clai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ClaI
    Description:
    ClaI 5 000 units
    Catalog Number:
    R0197L
    Price:
    264
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs clai
    ClaI
    ClaI 5 000 units
    https://www.bioz.com/result/clai/product/New England Biolabs
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    clai - by Bioz Stars, 2019-08
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: The pSP301 and derived plasmids were digested by ClaI (New England Biolabs). .. The CYS21 strain (DH10B derived with ccdB in the chromosome) (Delphigenetics) was transformed with the linear plasmid, and plated on LB agar.

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: The obtained pGEM-T NS2-3AgeI plasmid was subsequently cleaved with BsmBI and AgeI, and the fragment was cloned into pBici-388 RLuc NS3-3′ treated with NcoI and AgeI, resulting in pBici-388 Rluc NS2-3′. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The Gc ruvB and ruvC loci were cloned into the pBLUNT vector (Invitrogen) using the primers RUVBFOR (CCATTCCGCCCCCGACATA), RUVBREV (GCTGATGTGGGTCAACCCC), RUVCFOR2 (GGCGAATGTCGAAAACAATAAAT), and RUVCREV2 (CAAATAATGCTTATTGCGGTAG) and mutated using a deletion/insertion strategy. .. The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: Paragraph title: Cloning of RNA Elements and RBPs ... Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: The products were cloned into pUC19 and introduced into E. coli (DH5α) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3).

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: It was cloned by combining the origin of transfer from a pBSL vector , the multiple-cloning site and the origin of replication from pBC SK+ (Stratagene, California), and the nptII gene for kanamycin resistance from pZERO2.1 (Invitrogen, California). .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Centrifugation:

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: Amplicons were treated by one of four methods before use in downstream applications: QIAquick columns, incubation at 65 °C for 10 min followed by centrifugation at 3800 rcf for 20 s, incubation at 65 °C for 10 min, or no post-amplification treatment. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Amplification:

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: To construct the bicistronic Bici-388 RLuc NS2-3′ replicon, a region encompassing BVDV CP7 genomic sequence 3809 to 5359, including the entire NS2 and the N terminus of NS3, was amplified using the primers BVDV NS2 BsmBI se (5′- CGTCTC CCATGGAACCAGGTGCCCAGGGGTACCTAGAGCAGGTAGACC-3′) and BVDV NS3 AgeI ase (5′- ACCGGT TTCCAATCCCCTCCTTACCTTTAGTAGTGCTG-3′), where the underlined sequences correspond to the BsmBI and AgeI restriction sites. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: It was amplified from the 3′ UTRome entry vector. .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: Human PDGFRβ cDNA was amplified from hPDGFRβ in pEF6 (Invitrogen, Carlsbad, CA) with primers (all primer sequences available upon request) using proof-reading Pfu polymerase (Stratagene, La Jolla, CA). .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin .

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso. .. A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso.

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: The sequence of pBAV208 is available upon request. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix. .. The resulting construct, pVT138, was transferred to the P. syringae 508 chromosome by triparental mating.

    TA Cloning:

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Construct:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA). .. The PCR products were digested with Dpn I (New England BioLabs) at 37°C for 1 hour and transformed into DH5α competent cells.

    Article Title: Inter-telomeric recombination is present in telomerase-positive human cells
    Article Snippet: A telomeric recombination reporter system is a valuable tool not only with regard to elucidating the mechanism of ALT but also to assess the efficacy of potential drugs that target the ALT pathway. .. For the subtelomeric reporter construct (subtel-tag) the SV40-puromycin resistance gene was isolated from the pBabe-Puro retroviral vector by HindIII and ClaI restriction enzyme digestion (New England Biolabs). .. The isolated fragment was ligated into the polylinker region of the pSV-Zeo plasmid (Invitrogen).

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes. .. All NS5A deletion mutations derived from the pKS(+)Sal-NS5A-Cla plasmids were ligated into pDI-388, pBici-388, pT7-DI-388, and pCP7-388 plasmids via SalI and ClaI restriction sites to obtain either the final monocistronic or bicistronic replicon plasmids or the pCP7-388 full-length cDNA constructs.

    Article Title: Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion
    Article Snippet: The recombinant plasmid pcDNA3.1-B2c was constructed by inserting the genome of CVS-B2c into the mammalian expression vector pcDNA3.1 as described previously ( , ). .. The PCR products were first digested with ClaI and KpnI (New England BioLabs, Beverly, MA) and then ligated into pcDNA3.1-B2c, which had been digested with ClaI and KpnI.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The pADH1::GFP: unc-54 :MCS:Ribozyme plasmid expression vector was generated using sequential PCR stitching and gap repair of DNA constructs into the pDest22 backbone (Thermo Fisher Scientific). .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: The resulting PCR product (ClaI-CMV-TetO2-EcoRI) was purified using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3). .. To obtain lentiviral particles containing the OAT constructs, lentiviral stock was produced by transfecting the pLenti expression constructs with packaging plasmid mix into the HEK293FT cell line using ViraPower Lentiviral Gateway Expression Systems (Invitrogen), according to the manufacturer’s instructions.

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: Two integrative plasmids were constructed from pBAV208. pBAV208 is a cloning vector with an origin of transfer for transferring constructs from Escherichia coli to P. syringae by triparental mating. pBAV208 can be used either for disrupting genes in P. syringae or for adding genes to the chromosome of P. syringae by Campbell integration. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Electrophoresis:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Incubation:

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Supernatant was filtered to remove any particles and then incubated on ice for 15 minutes after addition of 1/10 volume of endotoxin removal buffer (1% Triton X-114). .. Prior to transfection, 50 μg of plasmid were linearized by digesting with 50 units of ClaI (New England Biolabs) restriction enzyme for 1 hour at 37°C.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Data from two independent experiments were used to calculate the average ratio (and absolute deviation) of each nucleotide inserted opposite the AP lesion after replication. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Characterization of Toxin Plasmids in Clostridium perfringens Type C Isolates
    Article Snippet: Finally, the lysed plugs were incubated for 2 days at 55°C in 0.2% proteinase K (Gene Choice)-0.5 M EDTA (pH 8.0) buffer. .. For the undigested DNA plugs, the running parameters were as follows: initial pulse, 1 s; final pulse, 25 s; voltage, 6 V/cm; and time, 24 h. For isolates that showed Southern blot signal colocalization using probes for two different open reading frames (ORFs) (as described below), DNA plugs were digested with the restriction endonucleases ApaI, AvaI, ClaI, KpnI, NcoI, NheI, SphI, and XhoI (New England Biolabs).

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix. .. The resulting construct, pVT138, was transferred to the P. syringae 508 chromosome by triparental mating.

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: Amplicons were treated by one of four methods before use in downstream applications: QIAquick columns, incubation at 65 °C for 10 min followed by centrifugation at 3800 rcf for 20 s, incubation at 65 °C for 10 min, or no post-amplification treatment. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Cell Culture:

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin . .. Infected cells were then selected with 100 µg/ml hygromycin B (Clontech, Palo Alto, CA).

    Expressing:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: These mutations were made using a modified QuickChange Site-Directed Mutagenesis method (Stratagene). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA). .. The PCR products were digested with Dpn I (New England BioLabs) at 37°C for 1 hour and transformed into DH5α competent cells.

    Article Title: Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion
    Article Snippet: The recombinant plasmid pcDNA3.1-B2c was constructed by inserting the genome of CVS-B2c into the mammalian expression vector pcDNA3.1 as described previously ( , ). .. The PCR products were first digested with ClaI and KpnI (New England BioLabs, Beverly, MA) and then ligated into pcDNA3.1-B2c, which had been digested with ClaI and KpnI.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: When appropriate 1mM isopropyl-β-D-thiogalactopyranoside (IPTG, Diagnostic Chemicals, Ltd.) was added to the media to induce expression from the recA 6 locus or the nics6 complementing locus. .. The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The multiple cloning site (MCS) and hammerhead ribozyme were generated synthetically. .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors. .. The pGPD:eGFP: unc-54 :HBE:Stem-loop:Ribozyme integration expression vector was generated from pAG303GPD-EGFP-ccdB by inserting the 3′ end of pADH1:GFP: unc-54 :HBE:Stem-loop:Ribozyme vector (this work) into the Not I (NEB) / Sal I (NEB) fragment.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: PDGFRα/β double null (double KO) (α−/−β−/−), PDGFR beta null (PDGFRα/β double null cells infected with PDGFRα expressing retro-viruses), and PDGFR alpha null (PDGFRα/β double null cells infected with PDGFRβ expressing retro-viruses) MEFs were gifts from Dr. Andrius Kazlauskas (Schepens Eye Research Institute) . .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin .

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: The resulting PCR product (ClaI-CMV-TetO2-EcoRI) was purified using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3). .. To obtain lentiviral particles containing the OAT constructs, lentiviral stock was produced by transfecting the pLenti expression constructs with packaging plasmid mix into the HEK293FT cell line using ViraPower Lentiviral Gateway Expression Systems (Invitrogen), according to the manufacturer’s instructions.

    Article Title: Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+
    Article Snippet: Point mutations of the wild-type hKv1.5 α-subunit in the plasmid expression vector pcDNA3 were made using the Quikchange Kit (Stratagene, La Jolla, CA, USA) to convert the histidine (H) residue at position 463 to glutamine (Q) (H463Q) or glycine (G) (H463G). .. The double mutant H463Q,R487V was created by subcloning a cassette of hKv1.5 H463Q into hKv1.5 R487V ( ) using BstEII and ClaI restriction enzymes (New England BioLabs, Beverly, MA, USA).

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: Paragraph title: Expression of the nisin O cluster in L. lactis ... A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso.

    Modification:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: These mutations were made using a modified QuickChange Site-Directed Mutagenesis method (Stratagene). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA).

    Transformation Assay:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso. .. A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso.

    Recombinase Polymerase Amplification:

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: RPA amplicons were generated using primer pair TYL828F/TYL834R for 20 min at 37 °C. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Derivative Assay:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: To use the ccdA/ccdB selection system, the Kanamycin resistance gene was eliminated through homologous recombination. .. The pSP301 and derived plasmids were digested by ClaI (New England Biolabs). .. The CYS21 strain (DH10B derived with ccdB in the chromosome) (Delphigenetics) was transformed with the linear plasmid, and plated on LB agar.

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Transfection:

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: The sample was washed twice in 70% endotoxin-free ethanol, air dried and resuspended in endotoxin free water. .. Prior to transfection, 50 μg of plasmid were linearized by digesting with 50 units of ClaI (New England Biolabs) restriction enzyme for 1 hour at 37°C. .. The final plasmid concentration was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher).

    Article Title: Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+
    Article Snippet: The double mutant H463Q,R487V was created by subcloning a cassette of hKv1.5 H463Q into hKv1.5 R487V ( ) using BstEII and ClaI restriction enzymes (New England BioLabs, Beverly, MA, USA). .. Stable transfections of HEK293 cells were made using 0.8 μg of hKv1.5 H463Q, hKv1.5 H463Q, R487V or hKv1.5 H463G cDNA and 2 μl of Lipofectamine 2000 (Invitrogen).

    Gas Chromatography:

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The Gc ruvB and ruvC loci were cloned into the pBLUNT vector (Invitrogen) using the primers RUVBFOR (CCATTCCGCCCCCGACATA), RUVBREV (GCTGATGTGGGTCAACCCC), RUVCFOR2 (GGCGAATGTCGAAAACAATAAAT), and RUVCREV2 (CAAATAATGCTTATTGCGGTAG) and mutated using a deletion/insertion strategy. .. The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene.

    Southern Blot:

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene. .. Double mutants were generated by transforming isolated genomic DNA from ruvB and ruvC mutants into recG and ruvA mutants.

    Article Title: Characterization of Toxin Plasmids in Clostridium perfringens Type C Isolates
    Article Snippet: PFGE was performed with 1% agarose gels by using a CHEF-DR II system (Bio-Rad Laboratories) and 0.5× Tris-borate-EDTA buffer at 14°C. .. For the undigested DNA plugs, the running parameters were as follows: initial pulse, 1 s; final pulse, 25 s; voltage, 6 V/cm; and time, 24 h. For isolates that showed Southern blot signal colocalization using probes for two different open reading frames (ORFs) (as described below), DNA plugs were digested with the restriction endonucleases ApaI, AvaI, ClaI, KpnI, NcoI, NheI, SphI, and XhoI (New England Biolabs). .. Briefly, a plug slice (approximately one-sixth of the plug) was incubated overnight, at the proper temperature as instructed by the enzyme manufacturer, in 30 μl of 10× commercial restriction endonuclease buffer, 4 μl of a selected enzyme, and 266 μl of distilled water.

    Ligation:

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: The resulting PCR product (ClaI-CMV-TetO2-EcoRI) was purified using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3). .. To obtain lentiviral particles containing the OAT constructs, lentiviral stock was produced by transfecting the pLenti expression constructs with packaging plasmid mix into the HEK293FT cell line using ViraPower Lentiviral Gateway Expression Systems (Invitrogen), according to the manufacturer’s instructions.

    Genomic Sequencing:

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA). .. Prior to sequencing, DNA quality and quantity were estimated using both a Nanodrop (ND-1000, Thermo Fisher, Waltham, MA, USA) and by visualization after agarose gel electrophoresis.

    Transferring:

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: Two integrative plasmids were constructed from pBAV208. pBAV208 is a cloning vector with an origin of transfer for transferring constructs from Escherichia coli to P. syringae by triparental mating. pBAV208 can be used either for disrupting genes in P. syringae or for adding genes to the chromosome of P. syringae by Campbell integration. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Infection:

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: PDGFRα/β double null (double KO) (α−/−β−/−), PDGFR beta null (PDGFRα/β double null cells infected with PDGFRα expressing retro-viruses), and PDGFR alpha null (PDGFRα/β double null cells infected with PDGFRβ expressing retro-viruses) MEFs were gifts from Dr. Andrius Kazlauskas (Schepens Eye Research Institute) . .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin .

    Generated:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: A double cysteine mutant of mouse TRPA1 (TRPA1-2C) was generated by cysteine-serine substitutions at C422 and C622, residues that are thought to be covalently modified by several agonists ( ). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA).

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene. .. Complementation was performed by amplifying fragments carrying the ruvB and ruvC genes from the Gc chromosome using primers RUVBFOR2 (TGCCGTCTGAAACGCGCCG), RUVBREV2 (CAAACGTCTGATAACAATGCCG), RUVCFOR3 (CTGGGACTGAACCGCAATAC), and RUVCREV3 (ATTTCATCTCGGTACACATTTTC) and expressing the wild type genes from lacIO -regulated complementation locus.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The multiple cloning site (MCS) and hammerhead ribozyme were generated synthetically. .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: Wild-type PDGFRα and PDGFRβ MEFs [PDGFRα+/+ β+/+] were generated as follows. .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin .

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: A maximum likelihood tree was generated in PAUP* 4.0b10 using the model selected in the previous step and 2,000 bootstrap replicates. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: RPA amplicons were generated using primer pair TYL828F/TYL834R for 20 min at 37 °C. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Sequencing:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: The pSP301 and derived plasmids were digested by ClaI (New England Biolabs). .. Only the clones containing a correctly recombined plasmid encoding a functional ccdA gene could grow.

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene. .. Double mutants were generated by transforming isolated genomic DNA from ruvB and ruvC mutants into recG and ruvA mutants.

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The S65T GFP sequence was amplified from pFA6:GFP (kindly provided by Paul Kaufman). .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. The PCR product was digested with NdeI and SapI and then subcloned into pUC19 and introduced into DH5α.

    Article Title: The exopolysaccharide of Rhizobium sp. YAS34 is not necessary for biofilm formation on Arabidopsis thaliana and Brassica napus roots but contributes to root colonization
    Article Snippet: Mutants were screened on RCV-agar plates supplemented with 2 g l−1 glucose to test for EPS production. .. Genomic DNA from the YAS34 mutant was extracted, digested with ClaI (a restriction enzyme that does not cut within the Tn5 sequence) (NEB), ligated with T4 ligase (Roche Diagnostics) and transferred into E. coli DH5α ( ). .. As the transposon carries an origin of replication (p15A), only the plasmids containing Tn5 and flanking regions from the YAS34 chromosome will replicate and maintain itself in E. coli .

    Article Title: Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum
    Article Snippet: Three methylation-sensitive restriction enzymes, MspI (NEB, R0106V, USA), HpaII (NEB, R0171V, USA), and ClaI (NEB, R0197V, USA) were selected for the validation procedure. .. MspI and HpaII are isoschizomers; both enzymes recognize the sequence 5′-CCGG-3′ and exhibit differential methylation sensitivity.

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: Cluster comparisons were visualized using the tblastx comparison files and RAxML tree in R v 3.3.2 using the genoPlotR package . .. A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso. .. The construct was transformed into electrocompetent L. lactis MG1614 using a Gene Pulse Xcell (BioRad, [ ]).

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: The sequence of pBAV208 is available upon request. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: Amplicons generated by RPA using either purified DNA or crude extracts were evaluated and compared for their ability to be used in three downstream applications: TA cloning, restriction endonuclease digestion and direct sequencing. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: Paragraph title: 4.6. DNA Isolation, Restriction and Sequencing ... DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA).

    Binding Assay:

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The multiple cloning site (MCS) and hammerhead ribozyme were generated synthetically. .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors. .. The pGPD:eGFP: unc-54 :HBE:Stem-loop:Ribozyme integration expression vector was generated from pAG303GPD-EGFP-ccdB by inserting the 3′ end of pADH1:GFP: unc-54 :HBE:Stem-loop:Ribozyme vector (this work) into the Not I (NEB) / Sal I (NEB) fragment.

    Pulsed-Field Gel:

    Article Title: Characterization of Toxin Plasmids in Clostridium perfringens Type C Isolates
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis (PFGE). ... For the undigested DNA plugs, the running parameters were as follows: initial pulse, 1 s; final pulse, 25 s; voltage, 6 V/cm; and time, 24 h. For isolates that showed Southern blot signal colocalization using probes for two different open reading frames (ORFs) (as described below), DNA plugs were digested with the restriction endonucleases ApaI, AvaI, ClaI, KpnI, NcoI, NheI, SphI, and XhoI (New England Biolabs).

    DNA Extraction:

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: Paragraph title: 4.6. DNA Isolation, Restriction and Sequencing ... DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA).

    Gene Knockout:

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. Transgenic founders were PCR-genotyped using genomic DNA extracted from the tails and 2 human NEU1 cDNA-specific oligonucleotide primers (sense, 5'-gggcttaagggtgacatctgcgct-3'; antisense, 5'-agcagttgctccatggtcaccagc-3') that generate a 288-bp fragment in transgene-positive mice.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: PDGFRα/β double null (double KO) (α−/−β−/−), PDGFR beta null (PDGFRα/β double null cells infected with PDGFRα expressing retro-viruses), and PDGFR alpha null (PDGFRα/β double null cells infected with PDGFRβ expressing retro-viruses) MEFs were gifts from Dr. Andrius Kazlauskas (Schepens Eye Research Institute) . .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin .

    Methylation:

    Article Title: Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum
    Article Snippet: First, global DNA methylation levels in the four stages of T. castaneum were determined using a methylated DNA quantification kit (Epigentek, P-1034, USA) according to the manufacturer’s protocols, and specific methylated sites were validated through methylation-sensitive restriction enzyme-mediated PCR. .. Three methylation-sensitive restriction enzymes, MspI (NEB, R0106V, USA), HpaII (NEB, R0171V, USA), and ClaI (NEB, R0197V, USA) were selected for the validation procedure. .. MspI and HpaII are isoschizomers; both enzymes recognize the sequence 5′-CCGG-3′ and exhibit differential methylation sensitivity.

    Mutagenesis:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: These mutations were made using a modified QuickChange Site-Directed Mutagenesis method (Stratagene). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA).

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. Transgenic founders were PCR-genotyped using genomic DNA extracted from the tails and 2 human NEU1 cDNA-specific oligonucleotide primers (sense, 5'-gggcttaagggtgacatctgcgct-3'; antisense, 5'-agcagttgctccatggtcaccagc-3') that generate a 288-bp fragment in transgene-positive mice.

    Article Title: The exopolysaccharide of Rhizobium sp. YAS34 is not necessary for biofilm formation on Arabidopsis thaliana and Brassica napus roots but contributes to root colonization
    Article Snippet: Mutants were screened on RCV-agar plates supplemented with 2 g l−1 glucose to test for EPS production. .. Genomic DNA from the YAS34 mutant was extracted, digested with ClaI (a restriction enzyme that does not cut within the Tn5 sequence) (NEB), ligated with T4 ligase (Roche Diagnostics) and transferred into E. coli DH5α ( ). .. As the transposon carries an origin of replication (p15A), only the plasmids containing Tn5 and flanking regions from the YAS34 chromosome will replicate and maintain itself in E. coli .

    Article Title: Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+
    Article Snippet: Point mutations of the wild-type hKv1.5 α-subunit in the plasmid expression vector pcDNA3 were made using the Quikchange Kit (Stratagene, La Jolla, CA, USA) to convert the histidine (H) residue at position 463 to glutamine (Q) (H463Q) or glycine (G) (H463G). .. The double mutant H463Q,R487V was created by subcloning a cassette of hKv1.5 H463Q into hKv1.5 R487V ( ) using BstEII and ClaI restriction enzymes (New England BioLabs, Beverly, MA, USA). .. Stable transfections of HEK293 cells were made using 0.8 μg of hKv1.5 H463Q, hKv1.5 H463Q, R487V or hKv1.5 H463G cDNA and 2 μl of Lipofectamine 2000 (Invitrogen).

    Isolation:

    Article Title: Inter-telomeric recombination is present in telomerase-positive human cells
    Article Snippet: A telomeric recombination reporter system is a valuable tool not only with regard to elucidating the mechanism of ALT but also to assess the efficacy of potential drugs that target the ALT pathway. .. For the subtelomeric reporter construct (subtel-tag) the SV40-puromycin resistance gene was isolated from the pBabe-Puro retroviral vector by HindIII and ClaI restriction enzyme digestion (New England Biolabs). .. The isolated fragment was ligated into the polylinker region of the pSV-Zeo plasmid (Invitrogen).

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: Molecular biology techniques were performed as previously described ( ). recG and ruvA mutants were isolated as previously described ( ). .. The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: The plasmids from the transformants were isolated and the AP lesion region was sequenced to determine the nucleotides inserted opposite AP. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Subcloning:

    Article Title: Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+
    Article Snippet: Point mutations of the wild-type hKv1.5 α-subunit in the plasmid expression vector pcDNA3 were made using the Quikchange Kit (Stratagene, La Jolla, CA, USA) to convert the histidine (H) residue at position 463 to glutamine (Q) (H463Q) or glycine (G) (H463G). .. The double mutant H463Q,R487V was created by subcloning a cassette of hKv1.5 H463Q into hKv1.5 R487V ( ) using BstEII and ClaI restriction enzymes (New England BioLabs, Beverly, MA, USA). .. Stable transfections of HEK293 cells were made using 0.8 μg of hKv1.5 H463Q, hKv1.5 H463Q, R487V or hKv1.5 H463G cDNA and 2 μl of Lipofectamine 2000 (Invitrogen).

    Flow Cytometry:

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: The sample was loaded by gravity flow, and resin was washed with 10 column-volumes of wash buffer (1.0mM NaCl, 50mM MOPS, 15% Isopropanol, pH 7.0). .. Prior to transfection, 50 μg of plasmid were linearized by digesting with 50 units of ClaI (New England Biolabs) restriction enzyme for 1 hour at 37°C.

    Mouse Assay:

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: Paragraph title: 2.4 Generation of Neu1 −/− ;NEU1 V54M mice ... A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs).

    Polymerase Chain Reaction:

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: These mutations were made using a modified QuickChange Site-Directed Mutagenesis method (Stratagene). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA). .. The PCR products were digested with Dpn I (New England BioLabs) at 37°C for 1 hour and transformed into DH5α competent cells.

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: The PCR product was cloned into pGEM-T (Promega, Madison, WI). .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes.

    Article Title: Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion
    Article Snippet: Key amino acids (K1685, D1797, K1829, and E1867) were mutated to alanine or other amino acids by overlapping PCR. .. The PCR products were first digested with ClaI and KpnI (New England BioLabs, Beverly, MA) and then ligated into pcDNA3.1-B2c, which had been digested with ClaI and KpnI. .. All the recombinant RABVs (rRABVs) were rescued as described previously ( ) and were then propagated in BSR cells or in newborn mice.

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. The DNA fragment was injected into the pronuclei of fertilized eggs isolated from FVB/NJ pregnant mice [ ].

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The pADH1::GFP: unc-54 :MCS:Ribozyme plasmid expression vector was generated using sequential PCR stitching and gap repair of DNA constructs into the pDest22 backbone (Thermo Fisher Scientific). .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: Human PDGFRβ cDNA was amplified from hPDGFRβ in pEF6 (Invitrogen, Carlsbad, CA) with primers (all primer sequences available upon request) using proof-reading Pfu polymerase (Stratagene, La Jolla, CA). .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin . .. The plasmids were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) into the retroviral packaging cell line PT67 (Clontech, Palo Alto, CA).

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: The resulting PCR product (ClaI-CMV-TetO2-EcoRI) was purified using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3). .. To obtain lentiviral particles containing the OAT constructs, lentiviral stock was produced by transfecting the pLenti expression constructs with packaging plasmid mix into the HEK293FT cell line using ViraPower Lentiviral Gateway Expression Systems (Invitrogen), according to the manufacturer’s instructions.

    Article Title: Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum
    Article Snippet: First, global DNA methylation levels in the four stages of T. castaneum were determined using a methylated DNA quantification kit (Epigentek, P-1034, USA) according to the manufacturer’s protocols, and specific methylated sites were validated through methylation-sensitive restriction enzyme-mediated PCR. .. Three methylation-sensitive restriction enzymes, MspI (NEB, R0106V, USA), HpaII (NEB, R0171V, USA), and ClaI (NEB, R0197V, USA) were selected for the validation procedure.

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso. .. Plasmid DNA was extracted using the QIAprep miniprep kit (Qiagen) with an additional 15 min at 37 ˚C with 5 mg ml−1 lysozyme and 30 U mutanolysin (Sigma) at the lysis stage, and the insert was confirmed by sequencing with the primers pIL253F and pIL253R.

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: The sequence of pBAV208 is available upon request. .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix. .. The resulting construct, pVT138, was transferred to the P. syringae 508 chromosome by triparental mating.

    Selection:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: To use the ccdA/ccdB selection system, the Kanamycin resistance gene was eliminated through homologous recombination. .. The pSP301 and derived plasmids were digested by ClaI (New England Biolabs).

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix. .. The resulting construct, pVT138, was transferred to the P. syringae 508 chromosome by triparental mating.

    Agarose Gel Electrophoresis:

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Half of the DNA was analyzed by TAE agarose gel electrophoresis and the remaining DNA was introduced into Maxi Efficiency DH5α (Invitrogen, CA, USA) by transformation. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI.

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA). .. The digested DNA was analyzed by agarose gel electrophoresis.

    Purification:

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes. .. All NS5A deletion mutations derived from the pKS(+)Sal-NS5A-Cla plasmids were ligated into pDI-388, pBici-388, pT7-DI-388, and pCP7-388 plasmids via SalI and ClaI restriction sites to obtain either the final monocistronic or bicistronic replicon plasmids or the pCP7-388 full-length cDNA constructs.

    Article Title: Biochemical reconstitution of abasic DNA lesion replication in Xenopus extracts
    Article Snippet: Data from two independent experiments were used to calculate the average ratio (and absolute deviation) of each nucleotide inserted opposite the AP lesion after replication. .. For the determination of nucleotides on replicated DNA that still carried the AP lesion, the DNA (after 75 min of incubation in NPE) was digested with DpnI, ClaI and APE (NEB, MA, USA), purified by Qiagen column, and re-digested with KpnI. .. This DNA was then used as template for PCR with two primers (5′ AGCGAGG AAGCGGAAGAGC 3′ and 5′ TGGTTGCCGCCACT TCACC 3′) that bracket the ClaI and KpnI sites.

    Article Title: Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics
    Article Snippet: Amplicons generated by RPA using either purified DNA or crude extracts were evaluated and compared for their ability to be used in three downstream applications: TA cloning, restriction endonuclease digestion and direct sequencing. .. Restriction endonuclease digestion consisted of digestion of amplicons with Cla I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and results were visualized in 1.5 % agarose gels.

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: CsCl purified phage particles were treated with DNase and RNase, followed by treatment with 10% SDS and proteinase K followed by DNA extraction with phenol: chloroform: isoamyl alcohol (25:24:1 v /v ) and chloroform: isoamyl alcohol (24:1 v /v ). .. DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA).

    Plasmid Preparation:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: The pSP301 and derived plasmids were digested by ClaI (New England Biolabs). .. The CYS21 strain (DH10B derived with ccdB in the chromosome) (Delphigenetics) was transformed with the linear plasmid, and plated on LB agar.

    Article Title: Intracellular alkalization causes pain sensation through activation of TRPA1 in mice
    Article Snippet: These mutations were made using a modified QuickChange Site-Directed Mutagenesis method (Stratagene). .. Briefly, PCR was performed using 2 residues of mouse TRPA1 expression vector divided at the Cla I (New England BioLabs) site as templates (the former for C422S, the latter for C622S), 2 synthetic oligonucleotide primers containing specific mutations (C422S-S and AS, 5′-CATTATGCCTCTAGGCAGGGG-3′ and 5′-CCCCTGCCTAGAGGCATAATG-3′; C622S-S and AS, 5′-CCCGAGTCCATGAAAGTTCTT-3′ and 5′-AAGAACTTTCATGGACTCGGG-3′), and primeSTAR HS DNA polymerase (TAKARA). .. The PCR products were digested with Dpn I (New England BioLabs) at 37°C for 1 hour and transformed into DH5α competent cells.

    Article Title: Inter-telomeric recombination is present in telomerase-positive human cells
    Article Snippet: A telomeric recombination reporter system is a valuable tool not only with regard to elucidating the mechanism of ALT but also to assess the efficacy of potential drugs that target the ALT pathway. .. For the subtelomeric reporter construct (subtel-tag) the SV40-puromycin resistance gene was isolated from the pBabe-Puro retroviral vector by HindIII and ClaI restriction enzyme digestion (New England Biolabs). .. The isolated fragment was ligated into the polylinker region of the pSV-Zeo plasmid (Invitrogen).

    Article Title: Functional Characterization of Bovine Viral Diarrhea Virus Nonstructural Protein 5A by Reverse Genetic Analysis and Live Cell Imaging
    Article Snippet: All NS5A deletions were generated via QuikChange mutagenesis with the subclone vector pKS(+)Sal-NS5A-Cla as the template, which contained the SalI-ClaI fragment derived from the pCP7-388 plasmid encompassing the NS5A coding sequence and surrounding regions. .. To construct this plasmid, pCP7-388 was digested with SalI and ClaI (NEB, Frankfurt/Main, Germany), and the NS5A-encoding fragment was gel purified and ligated into pBluescript II KS(+) (Agilent Technologies, Waldbronn, Germany) cleaved with the same enzymes. .. All NS5A deletion mutations derived from the pKS(+)Sal-NS5A-Cla plasmids were ligated into pDI-388, pBici-388, pT7-DI-388, and pCP7-388 plasmids via SalI and ClaI restriction sites to obtain either the final monocistronic or bicistronic replicon plasmids or the pCP7-388 full-length cDNA constructs.

    Article Title: Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion
    Article Snippet: The recombinant plasmid pcDNA3.1-B2c was constructed by inserting the genome of CVS-B2c into the mammalian expression vector pcDNA3.1 as described previously ( , ). .. The PCR products were first digested with ClaI and KpnI (New England BioLabs, Beverly, MA) and then ligated into pcDNA3.1-B2c, which had been digested with ClaI and KpnI.

    Article Title: Loss of both Holliday Junction processing pathways is synthetically lethal in the presence of gonococcal pilin antigenic variation
    Article Snippet: The Gc ruvB and ruvC loci were cloned into the pBLUNT vector (Invitrogen) using the primers RUVBFOR (CCATTCCGCCCCCGACATA), RUVBREV (GCTGATGTGGGTCAACCCC), RUVCFOR2 (GGCGAATGTCGAAAACAATAAAT), and RUVCREV2 (CAAATAATGCTTATTGCGGTAG) and mutated using a deletion/insertion strategy. .. The ruvC gene was mutated in a similar fashion, however the 270 bp ClaI and NdeI (NEB) fragment was deleted and replaced with the ermC gene.

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: Subsequently, the ubiquitin promoter fragment was cloned upstream of the NEU1 cDNA into the BamHI-linearized and Klenow-blunted pSCTOP-NEU1V54M plasmid DNA vector [ ]. .. A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. The DNA fragment was injected into the pronuclei of fertilized eggs isolated from FVB/NJ pregnant mice [ ].

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: The sample was washed twice in 70% endotoxin-free ethanol, air dried and resuspended in endotoxin free water. .. Prior to transfection, 50 μg of plasmid were linearized by digesting with 50 units of ClaI (New England Biolabs) restriction enzyme for 1 hour at 37°C. .. The final plasmid concentration was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher).

    Article Title: PRIMA: a gene-centered, RNA-to-protein method for mapping RNA-protein interactions
    Article Snippet: The multiple cloning site (MCS) and hammerhead ribozyme were generated synthetically. .. Binding sites were inserted into the MCS of the expression vector using yeast gap repair of synthetic oligos into Afl II (NEB) / Sma I (NEB) or Afl II (NEB) / Cla I (NEB) digested vectors. .. The pGPD:eGFP: unc-54 :HBE:Stem-loop:Ribozyme integration expression vector was generated from pAG303GPD-EGFP-ccdB by inserting the 3′ end of pADH1:GFP: unc-54 :HBE:Stem-loop:Ribozyme vector (this work) into the Not I (NEB) / Sal I (NEB) fragment.

    Article Title: Comprehensive Dissection of PDGF-PDGFR Signaling Pathways in PDGFR Genetically Defined Cells
    Article Snippet: Human PDGFRβ cDNA was amplified from hPDGFRβ in pEF6 (Invitrogen, Carlsbad, CA) with primers (all primer sequences available upon request) using proof-reading Pfu polymerase (Stratagene, La Jolla, CA). .. The PCR products were digested with Not I and Cla I (NEB Biolab, Ipswich, MA) and inserted into a retroviral vector pIRES-hygromycin . .. The plasmids were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) into the retroviral packaging cell line PT67 (Clontech, Palo Alto, CA).

    Article Title: The exopolysaccharide of Rhizobium sp. YAS34 is not necessary for biofilm formation on Arabidopsis thaliana and Brassica napus roots but contributes to root colonization
    Article Snippet: Mutagenesis in Rhizobium sp. YAS34 wt was carried out by random insertion of a Tn5 transposon from a non-replicative plasmid pRL1063a ( ). pRL1063a was transferred into YAS34 wt by triparental mating as described before and mutants by transposition were selected on TSB-agar plates containing kanamycin at 50 μg ml−1 . .. Genomic DNA from the YAS34 mutant was extracted, digested with ClaI (a restriction enzyme that does not cut within the Tn5 sequence) (NEB), ligated with T4 ligase (Roche Diagnostics) and transferred into E. coli DH5α ( ).

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: Paragraph title: Vector Construction ... Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3).

    Article Title: Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+
    Article Snippet: Point mutations of the wild-type hKv1.5 α-subunit in the plasmid expression vector pcDNA3 were made using the Quikchange Kit (Stratagene, La Jolla, CA, USA) to convert the histidine (H) residue at position 463 to glutamine (Q) (H463Q) or glycine (G) (H463G). .. The double mutant H463Q,R487V was created by subcloning a cassette of hKv1.5 H463Q into hKv1.5 R487V ( ) using BstEII and ClaI restriction enzymes (New England BioLabs, Beverly, MA, USA).

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: It was cloned by combining the origin of transfer from a pBSL vector , the multiple-cloning site and the origin of replication from pBC SK+ (Stratagene, California), and the nptII gene for kanamycin resistance from pZERO2.1 (Invitrogen, California). .. A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix.

    Introduce:

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: The inducible CMV-TetO2 promoter was replicated from pcDNA5-FRT-TO (Invitrogen) using primers that introduce ClaI (forward Cla1-CMV-TetO2: GCCGCCATCGATGCCGCCGTTGACATTGATTATTGACT) and EcoRI restriction sites (reverse EcoRI-CMV-TetO2: GGCGGCGAATTCGGCGGCCGGAGGCTGGATCGGTCCCGG). .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3).

    Functional Assay:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: Paragraph title: Homologous recombination process to obtain a functional ccdA ... The pSP301 and derived plasmids were digested by ClaI (New England Biolabs).

    Recombinant:

    Article Title: Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion
    Article Snippet: The recombinant plasmid pcDNA3.1-B2c was constructed by inserting the genome of CVS-B2c into the mammalian expression vector pcDNA3.1 as described previously ( , ). .. The PCR products were first digested with ClaI and KpnI (New England BioLabs, Beverly, MA) and then ligated into pcDNA3.1-B2c, which had been digested with ClaI and KpnI.

    Article Title: A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity
    Article Snippet: Commercially obtained vectors containing OAT1 (pENTR201-hOAT1, Harvard Plasmids HsCD00044153) and OAT3 (pENTR201-hOAT3, HsCD00044090) were transferred into a pLenti4/V5-DEST vector by LR recombinant reaction, resulting in expression vectors pLenti4/V5-EX-hOAT1 and pLenti4/V5-EX-hOAT3. .. Both PCR product and expression vectors were digested by ClaI and EcoRI (New England Biolabs, Ipswich, USA) for 1 h at 37°C and, after purification, ligation was performed with a 1:3 (insert:vector) unit ratio using T4 ligase (Invitrogen) for 2 h at 37°C, resulting in the pLenti expression constructs (pLenti4/V5-EX-CMV-TetO2-hOAT1 and pLenti4/V5-EX-CMV-TetO2-hOAT3).

    Sample Prep:

    Article Title: Novel N4-Like Bacteriophages of Pectobacterium atrosepticum
    Article Snippet: DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA). .. DNA samples were digested with BamHI and ClaI, according to manufacturer’s protocols (New England BioLabs, Ipswich, MA, USA).

    Transgenic Assay:

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. The DNA fragment was injected into the pronuclei of fertilized eggs isolated from FVB/NJ pregnant mice [ ].

    Knock-Out:

    Article Title: Chaperone–Mediated Gene Therapy with Recombinant AAV-PPCA in a New Mouse Model of Type I Sialidosis
    Article Snippet: A 4.2-kb linear NEU1V54M transgene-containing DNA fragment was released by digesting the plasmid DNA with ClaI and SfiI (New England BioLabs). .. Transgenic founders were PCR-genotyped using genomic DNA extracted from the tails and 2 human NEU1 cDNA-specific oligonucleotide primers (sense, 5'-gggcttaagggtgacatctgcgct-3'; antisense, 5'-agcagttgctccatggtcaccagc-3') that generate a 288-bp fragment in transgene-positive mice.

    DNA Methylation Assay:

    Article Title: Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum
    Article Snippet: Paragraph title: 2.10. Validation of DNA methylation ... Three methylation-sensitive restriction enzymes, MspI (NEB, R0106V, USA), HpaII (NEB, R0171V, USA), and ClaI (NEB, R0197V, USA) were selected for the validation procedure.

    DNA Purification:

    Article Title: Naturally Occurring Nonpathogenic Isolates of the Plant Pathogen Pseudomonas syringae Lack a Type III Secretion System and Effector Gene Orthologues
    Article Snippet: A fragment corresponding to the P. syringae 508 orthologue of Psy_1182 was amplified from P. syringae 508 genomic DNA by PCR using Pfu Turbo (Stratagene, California) and primers Psy_1182-F and Psy_1182-R (see Table S1 in the supplemental material), digested with the restriction enzymes ApaI and ClaI (New England Biolabs, Massachusetts), and ligated to pBAV208 digested with the same enzymes using TaKaRa Bio USA (Wisconsin) Mighty Mix. .. The plate was incubated for 48 h, after which single colonies became visible. avrRpt2 was added to pVT138 to construct pVT359 using the same procedure that was used to add the P. syringae 508 Psyr_1182 orthologue fragment to pBAV208; the only difference was that the EcoRI and SpeI enzymes and primers avrRpt2-F and avrRpt2-R (see Table S1 in the supplemental material) were used for PCR with P. syringae pv. tomato JL1065 DNA as the template.

    Lysis:

    Article Title: Characterization of Toxin Plasmids in Clostridium perfringens Type C Isolates
    Article Snippet: The agarose-embedded cells were lysed by incubation, with gentle shaking of the plugs overnight at 37°C in lysis buffer (0.5 M EDTA [pH 8.0], 0.5% [vol/vol] Sarkosyl, 0.5% lysozyme [Sigma], 0.4% deoxycholic acid). .. For the undigested DNA plugs, the running parameters were as follows: initial pulse, 1 s; final pulse, 25 s; voltage, 6 V/cm; and time, 24 h. For isolates that showed Southern blot signal colocalization using probes for two different open reading frames (ORFs) (as described below), DNA plugs were digested with the restriction endonucleases ApaI, AvaI, ClaI, KpnI, NcoI, NheI, SphI, and XhoI (New England Biolabs).

    Article Title: Discovery of a novel lantibiotic nisin O from Blautia obeum A2-162, isolated from the human gastrointestinal tract
    Article Snippet: A 17 438 bp sequence containing the novel lantibiotic cluster was restricted from the identified pJAZZ-OC clone with ClaI and PstI (NEB) and then ligated into vector pIL253 [MspI, PstI restricted and dephosphorylated (Antarctic Phosphatase, NEB)] using Fastlink DNA ligase (Epicentre) to create p nso. .. The construct was transformed into electrocompetent L. lactis MG1614 using a Gene Pulse Xcell (BioRad, [ ]).

    Homologous Recombination:

    Article Title: Antibiotic-free selection in E. coli: new considerations for optimal design and improved production
    Article Snippet: Paragraph title: Homologous recombination process to obtain a functional ccdA ... The pSP301 and derived plasmids were digested by ClaI (New England Biolabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs clai
    Clai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clai/product/New England Biolabs
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    clai - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results