, MA, USA), or into the NL4-3 molecular clone using MscI restriction enzyme sites (2683 and 4545). .. All clones were sequence-confirmed for orientation and presence of desired mutations.

    Article Title: 14-3-3γ Prevents Centrosome Amplification and Neoplastic Progression
    Article Snippet: Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs). .. Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs).

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening
    Article Snippet: For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. .. The vector was first digested with EcoRI (NEB) and AgeI (NEB). .. Next, the desired sequences were amplified from pgRNA1 using primers gRNA-PLKO-F (5′-TTTCTTGGGTAGTTTGCAGTTTT) and gRNA-PLKO-R (5′-ccatttgtctcgaggtcgag-TACCTCGAGCGGCCCAAGC) and inserted into PLKO.1.

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Synechocystis HO-1 was directly amplified from the pBAD vector using primers containing 5’ BsiWI and 3’ XbaI restriction enzyme sites. .. For creation of smURFP fusions, smURFP was PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ AgeI and 3’ NotI restriction enzyme sites for N-terminal fusions or with primers containing 5’ AgeI and 3’ BspEI restriction enzyme sites for C-terminal fusions. mGeos2-VEL-ManII-N-10 (Addgene 57551) and Dronpa-PDHA1-N-10 (Addgene 57292) vectors were digested with AgeI and NotI (NEB) and mCherry- αTubulin-C-18 (Addgene 55148) and tdTomato-LaminB1-10 (Addgene 58107) were digested with AgeI and BspEI, dephosphorylated (SAP, Roche), gel purified (Zymoclean Gel DNA Recovery Kit), and ligated (T4 DNA Ligase, Life Technologies) with similarly digested, purified smURFP PCR fragment.

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: Paragraph title: Plasmid construction ... Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB).

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Article Title: Compensatory Mutations Restore the Replication Defects Caused by Cytotoxic T Lymphocyte Escape Mutations in Hepatitis C Virus Polymerase
    Article Snippet: The gene encoding HCV genotype 1a polymerase was amplified from the H/FL plasmid ( ) with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA) using primers 5′-GGAGCCTGG GGATCC GGATC-3′ and 5′-CCTTC ACCGGT TGGGGAGGAGG-3′ (recognition sites for BamHI and AgeI are underlined). .. This fragment was then subcloned into the intermediate vector cut with BamHI and AgeI (New England BioLabs, Ipswich, MA), resulting in the generation of a chimeric intermediate vector. .. Finally, we generated the chimeric subgenomic replicon by transferring the XhoI-PvuI fragment from the chimeric intermediate vector into the I341PILuc_ns3_3ET plasmid restricted with XhoI and PvuI (New England BioLabs).

    Negative Control:

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA). .. Lentivirus expressing GMDS shRNA was produced as previously described [ ].

    shRNA:

    Article Title: GMDS knockdown impairs cell proliferation and survival in human lung adenocarcinoma
    Article Snippet: Paragraph title: Design of GMDS shRNA and lentivirus production ... Then oligonucleotides were then annealed and inserted into a lentiviral vector pGCSIL-GFP with AgeI and EcoRI (both from NEB, Ipswich, MA, USA).

    Article Title: 14-3-3γ Prevents Centrosome Amplification and Neoplastic Progression
    Article Snippet: The shRNA constructs targeting 14-3-3ε and 14-3-3γ and the shRNA resistant 14-3-3γ cDNA were described previously . .. Published shRNA sequences for cdc25C , cdc25B , cdc25A , cdk1 and cdk2 ( ) were cloned in pTU6IIA digested with AgeI and XhoI (New England Biolabs). .. The 5′ and 3′ oligonucleotides were annealed and phosphorylated at both the ends using T4 polynucleotide kinase (Fermentas).

    Article Title: Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice
    Article Snippet: For inducible PD-L1, mouse PD-L1 cDNA was amplified using primers mPD-L1-F: 5′-AGACTACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAG-3′ and mPD-L1-R: 5′-CATGTGTCACGCGTTTACGTCTCCTCGAATTGTGTATCATTTCG-3′, and PCR products were cloned using a TOPO 2.1 cloning kit (Life Technologies). .. Following sequence verification, mouse PD-L1 cDNA was exchanged for the TurboRFP and shRNA cassette in pINDUCER11 via AgeI and MluI (NEB) restriction digest and T4 DNA ligation (NEB). .. For inducible RFP, the parental pINDUCER11 vector was co-digested with NotI and MluI restriction enzymes (NEB) to remove the shRNA cassette.

    Agarose Gel Electrophoresis:

    Article Title: The HEPT Analogue WPR-6 Is Active against a Broad Spectrum of Nonnucleoside Reverse Transcriptase Drug-Resistant HIV-1 Strains of Different Serotypes
    Article Snippet: The Chinese clinical viruses were isolated from treatment-naive patients infected with the HIV-1 CRF07_BC and B′ strains circulating in China ( ). .. Mutations encoding Y181C and K103A were introduced into the T-vector containing HIV RT gene regions by use of DNA polymerase (PrimerSTAR; TaKaRa) and proper site mutation primers, followed by digestion with BstEII and AgeI (NEB), purification by agarose gel electrophoresis, and ligation to BstEII- and AgeI-digested pNL4-3. .. DNA sequencing was performed in both directions across the entire RT coding region to verify the absence of spurious mutations and the presence of the desired mutations ( ).

    Article Title: Molecular Identification of Cryptococcus neoformans Serotypes
    Article Snippet: In a first-line identification, PCR products were subjected to separate restriction procedures with BsmFI and HpaII according to the instructions of the manufacturer (New England BioLabs Inc.). .. Digested fragments were separated by electrophoresis in agarose gel (3% in Tris-borate-EDTA buffer) stained with ethidium bromide (0.5 μg/ml) at 90 V for 3 h. PCR products with patterns compatible with the B or C serotype were further digested with the AgeI enzyme (New England BioLabs Inc.). .. For fragment length analysis, a similar amplification protocol was performed but with a fluorolabeled (6-carboxyfluorescein dye; Applied Biosystems, Courtaboeuf, France) forward primer.

    In Vitro:

    Article Title: Accumulation of Self-Reactive Naïve and Memory B Cell Reveals Sequential Defects in B Cell Tolerance Checkpoints in Sjögren’s Syndrome
    Article Snippet: Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB). .. Briefly, before cloning all PCR products were digested with the respective restriction enzymes AgeI, Sall, BsiWI and XhoI (all from NEB).

    Produced:

    Article Title: IgG Subclass and Heavy Chain Domains Contribute to Binding and Protection by mAbs to the Poly ?-D-glutamic Acid Capsular Antigen of Bacillus anthracis
    Article Snippet: The F26G3 IgG3-CH1.2b sequence was cleaved from the pGEM vector with XbaI and AgeI restriction enzymes (New England BioLabs Inc., Ipswich, MA) and cloned to pcDNA3.3-TOPO expression vector (Invitrogen/Life Technologies, Grand Island, NY) that was digested with the same enzymes. .. F26G3 light chain was PCR amplified with primers ( ) and cloned to pOptiVEC-TOPO vector (Invitrogen) according to product manual.

    Alkaline Lysis:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb .

    BAC Assay:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The final mPvalb targeting construct carried Pvalb 5′ and 3′ homology arms surrounding tdTomato, β-globin minigene and an FRT-flanked neomycin resistance cassette. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The resulting BACs were screened by PCR and confirmed with restriction mapping and sequence analysis for correct modifications.

    Gel Extraction:

    Article Title: A Novel Anti-HIV Active Integrase Inhibitor with a Favorable In Vitro Cytochrome P450 and Uridine 5'-diphospho-glucuronosyltransferase Metabolism Profile
    Article Snippet: Integrase-pBluescript was obtained from the HIV Drug Resistance Program, NCI, NIH. .. Other materials were purchased as follows: GeneTailor Site-Directed Mutagenesis System and High Fidelity Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA); PCR primers (Operon Biotechnologies, Germantown, MD), pBluescript SK(+) cloning vector and XL10-Gold Ultracompetent cells (Stratagene, La Jolla, CA); Plasmid Miniprep and Gel Extraction Kits (Qiagen, Valencia, CA); restriction enzymes AgeI and SalI (New England Biolabs, Ipswich, MA); Rapid DNA Ligation Kits (Roche Applied Science, Indianapolis, IN) .. Fresh human peripheral blood mononuclear cells (PBMCs) were isolated and used in antiviral assays as previously described ( ; ).

    Homologous Recombination:

    Article Title: Inhibition of parvalbumin-expressing interneurons results in complex behavioral changes
    Article Snippet: The final mPvalb targeting construct carried Pvalb 5′ and 3′ homology arms surrounding tdTomato, β-globin minigene and an FRT-flanked neomycin resistance cassette. .. The targeting fragment was then released using AgeI restriction enzyme (New England BioLabs, Ipswich, MA) and electroporated into EL250 cells containing mRabl4− RP24-306A6 BAC for homologous recombination into mPvalb . .. The resulting BACs were screened by PCR and confirmed with restriction mapping and sequence analysis for correct modifications.

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs agei
    Agei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    Image Search Results