mlu i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    MluI
    Description:
    MluI 5 000 units
    Catalog Number:
    r0198l
    Price:
    269
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mlu i
    MluI
    MluI 5 000 units
    https://www.bioz.com/result/mlu i/product/New England Biolabs
    Average 98 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    mlu i - by Bioz Stars, 2020-05
    98/100 stars

    Images

    1) Product Images from "Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis"

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis

    Journal: Molecular Medicine Reports

    doi: 10.3892/mmr.2015.4582

    Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.
    Figure Legend Snippet: Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.

    Techniques Used: Transgenic Assay, Expressing, Isolation, Polymerase Chain Reaction, Amplification, Transfection, Plasmid Preparation, Produced, Negative Control

    2) Product Images from "Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach"

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    Journal:

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost
    Figure Legend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Techniques Used:

    3) Product Images from "vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus"

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus

    Journal: Journal of Virology

    doi: 10.1128/JVI.79.11.6984-6996.2005

    Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.
    Figure Legend Snippet: Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.

    Techniques Used: Mutagenesis, Construct, BAC Assay, Clone Assay, Plasmid Preparation, Labeling, Modification, FLAG-tag

    (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.
    Figure Legend Snippet: (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.

    Techniques Used: Labeling, Sequencing, Northern Blot, Derivative Assay, Inhibition, Staining, Marker

    4) Product Images from "Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response"

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.9.4199-4211.2002

    Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).
    Figure Legend Snippet: Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).

    Techniques Used: Recombinant, Expressing, Infection, Mouse Assay, Clone Assay, Neutralization, Labeling, SDS Page

    5) Product Images from "Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens"

    Article Title: Characterization of Genes Encoding for Acquired Bacitracin Resistance in Clostridium perfringens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044449

    PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.
    Figure Legend Snippet: PFGE and hybridization analysis of I-CeuI and MluI double-digested DNA of the bacitracin resistant C. perfringens strain c1261_A. PFGE analysis of C. perfringens strain c1261_A total DNA (A). Southern blot of C. perfringens isolate c1261_A total DNA probed with rrn (B) and with bcrB (C). Sizes (in kilobases) are indicated on the left.

    Techniques Used: Hybridization, Southern Blot

    6) Product Images from "The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF"

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF

    Journal: Molecular Therapy

    doi: 10.1038/mt.2015.149

    Construction and characterization of MV-expressing hGCSF . ( a ) Schematic showing cloning of DNA encoding human cytokine granulocyte colony-stimulating factor (hGCSF) p (+) MV-NSe upstream of M, using AatII and MluI restriction enzymes. ( b ) One step growth
    Figure Legend Snippet: Construction and characterization of MV-expressing hGCSF . ( a ) Schematic showing cloning of DNA encoding human cytokine granulocyte colony-stimulating factor (hGCSF) p (+) MV-NSe upstream of M, using AatII and MluI restriction enzymes. ( b ) One step growth

    Techniques Used: Expressing, Clone Assay

    7) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028223

    Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
    Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.

    Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay

    8) Product Images from "Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements"

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements

    Journal: Journal of Virology

    doi: 10.1128/JVI.02231-17

    Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.
    Figure Legend Snippet: Rearranged BKPyV Dunlop NCCR showed higher EVGR expression than did BKPyVww NCCR in HEK293 cells. (A) Schematic representation of the HPyV genome: noncoding control region (NCCR); early viral gene region (EVGR, in red) encoding large and small T antigens (Tags), alternative spliced Tags; microRNAs (blue arrow); late viral gene region (LVGR) encoding structural proteins (Vp1, Vp2, and Vp3) and the agnoprotein (agno) only in BKPyV and JCPyV. (B) Representation of the bidirectional reporter vector pRG13D12, containing the following: NCCR (in gray) in the early to late orientation cloned via restriction sites MluI and BssHII; the red fluorescence protein dsRed2, used as a marker of EVGR expression; the enhanced green fluorescence protein, EGFP, in the opposite orientation, used as a marker of LVGR expression; SV40 polyadenylation signals [SV40 poly(A)] for the dsRed2 and EGFP expression cassette; E1 ori for bacterial plasmid replication; the ampicillin-resistant gene (Amp) for selecting Escherichia coli transformants. (C) Flow cytometry of HEK293 cells 2 dpt with the pRG13D12 reporter vector alone or containing the NCCR of the archetype BKPyVww, the BKPyV(DUN), or the BKPyV(DUN-R) in the reverse orientation. x axis, EGFP fluorescence; y axis, dsRed2 fluorescence; 10,000 control transfected cells were gated for the live gate, while 5,000 transfected cells were gated for the P3 (Q1, Q2, and Q4) gate. Q1, Q4, and Q2 depict cells expressing red fluorescence, green fluorescence, and both, respectively. Ex, excitation wavelength; Em, emission wavelength. (D) Quantification of cells: red bars, sum of red cells (Q1 + Q2); green bars, sum of green cells (Q2 + Q4); yellow bars, red- and green-fluorescence double-positive cells (Q2); black bars, nonfluorescent cells (Q3, negative). Means with standard deviations (SD) from three independent replicates are shown. (E) Normalized mean fluorescence intensity (MFI). The weighted MFI was calculated for each measurement (see formulas in Materials and Methods); late expression was normalized to BKPyVww NCCR (green MFI was set as 100), while early expression was normalized to BKPyVww NCCR (red MFI was set as 1). Means with SD from three independent replicates are shown.

    Techniques Used: Expressing, Plasmid Preparation, Clone Assay, Fluorescence, Marker, Flow Cytometry, Cytometry, Transfection

    9) Product Images from "Ordered Cloned DNA Map of the Genome of Vibrio cholerae 569B and Localization of Genetic Markers"

    Article Title: Ordered Cloned DNA Map of the Genome of Vibrio cholerae 569B and Localization of Genetic Markers

    Journal: Journal of Bacteriology

    doi:

    Landmark analysis of cosmids for identifying overlapping clones. (a and b) Digestion patterns of cosmid clones with Mlu I (lanes 1 to 14), Mlu I plus Bam HI (lanes 15 to 28), and Mlu I plus Sal I (lanes 29 to 42). (c and d) Digestion patterns of cosmid clones with Mlu I (lanes 1 to 10), Mlu I plus Bam HI (lanes 11 to 20), Mlu I plus Sal I (lanes 21 to 30), and Mlu I plus Stu I (lanes 31 to 40).
    Figure Legend Snippet: Landmark analysis of cosmids for identifying overlapping clones. (a and b) Digestion patterns of cosmid clones with Mlu I (lanes 1 to 14), Mlu I plus Bam HI (lanes 15 to 28), and Mlu I plus Sal I (lanes 29 to 42). (c and d) Digestion patterns of cosmid clones with Mlu I (lanes 1 to 10), Mlu I plus Bam HI (lanes 11 to 20), Mlu I plus Sal I (lanes 21 to 30), and Mlu I plus Stu I (lanes 31 to 40).

    Techniques Used: Clone Assay

    Identification of overlapping clones and contig assembly by landmark analysis. (A) Mlu I, Mlu I-plus- Bam HI, and Mlu I-plus- Sal I digestion patterns of four cosmid clones. The closed arrowhead in the Mlu I digest represents fragments common to cosmid clones A42 and A90, which is not cleaved by Bam HI but produced four fragments (closed arrowheads) following Sal I digestion. The closed and open arrows represent two fragments common to cosmid clones A90 and A104. In the Mlu I- Bam HI double digest, both the fragments disappeared and identical new fragments appeared (closed and open arrows). In the Mlu I- Sal I double digest, only the fragment identified by the closed arrow disappeared and identical new fragments appeared (closed arrow). The open arrowhead represents a fragment common to A42 and A14 in the Mlu I digest which disappeared following Bam HI digestion, producing identical new fragments (open arrowhead). The Mlu I fragment common to A42 and A14 did not disappear upon digestion with Mlu I plus Sal I (open arrow). V, vector DNA. (B) Assembled contig comprising four overlapping cosmids, A14, A42, A90, and A104. The extent of overlap between the clones is marked above each overlap.
    Figure Legend Snippet: Identification of overlapping clones and contig assembly by landmark analysis. (A) Mlu I, Mlu I-plus- Bam HI, and Mlu I-plus- Sal I digestion patterns of four cosmid clones. The closed arrowhead in the Mlu I digest represents fragments common to cosmid clones A42 and A90, which is not cleaved by Bam HI but produced four fragments (closed arrowheads) following Sal I digestion. The closed and open arrows represent two fragments common to cosmid clones A90 and A104. In the Mlu I- Bam HI double digest, both the fragments disappeared and identical new fragments appeared (closed and open arrows). In the Mlu I- Sal I double digest, only the fragment identified by the closed arrow disappeared and identical new fragments appeared (closed arrow). The open arrowhead represents a fragment common to A42 and A14 in the Mlu I digest which disappeared following Bam HI digestion, producing identical new fragments (open arrowhead). The Mlu I fragment common to A42 and A14 did not disappear upon digestion with Mlu I plus Sal I (open arrow). V, vector DNA. (B) Assembled contig comprising four overlapping cosmids, A14, A42, A90, and A104. The extent of overlap between the clones is marked above each overlap.

    Techniques Used: Clone Assay, Produced, Plasmid Preparation

    10) Product Images from "Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response"

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.9.4199-4211.2002

    Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).
    Figure Legend Snippet: Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).

    Techniques Used: Recombinant, Expressing, Infection, Mouse Assay, Clone Assay, Neutralization, Labeling, SDS Page

    11) Product Images from "Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis"

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

    Journal: Nature protocols

    doi: 10.1038/nprot.2010.131

    Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.
    Figure Legend Snippet: Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCC AAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added Asc I recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Cha t in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

    Techniques Used: Amplification, Sequencing, Plasmid Preparation, Clone Assay

    12) Product Images from "Efficient method for site-directed mutagenesis in large plasmids without subcloning"

    Article Title: Efficient method for site-directed mutagenesis in large plasmids without subcloning

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0177788

    Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.
    Figure Legend Snippet: Validation of the URMAC method by insertion (I), substitution (S), or deletion (D) of some restriction sites in pUC18 plasmid. (A) Illustration of the Modification Target (NdeI restriction site) relative to the flanking restriction sites and location of the Starter Primers SP1 and SP2. After the first PCR, the Starter DNA migrated as expected, 532 bp on a 1% agarose gel (photo, arrow at right). A 100 bp DNA size ladder is shown in left lane for comparison. (B) Diagram of the strategy for I, S, or D using the Closed Starter DNA circularized from the PCR product in (A) as template and the Opener/Mutagenic Primers . The top photo shows the PCR product, Intermediate DNA , which contained the mutations. The bottom photo shows the Modified DNA after enrichment PCR step using SP1 and SP2. (C) Validation of URMAC mutagenesis for the three different types of mutations by restriction analysis. Fig 2C shows bands of expected DNA fragment size after digestion with respective restriction enzymes. In the control Starter PCR lane, only DNA treated with NdeI enzyme, cut the DNA into two fragments of 382 150 bp. Untreated DNA or DNA treated with MluI remained at the full size of 532 bp. In the Insertion lane, both NdeI and MluI cut the DNA at the expected sizes of 382 150 for NdeI and 383 149 for MluI. In the Substitution lane, only MluI cut the DNA producing the expected 383 149 bp bands. In the Deletion lane, none of the enzymes cut the DNA, leaving the bands at their original Modified DNA size.

    Techniques Used: Plasmid Preparation, Modification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mutagenesis

    13) Product Images from "A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer"

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028223

    Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.
    Figure Legend Snippet: Validation results of BSP for DNA methylation and RT-qPCR for gene expression. A. Validation results of MMSDK with BSP. To compare the BSP-Sanger sequencing data and deep sequencing MMSDK data, the MluI loci that were determined to be differentially methylated on average by deep sequencing were validated using BSP. The height of the columns represents the log2-transformed average fold change (tumor/normal) in methylation level across the 9 patients. B. BSP and RT-qPCR results for four cancer-associated genes examined in 33 bladder cancer patients. The methylation levels of promoters of four selected genes (SLIT2, HIC1, RASRAl1, KRT17) and their expression level were evaluated in a panel of 33 samples. The height of the columns represents the log2 average fold change (tumor/normal) in methylation level (blue) or expression level (red) across all patients. The bars represent the standard error. The number of samples (n) used in the validation assay is indicated beside each standard error bar.

    Techniques Used: DNA Methylation Assay, Quantitative RT-PCR, Expressing, Sequencing, Methylation, Transformation Assay

    14) Product Images from "Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells"

    Article Title: Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells

    Journal: Neural Regeneration Research

    doi: 10.4103/1673-5374.165523

    Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Techniques Used: Recombinant, Plasmid Preparation, Marker, Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, Derivative Assay

    Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Techniques Used: Polymerase Chain Reaction, Marker, Recombinant, Plasmid Preparation, Derivative Assay

    Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.

    Techniques Used: Polymerase Chain Reaction, Marker, Amplification, Recombinant, Plasmid Preparation, Derivative Assay

    15) Product Images from "Intestine-Specific Overexpression of LDLR Enhances Cholesterol Excretion and Induces Metabolic Changes in Male Mice"

    Article Title: Intestine-Specific Overexpression of LDLR Enhances Cholesterol Excretion and Induces Metabolic Changes in Male Mice

    Journal: Endocrinology

    doi: 10.1210/en.2018-00098

    Molecular characterization of the transgenic mouse line [C57BL/6-TG(Vil-LDLR)] of intestine-specific LDLR overexpression. (A) Schematic representation of the construct we used to generate the mice. Mlu I and Kpn I restriction enzyme sites, which were used to clone the open reading frame of the human (h)LDLR gene, are shown. Primer location and representative genotyping results [(A), lower panel; anticipated PCR product, 195 bp] are shown. (B) Droplet PCR results obtained using F 1 and F 2 ) copies. (C) Representative transgene and (D) LDLR protein expression levels in the duodenum of F 2 animals (transgenic mice, n = 4; wild-type mice, n = 3). Data shown in (C) represent mean ± SD. (E) Immunohistochemical staining detected intestinal LDLR overexpression and located the transgene in the columnar epithelium and crypt cells. Representative sections of proximal intestinal sections stained against LDLR are shown. Upper panel: left to right, ×4 and ×10 original magnification of sections. Lower panel: details of villi and crypt cell staining (original magnification, ×40). Arrows indicate examples of areas with positive staining. 1, positive control (12.4-kb Villin-ΔATG-hLDLR plasmid DNA); 2, colony founder (F 0 ); 3, F 1 mouse (obtained by crossing F 0 with C57BL/6 wild-type mice); 4, negative control (C57BL/6 wild-type mouse); 5, F 1 mouse; 6, H 2 O; L, ladder; TG, C57BL/6-TG(Vil-LDLR) transgenic mice; WT, wild-type littermate controls.
    Figure Legend Snippet: Molecular characterization of the transgenic mouse line [C57BL/6-TG(Vil-LDLR)] of intestine-specific LDLR overexpression. (A) Schematic representation of the construct we used to generate the mice. Mlu I and Kpn I restriction enzyme sites, which were used to clone the open reading frame of the human (h)LDLR gene, are shown. Primer location and representative genotyping results [(A), lower panel; anticipated PCR product, 195 bp] are shown. (B) Droplet PCR results obtained using F 1 and F 2 ) copies. (C) Representative transgene and (D) LDLR protein expression levels in the duodenum of F 2 animals (transgenic mice, n = 4; wild-type mice, n = 3). Data shown in (C) represent mean ± SD. (E) Immunohistochemical staining detected intestinal LDLR overexpression and located the transgene in the columnar epithelium and crypt cells. Representative sections of proximal intestinal sections stained against LDLR are shown. Upper panel: left to right, ×4 and ×10 original magnification of sections. Lower panel: details of villi and crypt cell staining (original magnification, ×40). Arrows indicate examples of areas with positive staining. 1, positive control (12.4-kb Villin-ΔATG-hLDLR plasmid DNA); 2, colony founder (F 0 ); 3, F 1 mouse (obtained by crossing F 0 with C57BL/6 wild-type mice); 4, negative control (C57BL/6 wild-type mouse); 5, F 1 mouse; 6, H 2 O; L, ladder; TG, C57BL/6-TG(Vil-LDLR) transgenic mice; WT, wild-type littermate controls.

    Techniques Used: Transgenic Assay, Over Expression, Construct, Mouse Assay, Polymerase Chain Reaction, Expressing, Immunohistochemistry, Staining, Positive Control, Plasmid Preparation, Negative Control

    16) Product Images from "The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks"

    Article Title: The abundance of Fob1 modulates the efficiency of rRFBs to stall replication forks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx655

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_MEM_3rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_MEM_3rRFBs+ (8908 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note the insertion of an EcoRI fragment containing the three putative Fob1 binding sites expected to act as RFBs (indicated in red), described by Kobayashi ( 20 ). ( B ) Map of the 3708 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with SwaI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 5186 bp linear fragment generated by digestion of pYAC_MEM_3rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3708 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5186-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_3′rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_3′rRFBs+ (8175 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the three putative Fob1 binding sites expected to act as RFBs (indicated in red and white), described by Kobayashi ( 20 ), are equally distanced. ( B ) Map of the 3710-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with FspI and BamHI showing the relative position of the three putative RFBs. ( C ) Map of the 4454-bp linear fragment generated by digestion of pYAC_AC_3′rRFBs+ with EcoRV and MluI showing the relative position of the three putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the FspI-BamHI 3710-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4454-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks and the distance separating them. For comparison, the densitometric profile corresponding to pYAC_MEM_3rRFBs shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, Generated

    Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.
    Figure Legend Snippet: Genetic map and 2D gel analysis of linear fragments corresponding to pYAC_MEM. ( A ) Genetic map of pYAC_MEM (7966 bp) showing its most relevant features: clockwise starting with the replication origin ARS4 (indicated in green), URA3 gene active in Saccharomyces cerevisiae (indicated in light blue), L1 lambda DNA used for hybridization (indicated in yellow), HIS3 gene active in S. cerevisiae (indicated in light blue), L2 lambda DNA used for hybridization (indicated in yellow), the ColE1 replication origin active only in Escherichia coli (indicated in gray), the ampicillin resistance gene active only in E. coli (indicated in gray) and the budding yeast centromeric sequence CEN6 (indicated in orange). The sites for specific restriction endonucleases are indicated outside the map. In addition, a magenta triangle points the position located 180° apart from the replication origin ARS4. ( B ) Map of the 2764-bp linear fragment generated by digestion of pYAC_MEM with SwaI and BamHI. ( C ) Map of the 4245-bp linear fragment generated by digestion of pYAC_MEM with EcoRV and MluI. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 2764 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 4245-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). De-localized termination signals are indicated in magenta.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Lambda DNA Preparation, Hybridization, Sequencing, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ isolated from cells that overexpress Fob1 and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the ten putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705 bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194 bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in ( D ) is presented in ( H ) indicating the height of the peaks. For comparison, the densitometric profile corresponding to the 3705-bp SwaI-BamHI of pYAC_AC_10rRFBs isolated from the top2-td strain shown in Figure 4H is presented on top.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Isolation, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.
    Figure Legend Snippet: Genetic map, 2D gel analysis of linear fragments corresponding to pYAC_AC_10rRFBs+ and densitometry of the spots accumulated on the simple-Y arc. ( A ) Genetic map of pYAC_AC_10rRFBs+ (8916 bp) showing its most relevant features (for further details see the legend of Figure 3 ). Note that here the fragment inserted at the unique SalI site of pYAC_MEM contained the 10 Fob1 binding sites described by Kobayashi ( 20 ) that were confirmed to act as RFBs in vivo (See Figures 4 and 5 ). ( B ) Map of the 3705-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with SwaI and BamHI showing the relative position of the 10 putative RFBs. ( C ) Map of the 5194-bp linear fragment generated by digestion of pYAC_AC_10rRFBs+ with EcoRV and MluI showing the relative position of the 10 putative RFBs. ( D ) 2D gel immunogram of the RIs corresponding to the SwaI-BamHI 3705-bp linear fragment with its diagrammatic interpretation in ( E ). The 2D gel immunogram of the RIs corresponding to the EcoRV-MluI 5194-bp linear fragment is shown in ( F ) with its diagrammatic interpretation in ( G ). The densitometric profile corresponding to the six most distal spots observed on the simple-Y arc shown in (D) is presented in ( H ) indicating the height of the peaks.

    Techniques Used: Two-Dimensional Gel Electrophoresis, Binding Assay, Activated Clotting Time Assay, In Vivo, Generated

    17) Product Images from "The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS"

    Article Title: The use of an adeno-associated viral vector for efficient bicistronic expression of two genes in the CNS

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-4939-0777-9_16

    (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing
    Figure Legend Snippet: (A) psubCMV-2A-WPRE plasmid map showing NheI site for cloning a transgene immediately downstream of the CMV promoter (and upstream of the 2A sequence) and an MluI site for cloning a transgene downstream of the 2A sequence. (B) Nucleotide sequence showing

    Techniques Used: Plasmid Preparation, Clone Assay, Sequencing

    18) Product Images from "Efficient repair of A/C mismatches in mouse cells deficient in long-patch mismatch repair"

    Article Title: Efficient repair of A/C mismatches in mouse cells deficient in long-patch mismatch repair

    Journal: The EMBO Journal

    doi: 10.1093/emboj/19.7.1711

    Fig. 7. Estimate of the size of repair patch accompanied by A/C repair. Each mismatched or gapped substrate was incubated with RH95021 or Colo26 cell extract in the presence of [α- 32 P]dGTP, recovered and digested with Mlu I. The relative mass corresponding to 3903 bp fragments was estimated using the Gel Doc 1000 system. Autoradiography of the same gel was performed using a PhosphorImager. From the relative mass and the radioactivity, the specific radioactivity in each band was calculated. The specific activity measurements of the 3903 bp fragments derived from G:C nick(+), GAP1 and GAP2 substrates were highly proportional to the number of guanine residues in the gaps. This linear relationship ( R 2 = 1.00) was used to calculate the number of incorporated dGMP residues associated with each correction event. The repair patch size was estimated based on the local DNA sequence.
    Figure Legend Snippet: Fig. 7. Estimate of the size of repair patch accompanied by A/C repair. Each mismatched or gapped substrate was incubated with RH95021 or Colo26 cell extract in the presence of [α- 32 P]dGTP, recovered and digested with Mlu I. The relative mass corresponding to 3903 bp fragments was estimated using the Gel Doc 1000 system. Autoradiography of the same gel was performed using a PhosphorImager. From the relative mass and the radioactivity, the specific radioactivity in each band was calculated. The specific activity measurements of the 3903 bp fragments derived from G:C nick(+), GAP1 and GAP2 substrates were highly proportional to the number of guanine residues in the gaps. This linear relationship ( R 2 = 1.00) was used to calculate the number of incorporated dGMP residues associated with each correction event. The repair patch size was estimated based on the local DNA sequence.

    Techniques Used: Incubation, Autoradiography, Radioactivity, Activity Assay, Derivative Assay, Sequencing

    Fig. 2. Mismatch repair activity in extracts of Colo26, HeLaS3 and RH95021 cells. ( A ) T/C mismatch repair. Cell extracts were standardized for gap-filling activity as described in Materials and methods. The amount of extracts corresponding to the GFU indicated was incubated with the mismatched substrate (141 fmol). DNA was recovered, digested with Mlu I and the products separated on an agarose gel. The uppermost band is the unrepaired or incompletely repaired substrate. The repair product of 3903 bp is shown arrowed. (The lowest band represents re-annealed linearized plasmids, which do not interfere with the assay.) The amount of repair is plotted as a function of GFU for HeLaS3 (▪), Colo26 (wild-type mouse) (○) or RH95021 ( Msh2 –/– mouse) (▴). ( B ) Efficiency of correction of different mismatches by human and mouse cell extracts. Mismatch repair assays were carried out using the different mismatched substrates indicated and 1.5 GFU cell extract. After recovery of DNA and digestion with the appropriate diagnostic restriction enzyme, products were separated on agarose gels. The repair products (arrowed) were quantified as described in Materials and methods. Colo26 (□); HeLaS3 (□); RH95021 (▪).
    Figure Legend Snippet: Fig. 2. Mismatch repair activity in extracts of Colo26, HeLaS3 and RH95021 cells. ( A ) T/C mismatch repair. Cell extracts were standardized for gap-filling activity as described in Materials and methods. The amount of extracts corresponding to the GFU indicated was incubated with the mismatched substrate (141 fmol). DNA was recovered, digested with Mlu I and the products separated on an agarose gel. The uppermost band is the unrepaired or incompletely repaired substrate. The repair product of 3903 bp is shown arrowed. (The lowest band represents re-annealed linearized plasmids, which do not interfere with the assay.) The amount of repair is plotted as a function of GFU for HeLaS3 (▪), Colo26 (wild-type mouse) (○) or RH95021 ( Msh2 –/– mouse) (▴). ( B ) Efficiency of correction of different mismatches by human and mouse cell extracts. Mismatch repair assays were carried out using the different mismatched substrates indicated and 1.5 GFU cell extract. After recovery of DNA and digestion with the appropriate diagnostic restriction enzyme, products were separated on agarose gels. The repair products (arrowed) were quantified as described in Materials and methods. Colo26 (□); HeLaS3 (□); RH95021 (▪).

    Techniques Used: Activity Assay, Incubation, Agarose Gel Electrophoresis, Diagnostic Assay

    Fig. 3. A/C mismatch repair by extracts of RH95021 cells. ( A ) An A/C mismatched substrate (141 fmol) was incubated for 20 min with extracts of Msh2 –/– RH95021 cells corresponding to the GFU indicated. The DNA was digested with Mlu I and analysed by agarose gel electrophoresis. The repair products (arrowed) were quantified as described in Materials and methods. ( B ) An A/C mismatched substrate was incubated with 1.0 GFU of cell extract for the times indicated. Products were analysed and quantified as above. RH95021 (▪); Colo26 (○).
    Figure Legend Snippet: Fig. 3. A/C mismatch repair by extracts of RH95021 cells. ( A ) An A/C mismatched substrate (141 fmol) was incubated for 20 min with extracts of Msh2 –/– RH95021 cells corresponding to the GFU indicated. The DNA was digested with Mlu I and analysed by agarose gel electrophoresis. The repair products (arrowed) were quantified as described in Materials and methods. ( B ) An A/C mismatched substrate was incubated with 1.0 GFU of cell extract for the times indicated. Products were analysed and quantified as above. RH95021 (▪); Colo26 (○).

    Techniques Used: Incubation, Agarose Gel Electrophoresis

    19) Product Images from "Replication-Competent Rhabdoviruses with Human Immunodeficiency Virus Type 1 Coats and Green Fluorescent Protein: Entry by a pH-Independent Pathway"

    Article Title: Replication-Competent Rhabdoviruses with Human Immunodeficiency Virus Type 1 Coats and Green Fluorescent Protein: Entry by a pH-Independent Pathway

    Journal: Journal of Virology

    doi:

    Diagrams of recombinant VSV genomes. To generate VSV-GFP, the GFP gene was inserted into the VSV genome sequence preceded by the appropriate VSV transcription start and stop sequences (SS). The ΔG-gp160G-GFP clone was constructed by inserting the gp160G gene, again under the control of VSV transcriptional start and stop sequences, upstream of the GFP gene in the VSV-GFP clone. Diagrams represent the negative-sense RNA viral genome, extending 3′ to 5′ from left to right. Xho I, Nhe I, and Mlu I cleavage sites are indicated.
    Figure Legend Snippet: Diagrams of recombinant VSV genomes. To generate VSV-GFP, the GFP gene was inserted into the VSV genome sequence preceded by the appropriate VSV transcription start and stop sequences (SS). The ΔG-gp160G-GFP clone was constructed by inserting the gp160G gene, again under the control of VSV transcriptional start and stop sequences, upstream of the GFP gene in the VSV-GFP clone. Diagrams represent the negative-sense RNA viral genome, extending 3′ to 5′ from left to right. Xho I, Nhe I, and Mlu I cleavage sites are indicated.

    Techniques Used: Recombinant, Sequencing, Construct

    20) Product Images from "LIGHT elevation enhances immune eradication of colon cancer metastases"

    Article Title: LIGHT elevation enhances immune eradication of colon cancer metastases

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-16-1655

    LIGHT expressing colon cancer cell lines maintain wild-type characteristics (A) To construct constitutive and doxycycline inducible(i) expressing LIGHT lentiviral vectors, murine LIGHT cDNA was cloned into MluI/PstI sites of the pHIV-Puro (pHIV-LIGHT) and pLVX-TRE3G (pLVX-LIGHT) parental plasmids. (B) CT26 cell clones constitutively expressing LIGHT (CT26LIGHT) or inducible expressing LIGHT (CT26LIGHT i ) or its empty control (CT26control i ) were established after drug selection and limited dilution, and LIGHT expression was analyzed using FACS after DNA sequencing. (C) LIGHT protein expression was confirmed in CT26LIGHT cells and CT26LIGHT i cells in the presence of doxycycline. The LIGHT expressing murine fibrosarcoma cell line Ag104LIGHT served as a positive control. (D) wtCT26, CT26control (empty vector), CT26control i , CT26LIGHTand CT26LIGHT i ). Cells were seeded in triplicate and MTS/PMS solution was added on days 1 2, 3, 4, and 5 with no difference in cell proliferation or metabolic activity.
    Figure Legend Snippet: LIGHT expressing colon cancer cell lines maintain wild-type characteristics (A) To construct constitutive and doxycycline inducible(i) expressing LIGHT lentiviral vectors, murine LIGHT cDNA was cloned into MluI/PstI sites of the pHIV-Puro (pHIV-LIGHT) and pLVX-TRE3G (pLVX-LIGHT) parental plasmids. (B) CT26 cell clones constitutively expressing LIGHT (CT26LIGHT) or inducible expressing LIGHT (CT26LIGHT i ) or its empty control (CT26control i ) were established after drug selection and limited dilution, and LIGHT expression was analyzed using FACS after DNA sequencing. (C) LIGHT protein expression was confirmed in CT26LIGHT cells and CT26LIGHT i cells in the presence of doxycycline. The LIGHT expressing murine fibrosarcoma cell line Ag104LIGHT served as a positive control. (D) wtCT26, CT26control (empty vector), CT26control i , CT26LIGHTand CT26LIGHT i ). Cells were seeded in triplicate and MTS/PMS solution was added on days 1 2, 3, 4, and 5 with no difference in cell proliferation or metabolic activity.

    Techniques Used: Expressing, Construct, Clone Assay, Selection, FACS, DNA Sequencing, Positive Control, Plasmid Preparation, Activity Assay

    Related Articles

    Clone Assay:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements
    Article Snippet: .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12. .. HPyV NCCR constructs were verified by Sanger sequencing for correct NCCR sequences and orientations using the 3130 genetic analyzer (Applied Biosystems, Switzerland).

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis
    Article Snippet: .. The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment. .. Thus, the present study successfully generated the pcDNA3.1-PapoE-HSD11B1-PIP-CHOP-IAPP recombinant vector.

    Amplification:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Synthesized:

    Article Title: Novel Human Polyomavirus Noncoding Control Regions Differ in Bidirectional Gene Expression according to Host Cell, Large T-Antigen Expression, and Clinically Occurring Rearrangements
    Article Snippet: .. The HPyV NCCRs were chemically synthesized in pUC57 (Eurogentec S.A, Belgium) , excised using the restriction enzymes BssHII and MluI (New England BioLabs, England), and cloned into the corresponding restriction sites of pRG13D12. .. HPyV NCCR constructs were verified by Sanger sequencing for correct NCCR sequences and orientations using the 3130 genetic analyzer (Applied Biosystems, Switzerland).

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis
    Article Snippet: .. The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment. .. Thus, the present study successfully generated the pcDNA3.1-PapoE-HSD11B1-PIP-CHOP-IAPP recombinant vector.

    Construct:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Sequencing:

    Article Title: A Systematic Analysis on DNA Methylation and the Expression of Both mRNA and microRNA in Bladder Cancer
    Article Snippet: .. Briefly, 3 µg of genomic DNA was digested with MluI (recognition sequence: ACGCGT ) (NEB, US). .. The MluI -digested genomic DNA was ligated to biotinylated linkers and fragmented by NlaIII cleavage (NEB, US).

    Polymerase Chain Reaction:

    Article Title: The Role of Neutrophils in Measles Virus–mediated Oncolysis Differs Between B-cell Malignancies and Is Not Always Enhanced by GCSF
    Article Snippet: .. It was then PCR amplified with the following primers, forward primer MluI+hGCSF: 5′- agtattac acgcgt atggctggacctgccacccagagc-3′ and reverse primer: AatII_hGCSF: 5′-tacagtcg gacgtc attcagggctgggcaaggtggcg-3′, and the PCR product was cloned into the MVNSe backbone using AatII and MluI restriction endonucleases (New England Biolab, UK), replacing GFP, upstream of MV M gene. ..

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response
    Article Snippet: .. The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert. ..

    Plasmid Preparation:

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus
    Article Snippet: .. In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB). .. Finally, the plasmid was closed using T4 DNA ligase (NEB) and transformed into Escherichia coli .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs mlu i
    Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, <t>Mlu</t> I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.
    Mlu I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mlu i/product/New England Biolabs
    Average 98 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    mlu i - by Bioz Stars, 2020-05
    98/100 stars
      Buy from Supplier

    Image Search Results


    Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.

    Journal: Molecular Medicine Reports

    Article Title: Multi-transgenic minipig models exhibiting potential for hepatic insulin resistance and pancreatic apoptosis

    doi: 10.3892/mmr.2015.4582

    Figure Lengend Snippet: Generation and identification of multi-transgenic PFFs and minipigs. (A) Schematic structure of tissue-specific polycistronic system (8,840 bp). The head-to-head arrows represent the primers for transgenic recognition, copy number measurement and gene expression analysis. The fragment between the two restriction sites comprises two cassettes isolated by an insulator: ( 1 ) 11β-HSD1 driven by the liver-specific PapoE; ( 2 ) hIAPP and CHOP linked to the F-2A peptide driven by the PIP. (B) PCR screening of multi-transgenic PFFs. Amplification of the PapoE-11b, PIP-CHOP, CHOP-IAPP and IAPP-pA fragments is shown, respectively. Lanes 42–44, three representative PFFs transfected by the vector. (C) Multi-transgenic piglets produced by somatic cell nuclear transfer. (D) Genomic DNA PCR identification of piglet 1 # , 2 # and negative control. F1–F3 indicate the three anticipated bands corresponding to PapoE-11b, PIP-CHOP and CHOP-IAPP, respectively. Tg, transgenic; 11β-HSD1, 11-β-hydroxysteroid dehydrogenase 1; PapoE; hIAPP; human islet amyloid polypeptide; PIP, porcine pancreas-specific insulin promoter; CHOP; C/EBP homologous protein; PCR, polymerase chain reaction; V, positive vector; N, negative control; M, 100 bp DNA ladder; W, ddH2O. MluI, Mlu I restriction enzyme site; NotI, Not I restriction enzyme site; PFFs, porcine fetal fibroblasts.

    Article Snippet: The multiple cloning site of pcDNA3.1 (+) was digested using the Mlu I and Not I enzymes (New England Biolabs, Beijing, China), and the cytomegalovirus (CMV) promoter fragment was replaced with this synthesized fragment.

    Techniques: Transgenic Assay, Expressing, Isolation, Polymerase Chain Reaction, Amplification, Transfection, Plasmid Preparation, Produced, Negative Control

    Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Journal:

    Article Title: Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach

    doi: 10.1128/AEM.71.3.1311-1317.2005

    Figure Lengend Snippet: Digestion patterns of type A (ATCC 3502) and type B (FT 243) proteolytic C. botulinum strains using the rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, and RsrII. The pulse time ramp was 1 to 22 s, and the running time was 20 h. The outermost

    Article Snippet: Nine rare-cutting restriction enzymes, ApaI, AscI, MluI, NruI, PmeI, RsrII, SacII, SmaI, and XhoI (New England Biolabs), were chosen for testing the cleavage of DNA of proteolytic C. botulinum .

    Techniques:

    Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.

    Journal: Journal of Virology

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus

    doi: 10.1128/JVI.79.11.6984-6996.2005

    Figure Lengend Snippet: Shuttle mutagenesis strategy used to construct vLIP mutant MDVs and revertants in the pRB-1B BAC. A 4.268-kb fragment of the Md5 strain of MDV, containing the vLIP gene and portions of neighboring genes, was cloned into pST76K-SR, a RecA-based shuttle vector. In step 1 (labeled arrow), an in-frame deletion of vLIP amino acids 256 to 426 was incorporated into the pRB-1B BAC by shuttle mutagenesis using a pST76K-SR-based shuttle vector bearing the same deletion (ΔMluI-SpeI), yielding Δ vLIP . In parallel (step 2), an alanine point mutant of the vLIP serine nucleophile position ( vLIP S307A) was incorporated into pRB-1B. As depicted in steps 3 and 4, shuttle mutagenesis was performed on the Δ vLIP BAC to generate C-terminally FLAG tagged vLIP ( vLIP *-rev) and native vLIP ( vLIP -rev) revertants. Relevant features of the DNA fragment used and modified in shuttle mutagenesis procedures are labeled accordingly. A double-headed arrow represents lipase homology in the vLIP ORF, a white X represents the location of the S307A change, a FLAG epitope tag is represented as a labeled asterisk, and the MluI and SpeI sites which were used to remove the lipase homology region of vLIP are labeled accordingly.

    Article Snippet: In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Techniques: Mutagenesis, Construct, BAC Assay, Clone Assay, Plasmid Preparation, Labeling, Modification, FLAG-tag

    (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.

    Journal: Journal of Virology

    Article Title: vLIP, a Viral Lipase Homologue, Is a Virulence Factor of Marek's Disease Virus

    doi: 10.1128/JVI.79.11.6984-6996.2005

    Figure Lengend Snippet: (a) Location of vLIP relative to other genes in the MDV genome. The vLIP open reading frame is drawn to scale; a bar representing 1 kb is drawn and labeled. The terminal repeat long (TR L ) region, the U L region, and an a-like sequence (double-headed arrow) are also indicated. Several MDV-1-specific ORFs neighboring the vLIP gene are displayed, as are the conserved genes U L 1 to U L 3. The gene organization of the vLIP transcript is shown in more detail below, also drawn to scale. A 500-bp bar is shown, and the TATA box, putatively used to initiate vLIP transcripts, as well as the poly(A) site and poly(A) signal, is labeled. MluI and SpeI restriction sites flanking the lipase homology region, indicated by a double-headed arrow, are also labeled. (b) The vLIP transcript as visualized by Northern blotting. In the left panel, a Northern blot was probed with a single-stranded riboprobe antisense to vLIP mRNA. RNA samples were derived from MSB-1 tumor cells which had been either treated for 24 h in the presence of sodium butyrate to induce virus replication or left untreated, as indicated. PFA was also used where indicated, to show the sensitivity of vLIP transcription to inhibition of DNA replication. To the right, RNA samples used in Northern blotting were separated on denatured agarose gels, stained with ethidium bromide, and imaged to verify that RNA integrity and quantity were comparable across all samples tested. An RNA marker (Ambion) was included to determine molecular weights.

    Article Snippet: In order to construct a shuttle vector to incorporate an in-frame deletion of amino acids 256 to 428 of the vLIP open reading frame, a 519-bp fragment was released from the pEco4.268 plasmid using MluI and SpeI, and overhangs were filled in using T4 DNA polymerase (NEB).

    Techniques: Labeling, Sequencing, Northern Blot, Derivative Assay, Inhibition, Staining, Marker

    Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).

    Journal: Journal of Virology

    Article Title: Role of N-Linked Glycans in a Human Immunodeficiency Virus Envelope Glycoprotein: Effects on Protein Function and the Neutralizing Antibody Response

    doi: 10.1128/JVI.76.9.4199-4211.2002

    Figure Lengend Snippet: Diagram of recombinant VSV, VSV-89.6G, and VSVΔG-89.6G-GFP genomes, and expression of 89.6G glycosylation mutants in VSVΔG-GFP-infected cells. rwt VSV, VSV-89.6G, and VSV-89.6G glycosylation mutants were used for immunizations of mice. The 89.6G glycosylation mutants were also cloned into the Mlu I and Nhe I sites of VSVΔG-GFP cDNA between the M and GFP genes. These recombinant viruses were used for Env neutralization assays (A). BHK-G cells were infected with recombinant VSVs for 8 h and labeled with [ 35 S]methionine for 1 h, and cell lysates were analyzed by SDS-PAGE. The positions of four VSV proteins (L, G, N, and P) as well as HIV Env G are indicated (B).

    Article Snippet: The PCR product was digested with Mlu I and Nhe I restriction enzymes (New England Biolabs) and ligated to pVSVΔG-JRFLG-GFP , which had previously been digested with Mlu I and Nhe I to remove the JRFLG insert.

    Techniques: Recombinant, Expressing, Infection, Mouse Assay, Clone Assay, Neutralization, Labeling, SDS Page