bbsi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BbsI
    Description:
    BbsI 1 500 units
    Catalog Number:
    R0539L
    Price:
    277
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bbsi
    BbsI
    BbsI 1 500 units
    https://www.bioz.com/result/bbsi/product/New England Biolabs
    Average 99 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    bbsi - by Bioz Stars, 2019-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Novel Ribozyme-Based Prophylaxis Inhibits Influenza A Virus Replication and Protects from Severe Disease
    Article Snippet: SOFA-HDV-Rz cleavage assays were performed in the presence of 1 pmol of either 3′- (NS substrate) or internally 32 P-labelled target mRNA (all other substrates) mixed with SOFA-HDV-Rz (20 pmol) in a 20 µL mixture containing 50 mM Tris-HCl, pH 7.5, and 10 mM MgCl2 and then incubated at 37°C for 2 h. The reactions were stopped by the addition of denaturing loading buffer, separated on denaturing 5% PAGE gels, and then analyzed by autoradiography on a Phosphorscreen (GE Healthcare). .. The tet-responsive Pol II promoter Ptight was amplified from the plasmid pTRE-Tight (Clontech Laboratories, Inc.), cloned in pGEM-T (Promega) and subcloned in pBudCE4.1 (Invitrogen) with the added restriction sites BbsI and NheI (NEB). .. The Pol III promoter PhHI was amplified from the plasmid psiRNA-hH1GFPzeo (InvivoGen) and cloned in the engineered plasmid with the added restriction sites BspHI and SbfI.

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: This prospective observational trial has been registered with www.Clinicaltrials.gov (NCT03188874). contains the clinical features of the AML patient samples used throughout the study. .. shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Article Title: The dTAG system for immediate and target-specific protein degradation
    Article Snippet: Note that Gibson assembly can be used to modify the flanking microhomology sequences to those of any target gene of interest. pX330A-nBRD4/PITCh (Addgene, #91794) was cloned as previously described , . .. Oligonucleotides from IDT were annealed and inserted into the pX330A-1×2 (Addgene, #58766) plasmid after BbsI (NEB) digestion to generate pX330A-1×2-nBRD4.

    Article Title: Simultaneous reprogramming and gene editing of human fibroblasts
    Article Snippet: This bias toward the HDR pathway of Cas9-Gem allows efficient and reliable generation of both knock-in cell lines and gene-corrected patient-specific iPSC lines that are free of disruptive mutations within the untargeted allele. .. pSMART-sgRNA(Sp) plasmid (Addgene, plasmid ID 80427) Oligonucleotides (ODNs) for sgRNA construction (Integrated DNA Technologies; see for design guidelines and for sgRNA sequences used in our experiments) ODNs and/or gBlocks for construction of homologous recombination templates (Integrated DNA Technologies) pSMART-HCKan Blunt Cloning Kit (Lucigen, cat. no. 40704-2) Nuclease-free dH2 O (Thermo Fisher Scientific, cat. no. AM9932) 1 M Tris-HCl (pH 8; Sigma-Aldrich, cat. no. T2788) 0.5 M EDTA (Sigma-Aldrich, cat. no. 03690) 5 M NaCl (Sigma-Aldrich, cat. no. S6546) BbsI restriction endonuclease (NEB, cat. no. R0539S) PCR and gel extraction kit (Bioline, cat. no. BIO-52060) 6× DNA loading dye (NEB, cat. no. B7024S) TAE buffer (10×; Sigma-Aldrich, cat. no. T9650) Agarose (Bioline, cat. no. BIO-41025) Ethidium bromide solution (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Ethidium bromide is toxic and carcinogenic; handle it with nitrile gloves at all times.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Paragraph title: Cloning procedure and transformation ... The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme).

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: A549 EGFR knockout cells were generated by a CRISPR/Cas9 approach as described [ ]. .. The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: Lysates were subjected to co-immunoprecipitation and analyzed by Western blot using indicated antibodies. .. The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ). .. 293T, U87mG and LN229 cells cultured in 6-well plates were transiently transfected with 2 μg of pX459 genome editing plasmids using Lipofectamine 3000 (Invitrogen).

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Annealed guide oligos were cloned into the CRISPR-Cas9 expression vector pSpCas9 (BB)-2A-GFP (PX458) (#48138 Addgene plasmid [ ]. .. The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The three different plasmids were separately transfected into U251 N cells.

    Centrifugation:

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: The resulting lysate was flash-frozen in liquid nitrogen and stored at −80 °C. .. Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA). .. The in vitro replication reactions were carried out as described ( ).

    Amplification:

    Article Title: A Novel Ribozyme-Based Prophylaxis Inhibits Influenza A Virus Replication and Protects from Severe Disease
    Article Snippet: SOFA-HDV-Rz cleavage assays were performed in the presence of 1 pmol of either 3′- (NS substrate) or internally 32 P-labelled target mRNA (all other substrates) mixed with SOFA-HDV-Rz (20 pmol) in a 20 µL mixture containing 50 mM Tris-HCl, pH 7.5, and 10 mM MgCl2 and then incubated at 37°C for 2 h. The reactions were stopped by the addition of denaturing loading buffer, separated on denaturing 5% PAGE gels, and then analyzed by autoradiography on a Phosphorscreen (GE Healthcare). .. The tet-responsive Pol II promoter Ptight was amplified from the plasmid pTRE-Tight (Clontech Laboratories, Inc.), cloned in pGEM-T (Promega) and subcloned in pBudCE4.1 (Invitrogen) with the added restriction sites BbsI and NheI (NEB). .. The Pol III promoter PhHI was amplified from the plasmid psiRNA-hH1GFPzeo (InvivoGen) and cloned in the engineered plasmid with the added restriction sites BspHI and SbfI.

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The sgRNA scaffold was amplified from the vector pKS Chlamy dual with the primers FH16 and FH18 (Supplementary Table ) and subcloned into pJET1.2 (ThermoFisher Scientific) resulting in the vector pFH4. .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26.

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the ssM13 DNA template. .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Gels were stained using ethidium bromide (Sigma #46067-50ML-F) and visualized using a UV-light transilluminator. .. The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the single-stranded M13 DNA template. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase.

    Synthesized:

    Article Title: The dTAG system for immediate and target-specific protein degradation
    Article Snippet: The BSDR -P2A-2xHA-FKBP12F36V -linker cassette was designed to include flanking BRD4 microhomology sequences and overlapping sequences to aid in Gibson assembly and synthesized at IDT as a gBlock gene fragment. .. Oligonucleotides from IDT were annealed and inserted into the pX330A-1×2 (Addgene, #58766) plasmid after BbsI (NEB) digestion to generate pX330A-1×2-nBRD4.

    Article Title: Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides
    Article Snippet: 2.8 Three variants of N. lugens Rdl were synthesized and sub-cloned into the expression vector pcDNA3.1(+) by Thermo Fisher Scientific (Life Technologies GmbH, Darmstadt, Germany): wildtype Rdl (accession no KX592155), Rdl -(A301S) and Rdl -(A301S + Q359E). .. The obtained plasmids were linearized by BbsI digestion according to manufacturer instructions (New England BioLabs Inc., USA), briefly: 20 μg plasmid DNA was incubated with 50 units BbsI for 3 h at 37 °C in a total volume of 100 μL.

    Construct:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The two PCR products were combined with NheI/SpeI-digested pFH13 to the construct pFH6 via Gibson assembly® (NEB). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26.

    Electrophoresis:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    Modification:

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: We employed a modified version of the competitive replication and adduct bypass (CRAB) assay to assess the bypass efficiencies and mutation frequencies of the O 4 -alkyldT lesions upon replication in E. coli cells (Supplementary Figure S28) ( , , ). .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase.

    Incubation:

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase. .. To the above mixture, 5mM dithiothreitol, 1 µM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10U T4 polynucleotide kinase in a 15 µl solution were added subsequently and the mixture was incubated at 37°C for 30min, followed by heating at 65°C for 20min to deactivate the T4 polynucleotide kinase.

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase. .. To the above mixture were subsequently added 5 mM DTT, 1 μM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10 U T4 polynucleotide kinase in a 15 μl solution and the mixture was incubated at 37°C for 30 min, followed by heating at 65°C for 20 min to deactivate the T4 polynucleotide kinase.

    Article Title: Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides
    Article Snippet: 2.8 Three variants of N. lugens Rdl were synthesized and sub-cloned into the expression vector pcDNA3.1(+) by Thermo Fisher Scientific (Life Technologies GmbH, Darmstadt, Germany): wildtype Rdl (accession no KX592155), Rdl -(A301S) and Rdl -(A301S + Q359E). .. The obtained plasmids were linearized by BbsI digestion according to manufacturer instructions (New England BioLabs Inc., USA), briefly: 20 μg plasmid DNA was incubated with 50 units BbsI for 3 h at 37 °C in a total volume of 100 μL. .. Subsequently the linearized DNA was purified using Qiagen QIAquick PCR Purification Kit (Qiagen GmbH, Germany).

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: The cell lysate suspension was incubated on ice for another 60 min. After this incubation, the lysate was centrifuged at 1700 × g at 4 °C for 10 min to remove the nuclei and then centrifuged again at 12,000 × g for 10 min at 4 °C to clarify the lysate. .. Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA).

    Gel Extraction:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    Article Title: Simultaneous reprogramming and gene editing of human fibroblasts
    Article Snippet: This bias toward the HDR pathway of Cas9-Gem allows efficient and reliable generation of both knock-in cell lines and gene-corrected patient-specific iPSC lines that are free of disruptive mutations within the untargeted allele. .. pSMART-sgRNA(Sp) plasmid (Addgene, plasmid ID 80427) Oligonucleotides (ODNs) for sgRNA construction (Integrated DNA Technologies; see for design guidelines and for sgRNA sequences used in our experiments) ODNs and/or gBlocks for construction of homologous recombination templates (Integrated DNA Technologies) pSMART-HCKan Blunt Cloning Kit (Lucigen, cat. no. 40704-2) Nuclease-free dH2 O (Thermo Fisher Scientific, cat. no. AM9932) 1 M Tris-HCl (pH 8; Sigma-Aldrich, cat. no. T2788) 0.5 M EDTA (Sigma-Aldrich, cat. no. 03690) 5 M NaCl (Sigma-Aldrich, cat. no. S6546) BbsI restriction endonuclease (NEB, cat. no. R0539S) PCR and gel extraction kit (Bioline, cat. no. BIO-52060) 6× DNA loading dye (NEB, cat. no. B7024S) TAE buffer (10×; Sigma-Aldrich, cat. no. T9650) Agarose (Bioline, cat. no. BIO-41025) Ethidium bromide solution (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Ethidium bromide is toxic and carcinogenic; handle it with nitrile gloves at all times.

    Activity Assay:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26. .. Since, the U6 RNA polymerase III promoter takes guanine as transcription start nucleotide, we could not use the usual 20 bp protospacer sequence.

    Expressing:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: To create a sgRNA expression cassette with the sgRNA scaffold and the U6-26p , the U6-26p was PCR-amplified from pFH13 with FH21 and FH22 (Supplementary Table ) and the sgRNA scaffold was PCR-amplified from pFH4 with FH23 and FH24 (Supplementary Table ). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26.

    Article Title: Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides
    Article Snippet: 2.8 Three variants of N. lugens Rdl were synthesized and sub-cloned into the expression vector pcDNA3.1(+) by Thermo Fisher Scientific (Life Technologies GmbH, Darmstadt, Germany): wildtype Rdl (accession no KX592155), Rdl -(A301S) and Rdl -(A301S + Q359E). .. The obtained plasmids were linearized by BbsI digestion according to manufacturer instructions (New England BioLabs Inc., USA), briefly: 20 μg plasmid DNA was incubated with 50 units BbsI for 3 h at 37 °C in a total volume of 100 μL.

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Annealed guide oligos were cloned into the CRISPR-Cas9 expression vector pSpCas9 (BB)-2A-GFP (PX458) (#48138 Addgene plasmid [ ]. .. The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen).

    Genome Wide:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen).

    Knock-In:

    Article Title: The dTAG system for immediate and target-specific protein degradation
    Article Snippet: Paragraph title: dTAG knock-in vector construction ... Oligonucleotides from IDT were annealed and inserted into the pX330A-1×2 (Addgene, #58766) plasmid after BbsI (NEB) digestion to generate pX330A-1×2-nBRD4.

    Western Blot:

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ). .. The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ).

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen).

    Transformation Assay:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Paragraph title: Cloning procedure and transformation ... The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme).

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified. .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified.

    Over Expression:

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Transfection:

    Article Title: CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations
    Article Snippet: Oligos encoding the targeting sequence were then annealed and ligated into the pSpCas9(BB)-2A-Puro ( ) vector digested with BbsI (New England Biolabs). .. For each targeted locus, cells were co-transfected with 2 μg of the CRISPR/Cas9 plasmid and 2 μl of either the control or the sense/nonsense ssODN (50 μM) to prevent the potential incorporation of the two donor DNA sequences into different alleles within the same cell.

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ). .. 293T, U87mG and LN229 cells cultured in 6-well plates were transiently transfected with 2 μg of pX459 genome editing plasmids using Lipofectamine 3000 (Invitrogen).

    Chromatography:

    Article Title: Construction of Plasmids Containing Site-Specific DNA Interstrand Cross-Links for Biochemical and Cell Biological Studies
    Article Snippet: Mobile phases for anion exchange chromatography: A1 10 mM Tris–HCl, pH 7.4: 1.21 g Tris in 800 mL H2 O, adjust the pH to 7.4 with HCl and the volume to 1 L. Filter and degas. .. BbsI (NEB R0539L) 5,000 U/mL (see ).

    Ligation:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen).

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme).

    Serial Dilution:

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ). .. After recovery in complete media for 2 days, cells were collected to check the SLO1 editing by Western blot.

    Introduce:

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The two PCR products were combined with NheI/SpeI-digested pFH13 to the construct pFH6 via Gibson assembly® (NEB). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26. .. The final T-DNA transformation vector pUB-Cas9-@GL1 (with the @ representing the targeted gene) was constructed by Gibson Assembly© (New England Biolabs) of KpnI and HindIII-digested pUB-Cas9 and the sgRNA cassette that was amplified from pFH26 with FH41 and FH42 (Supplementary Table ).

    Generated:

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: A549 EGFR knockout cells were generated by a CRISPR/Cas9 approach as described [ ]. .. The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC.

    Article Title: Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides
    Article Snippet: The obtained plasmids were linearized by BbsI digestion according to manufacturer instructions (New England BioLabs Inc., USA), briefly: 20 μg plasmid DNA was incubated with 50 units BbsI for 3 h at 37 °C in a total volume of 100 μL. .. Subsequently the linearized DNA was purified using Qiagen QIAquick PCR Purification Kit (Qiagen GmbH, Germany).

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: Four separate AQP3mut cell lines were generated using different guide RNAs (gRNA). .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified.

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA). .. Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA).

    Sequencing:

    Article Title: A Novel Ribozyme-Based Prophylaxis Inhibits Influenza A Virus Replication and Protects from Severe Disease
    Article Snippet: The tet-responsive Pol II promoter Ptight was amplified from the plasmid pTRE-Tight (Clontech Laboratories, Inc.), cloned in pGEM-T (Promega) and subcloned in pBudCE4.1 (Invitrogen) with the added restriction sites BbsI and NheI (NEB). .. The different SOFA-HDV-Rz were PCR amplified and inserted after the PhHI promoter of pDUAL-JU using added BbsI restriction sites.

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The two PCR products were combined with NheI/SpeI-digested pFH13 to the construct pFH6 via Gibson assembly® (NEB). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26. .. The final T-DNA transformation vector pUB-Cas9-@GL1 (with the @ representing the targeted gene) was constructed by Gibson Assembly© (New England Biolabs) of KpnI and HindIII-digested pUB-Cas9 and the sgRNA cassette that was amplified from pFH26 with FH41 and FH42 (Supplementary Table ).

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the ssM13 DNA template. .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase.

    Article Title: CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations
    Article Snippet: sgRNA target sequences ( ) were designed using the CRISPR Design tool hosted by the Massachusetts Institute of Technology ( ) to minimize potential off-target effects. .. Oligos encoding the targeting sequence were then annealed and ligated into the pSpCas9(BB)-2A-Puro ( ) vector digested with BbsI (New England Biolabs). .. The sequence of the ssODNs (Integrated DNA Technologies) used for CRISPR/Cas9-mediated HDR, containing one missense/nonsense mutation coupled to different silent mutations, are provided in .

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the single-stranded M13 DNA template. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase.

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: A549 EGFR knockout cells were generated by a CRISPR/Cas9 approach as described [ ]. .. The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: The gRNA sequences were determined (crispr.mit.edu) for recruitment of Cas9 to either the first or second exon of AQP3 and are listed in . .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified. .. Reverse complements of gRNA were annealed using T4 ligation buffer (NEB).

    In Vivo:

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: We employed the competitive replication and adduct bypass assay developed by Delaney et al . ( ) to assess the bypass efficiencies of N 3-EtdT, O 2 -EtdT and O 4 -EtdT in vivo ( , available at Carcinogenesis Online). .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase.

    Gene Knockout:

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. 48 h post transfection, GFP-expressing cells were FACS sorted and re-seeded at limiting dilution in 96-well plates in order to obtain individual clones.

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Paragraph title: Generation of PAX6 KO cell-lines by CRISPR-Cas9 genome editing ... The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen).

    Methylation:

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA). .. Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA).

    Mutagenesis:

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: The PCR products were purified by using Cycle Pure Kit. .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase. .. To the above mixture, 5mM dithiothreitol, 1 µM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10U T4 polynucleotide kinase in a 15 µl solution were added subsequently and the mixture was incubated at 37°C for 30min, followed by heating at 65°C for 20min to deactivate the T4 polynucleotide kinase.

    Article Title: Characterization and Molecular Analysis of Macrolide-Resistant Mycoplasma pneumoniae Clinical Isolates Obtained in Japan
    Article Snippet: Paragraph title: RFLP analysis of point mutation in domain V of 23S rRNA. ... To detect the point mutations A2063G, A2063C, A2064G, and A2617G in domain V of 23S rRNA, BbsI, BceAI, BsaI, and BsmFI (New England BioLabs) were used.

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: Paragraph title: Quantification of bypass efficiencies and mutation frequencies ... For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase.

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: Paragraph title: Generation of AQP3 mutant cell line ... Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified.

    Isolation:

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified. .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified.

    Purification:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: The PCR products were purified by using Cycle Pure Kit. .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Gels were stained using ethidium bromide (Sigma #46067-50ML-F) and visualized using a UV-light transilluminator. .. The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: The PCR products were purified by using Cycle Pure Kit (Omega). .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase.

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: The gRNA sequences were determined (crispr.mit.edu) for recruitment of Cas9 to either the first or second exon of AQP3 and are listed in . .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified. .. Reverse complements of gRNA were annealed using T4 ligation buffer (NEB).

    Polymerase Chain Reaction:

    Article Title: A Novel Ribozyme-Based Prophylaxis Inhibits Influenza A Virus Replication and Protects from Severe Disease
    Article Snippet: The tet-responsive Pol II promoter Ptight was amplified from the plasmid pTRE-Tight (Clontech Laboratories, Inc.), cloned in pGEM-T (Promega) and subcloned in pBudCE4.1 (Invitrogen) with the added restriction sites BbsI and NheI (NEB). .. The two promoters inserted in the resulting pDUAL-JU vector were sequenced in both directions to assure that the correct sequences were cloned.

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The two PCR products were combined with NheI/SpeI-digested pFH13 to the construct pFH6 via Gibson assembly® (NEB). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26.

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated.

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    Article Title: Cytotoxic and mutagenic properties of regioisomeric O2-, N3- and O4-ethylthymidines in bacterial cells
    Article Snippet: The PCR products were purified by using Cycle Pure Kit. .. For the determination of bypass efficiencies and mutation frequencies, a portion of the above PCR products was digested with 10U BbsI and 1U shrimp alkaline phosphatase in 10 µl New England Biolabs buffer 4 at 37°C for 30min, followed by heating at 80°C for 20min to deactivate the shrimp alkaline phosphatase. .. To the above mixture, 5mM dithiothreitol, 1 µM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10U T4 polynucleotide kinase in a 15 µl solution were added subsequently and the mixture was incubated at 37°C for 30min, followed by heating at 65°C for 20min to deactivate the T4 polynucleotide kinase.

    Article Title: CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations
    Article Snippet: Oligos encoding the targeting sequence were then annealed and ligated into the pSpCas9(BB)-2A-Puro ( ) vector digested with BbsI (New England Biolabs). .. The sequence of the ssODNs (Integrated DNA Technologies) used for CRISPR/Cas9-mediated HDR, containing one missense/nonsense mutation coupled to different silent mutations, are provided in .

    Article Title: Simultaneous reprogramming and gene editing of human fibroblasts
    Article Snippet: This bias toward the HDR pathway of Cas9-Gem allows efficient and reliable generation of both knock-in cell lines and gene-corrected patient-specific iPSC lines that are free of disruptive mutations within the untargeted allele. .. pSMART-sgRNA(Sp) plasmid (Addgene, plasmid ID 80427) Oligonucleotides (ODNs) for sgRNA construction (Integrated DNA Technologies; see for design guidelines and for sgRNA sequences used in our experiments) ODNs and/or gBlocks for construction of homologous recombination templates (Integrated DNA Technologies) pSMART-HCKan Blunt Cloning Kit (Lucigen, cat. no. 40704-2) Nuclease-free dH2 O (Thermo Fisher Scientific, cat. no. AM9932) 1 M Tris-HCl (pH 8; Sigma-Aldrich, cat. no. T2788) 0.5 M EDTA (Sigma-Aldrich, cat. no. 03690) 5 M NaCl (Sigma-Aldrich, cat. no. S6546) BbsI restriction endonuclease (NEB, cat. no. R0539S) PCR and gel extraction kit (Bioline, cat. no. BIO-52060) 6× DNA loading dye (NEB, cat. no. B7024S) TAE buffer (10×; Sigma-Aldrich, cat. no. T9650) Agarose (Bioline, cat. no. BIO-41025) Ethidium bromide solution (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Ethidium bromide is toxic and carcinogenic; handle it with nitrile gloves at all times.

    Article Title: Characterization and Molecular Analysis of Macrolide-Resistant Mycoplasma pneumoniae Clinical Isolates Obtained in Japan
    Article Snippet: To detect the point mutations A2063G, A2063C, A2064G, and A2617G in domain V of 23S rRNA, BbsI, BceAI, BsaI, and BsmFI (New England BioLabs) were used. .. Second PCR products from domain V for tested M. pneumoniae strains were used for digestion with the four restriction enzymes.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: Gels were stained using ethidium bromide (Sigma #46067-50ML-F) and visualized using a UV-light transilluminator. .. The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The digested products were then purified by agarose gel electrophoresis, and eluted in a final volume of 30 µL using the QIAquick gel extraction kit (Qiagen #28706).

    Article Title: Cytotoxic and mutagenic properties of O4-alkylthymidine lesions in Escherichia coli cells
    Article Snippet: The PCR products were purified by using Cycle Pure Kit (Omega). .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) CutSmart buffer at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the phosphatase. .. To the above mixture were subsequently added 5 mM DTT, 1 μM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10 U T4 polynucleotide kinase in a 15 μl solution and the mixture was incubated at 37°C for 30 min, followed by heating at 65°C for 20 min to deactivate the T4 polynucleotide kinase.

    CRISPR:

    Article Title: CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations
    Article Snippet: Paragraph title: CRISPR-Barcoding ... Oligos encoding the targeting sequence were then annealed and ligated into the pSpCas9(BB)-2A-Puro ( ) vector digested with BbsI (New England Biolabs).

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: A549 EGFR knockout cells were generated by a CRISPR/Cas9 approach as described [ ]. .. The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: Paragraph title: CRISPR genome editing ... The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ).

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Paragraph title: Generation of PAX6 KO cell-lines by CRISPR-Cas9 genome editing ... The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen).

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: The gRNA sequences were determined (crispr.mit.edu) for recruitment of Cas9 to either the first or second exon of AQP3 and are listed in . .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Annealed guide oligos were cloned into the CRISPR-Cas9 expression vector pSpCas9 (BB)-2A-GFP (PX458) (#48138 Addgene plasmid [ ]. .. The vector was linearized by BbsI (catR0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The three different plasmids were separately transfected into U251 N cells.

    Plasmid Preparation:

    Article Title: A Novel Ribozyme-Based Prophylaxis Inhibits Influenza A Virus Replication and Protects from Severe Disease
    Article Snippet: SOFA-HDV-Rz cleavage assays were performed in the presence of 1 pmol of either 3′- (NS substrate) or internally 32 P-labelled target mRNA (all other substrates) mixed with SOFA-HDV-Rz (20 pmol) in a 20 µL mixture containing 50 mM Tris-HCl, pH 7.5, and 10 mM MgCl2 and then incubated at 37°C for 2 h. The reactions were stopped by the addition of denaturing loading buffer, separated on denaturing 5% PAGE gels, and then analyzed by autoradiography on a Phosphorscreen (GE Healthcare). .. The tet-responsive Pol II promoter Ptight was amplified from the plasmid pTRE-Tight (Clontech Laboratories, Inc.), cloned in pGEM-T (Promega) and subcloned in pBudCE4.1 (Invitrogen) with the added restriction sites BbsI and NheI (NEB). .. The Pol III promoter PhHI was amplified from the plasmid psiRNA-hH1GFPzeo (InvivoGen) and cloned in the engineered plasmid with the added restriction sites BspHI and SbfI.

    Article Title: An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana
    Article Snippet: The two PCR products were combined with NheI/SpeI-digested pFH13 to the construct pFH6 via Gibson assembly® (NEB). .. To introduce the 20 bp target sequence designed against the GL1 gene, pFH6 was digested with BbsI (NEB) and the vector backbone was ligated with two annealed primers (FH35/FH36, Supplementary Table ) containing the target sequence resulting in the vector pFH26. .. The final T-DNA transformation vector pUB-Cas9-@GL1 (with the @ representing the targeted gene) was constructed by Gibson Assembly© (New England Biolabs) of KpnI and HindIII-digested pUB-Cas9 and the sgRNA cassette that was amplified from pFH26 with FH41 and FH42 (Supplementary Table ).

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: This prospective observational trial has been registered with www.Clinicaltrials.gov (NCT03188874). contains the clinical features of the AML patient samples used throughout the study. .. shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    Article Title: CRISPR/Cas9-mediated gene targeting during embryogenesis in swine
    Article Snippet: pX330 vector (Addgene). .. BbsI enzyme (NEB).

    Article Title: CRISPR/Cas9-mediated gene targeting during embryogenesis in swine
    Article Snippet: Digest 1 μg of pX330 vector with BbsI enzyme. .. Reaction mixture contains 2 μL of 10 x buffer, 1 μL of BbsI enzyme, 1 μg of pX330 vector and distilled water up to 20 μL. .. Mixture is incubated at 37°C for 1 hour. sgRNA sequences are designed using a web-based program ( ).

    Article Title: CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations
    Article Snippet: sgRNA target sequences ( ) were designed using the CRISPR Design tool hosted by the Massachusetts Institute of Technology ( ) to minimize potential off-target effects. .. Oligos encoding the targeting sequence were then annealed and ligated into the pSpCas9(BB)-2A-Puro ( ) vector digested with BbsI (New England Biolabs). .. The sequence of the ssODNs (Integrated DNA Technologies) used for CRISPR/Cas9-mediated HDR, containing one missense/nonsense mutation coupled to different silent mutations, are provided in .

    Article Title: The dTAG system for immediate and target-specific protein degradation
    Article Snippet: Briefly, N-terminal targeting guides for BRD4 were designed using . .. Oligonucleotides from IDT were annealed and inserted into the pX330A-1×2 (Addgene, #58766) plasmid after BbsI (NEB) digestion to generate pX330A-1×2-nBRD4. .. The PITCh sgRNA sequence from pX330S-2-PITCh (Addgene #63670) was inserted into pX330A-1×2-nBRD4 using Golden Gate assembly (NEB).

    Article Title: Simultaneous reprogramming and gene editing of human fibroblasts
    Article Snippet: This bias toward the HDR pathway of Cas9-Gem allows efficient and reliable generation of both knock-in cell lines and gene-corrected patient-specific iPSC lines that are free of disruptive mutations within the untargeted allele. .. pSMART-sgRNA(Sp) plasmid (Addgene, plasmid ID 80427) Oligonucleotides (ODNs) for sgRNA construction (Integrated DNA Technologies; see for design guidelines and for sgRNA sequences used in our experiments) ODNs and/or gBlocks for construction of homologous recombination templates (Integrated DNA Technologies) pSMART-HCKan Blunt Cloning Kit (Lucigen, cat. no. 40704-2) Nuclease-free dH2 O (Thermo Fisher Scientific, cat. no. AM9932) 1 M Tris-HCl (pH 8; Sigma-Aldrich, cat. no. T2788) 0.5 M EDTA (Sigma-Aldrich, cat. no. 03690) 5 M NaCl (Sigma-Aldrich, cat. no. S6546) BbsI restriction endonuclease (NEB, cat. no. R0539S) PCR and gel extraction kit (Bioline, cat. no. BIO-52060) 6× DNA loading dye (NEB, cat. no. B7024S) TAE buffer (10×; Sigma-Aldrich, cat. no. T9650) Agarose (Bioline, cat. no. BIO-41025) Ethidium bromide solution (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Ethidium bromide is toxic and carcinogenic; handle it with nitrile gloves at all times.

    Article Title: Preparation of Group I Introns for Biochemical Studies and Crystallization Assays by Native Affinity Purification
    Article Snippet: The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme). .. The PCR amplified products were purified using the QIAquick PCR purification kit (Qiagen #28104), and digested using the appropriate restriction enzymes (EcoRI, New England Biolabs (NEB) #R0101L; and NcoI, NEB #R0193L—incomplete digestion products were typically obtained using BbsI, NEB #R0539L, which made us avoid using this enzyme).

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: A549 EGFR knockout cells were generated by a CRISPR/Cas9 approach as described [ ]. .. The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides
    Article Snippet: 2.8 Three variants of N. lugens Rdl were synthesized and sub-cloned into the expression vector pcDNA3.1(+) by Thermo Fisher Scientific (Life Technologies GmbH, Darmstadt, Germany): wildtype Rdl (accession no KX592155), Rdl -(A301S) and Rdl -(A301S + Q359E). .. The obtained plasmids were linearized by BbsI digestion according to manufacturer instructions (New England BioLabs Inc., USA), briefly: 20 μg plasmid DNA was incubated with 50 units BbsI for 3 h at 37 °C in a total volume of 100 μL. .. Subsequently the linearized DNA was purified using Qiagen QIAquick PCR Purification Kit (Qiagen GmbH, Germany).

    Article Title: CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory
    Article Snippet: Lysates were subjected to co-immunoprecipitation and analyzed by Western blot using indicated antibodies. .. The genome editing plasmids were prepared by cloning sgRNAs into pX459 plasmid (Addgene) digested by BbsI (NEB) following Zhang’s lab protocol ( http://www.addgene.org/crispr/zhang/ ). .. 293T, U87mG and LN229 cells cultured in 6-well plates were transiently transfected with 2 μg of pX459 genome editing plasmids using Lipofectamine 3000 (Invitrogen).

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: Annealed guide oligos were cloned into the CRISPR-Cas9 expression vector pSpCas9 (BB)-2A-GFP (PX458) (#48138 Addgene plasmid [ ]. .. The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The three different plasmids were separately transfected into U251 N cells.

    Article Title: Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection
    Article Snippet: The gRNA sequences were determined (crispr.mit.edu) for recruitment of Cas9 to either the first or second exon of AQP3 and are listed in . .. Tails were added to gRNA sequence for introduction into px33034 (Addgene plasmid #42230), a plasmid containing a human codon-optimized SpCas9. px330 was digested using BbsI (NEB) for one hour according to manufacturer’s protocol and gel purified. .. Reverse complements of gRNA were annealed using T4 ligation buffer (NEB).

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: The resulting lysate was flash-frozen in liquid nitrogen and stored at −80 °C. .. Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA). .. The in vitro replication reactions were carried out as described ( ).

    shRNA:

    Article Title: STK3 is a therapeutic target for a subset of acute myeloid leukemias
    Article Snippet: This prospective observational trial has been registered with www.Clinicaltrials.gov (NCT03188874). contains the clinical features of the AML patient samples used throughout the study. .. shRNA sequences were cloned and expressed from pRSI12_U6_shRNA_Ubic_TagGFP_2A_Puro (pRSI12) vector (Cellecta) after cutting with BbsI restriction enzyme (New England Biolabs). pRSI12 based shRNA vectors were used for knocking down STK3 throughout the study unless otherwise stated. .. For expression of Cas9 and STK3 sgRNAs from lentiviral plasmids pLCRISPR.EFS.GFP was used (Addgene plasmid # 57818).

    Agarose Gel Electrophoresis:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP).

    In Vitro:

    Article Title: FEN1 Ensures Telomere Stability by Facilitating Replication Fork Re-initiation
    Article Snippet: Paragraph title: SV-40 Large-T Antigen-dependent in Vitro DNA Replication Assay ... Linear plasmid DNA (pSVO.11–2K ( )) used in the replication reactions was prepared by equilibrium centrifugation in cesium chloride-ethidium bromide gradients and then digested with BbsI (New England Biolabs, Ipswich, MA).

    Knock-Out:

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: Paragraph title: Knockout of EGFR by CRISPR/Cas9-mediated genome editing ... The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC.

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen).

    Concentration Assay:

    Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
    Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen).

    Marker:

    Article Title: The dTAG system for immediate and target-specific protein degradation
    Article Snippet: This protocol was also used to generate an N-terminal BRD4 tagging cassette (PuroR -P2A-2xHA-FKBP12F36V -linker) with a puromycin selectable marker (Addgene, #91793), and C-terminal BRD4 tagging cassettes (linker-FKBP12F36V -2xHA-P2A-BSDR /PuroR ) with blasticidin or puromycin selectable markers (Addgene, #91795 and #91796). .. Oligonucleotides from IDT were annealed and inserted into the pX330A-1×2 (Addgene, #58766) plasmid after BbsI (NEB) digestion to generate pX330A-1×2-nBRD4.

    FACS:

    Article Title: PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells
    Article Snippet: The sgRNA with the sequence TCGTTCGGAAGCGCACGCTGCGG within the EGFR gene was obtained using the CRISPR Design Tool ( http://tools.genome-engineering.org ). sgRNA targeting EGFR was cloned into BbsI (NEB, Ipswich, MA, USA) digested pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) using the oligos: Forward CACCGTCGTTCGGAAGCGCACGCTG and Reverse AAACCAGCGTGCGCTTCCGAACGAC. .. Cells were transiently transfected with 1 μg PX458 using an Amaxa Nucleofector machine (Lonza, Basel, Switzerland) according to manufacturer's instructions.

    Article Title: Generation of a PAX6 knockout glioblastoma cell line with changes in cell cycle distribution and sensitivity to oxidative stress
    Article Snippet: The vector was linearized by BbsI (cat#R0539S New England BioLabs), and guide oligos were cloned into the vector by T4 DNA ligase (cat#15224–041, Invitrogen). .. The three different plasmids were separately transfected into U251 N cells.

    Homologous Recombination:

    Article Title: Simultaneous reprogramming and gene editing of human fibroblasts
    Article Snippet: This bias toward the HDR pathway of Cas9-Gem allows efficient and reliable generation of both knock-in cell lines and gene-corrected patient-specific iPSC lines that are free of disruptive mutations within the untargeted allele. .. pSMART-sgRNA(Sp) plasmid (Addgene, plasmid ID 80427) Oligonucleotides (ODNs) for sgRNA construction (Integrated DNA Technologies; see for design guidelines and for sgRNA sequences used in our experiments) ODNs and/or gBlocks for construction of homologous recombination templates (Integrated DNA Technologies) pSMART-HCKan Blunt Cloning Kit (Lucigen, cat. no. 40704-2) Nuclease-free dH2 O (Thermo Fisher Scientific, cat. no. AM9932) 1 M Tris-HCl (pH 8; Sigma-Aldrich, cat. no. T2788) 0.5 M EDTA (Sigma-Aldrich, cat. no. 03690) 5 M NaCl (Sigma-Aldrich, cat. no. S6546) BbsI restriction endonuclease (NEB, cat. no. R0539S) PCR and gel extraction kit (Bioline, cat. no. BIO-52060) 6× DNA loading dye (NEB, cat. no. B7024S) TAE buffer (10×; Sigma-Aldrich, cat. no. T9650) Agarose (Bioline, cat. no. BIO-41025) Ethidium bromide solution (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Ethidium bromide is toxic and carcinogenic; handle it with nitrile gloves at all times.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bbsi
    Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbsi/product/New England Biolabs
    Average 99 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    bbsi - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results