stui  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    StuI
    Description:
    StuI 5 000 units
    Catalog Number:
    R0187L
    Price:
    256
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs stui
    StuI
    StuI 5 000 units
    https://www.bioz.com/result/stui/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    stui - by Bioz Stars, 2019-07
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Relative quantification of gene expression was determined using the 2−ΔCt method , with elongation factor 1α (ef1α ) as a reference gene. .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. Escherichia coli XL10 Gold Ultracompetent Cells (Agilent Technologies) were transformed with amplification products and the success of mutagenesis confirmed by DNA sequencing.

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: Paragraph title: Cloning and sequencing of the R. monacensis plasmid. ... To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C.

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: The self-complementary oligonucleotide, 5′-AGCT GCTGAGG GCTGAGG GCTGAGG GCTGAGG AGGCCT CCTCAGC CCTCAGC CCTCAGC CCTCAGC-3′, was annealed to form a duplex that was cloned into the HindIII site of pUC19. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Cloning and sequencing: Positive PCR reactions as needed were extended using Crimson Taq DNA polymerase (New England Biolabs, Inc.), cloned into pCR®4.0-TOPO® vector and transformed into One Shot® chemically competent cells (Invitrogen). .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: Paragraph title: Cloning of Tagged Mutant Allele ... Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer.

    Amplification:

    Article Title: A concept of eliminating nonhomologous recombination for scalable and safe AAV vector generation for human gene therapy
    Article Snippet: The plasmid pRB21was digested with SmaI and StuI (NEB, Ipswich, MA), and then dephosphorylated by calf intestinal alkaline phosphatase (NEB, Ipswich, MA). .. This digested plasmid was used as the backbone to construct all plasmids having individual AAV2 rep and cap genes.

    Article Title: Assessment of canine BEST1 variations identifies new mutations and establishes an independent bestrophinopathy model (cmr3)
    Article Snippet: Coding changes identified in the BMD were screened in all individuals of the breed by either direct sequencing, as described above (BEST1 sequence comparison), or restriction enzyme tests. .. Thus, cBEST1 exon 10 was amplified and subsequently digested at 37 °C overnight with StuI, BstNI, and BbsI (New England Biolabs, Ipswich, MA) to assess the Lys438Arg, Trp440Cys, and Val473Gly substitutions, respectively. .. Resulting DNA patterns were evaluated on 1% agarose gels reflecting the a) Lys438Arg WT allele (A) by 304- and 521-bp bands versus the 825-bp mutant allele (G); b) Trp440Cys WT allele (G) by 36- and 185-bp bands compared to a 121-bp allele for the mutant allele (T) in addition to 38-, 54-, 84-, 186-, and 242-bp bands present with both genotypes; c) Val473Gly WT allele (T) by 100- and 426-bp bands in contrast to a 526-bp band indicating the mutant allele (G) next to 107- and 192-bp products being present with both genotypes.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Relative quantification of gene expression was determined using the 2−ΔCt method , with elongation factor 1α (ef1α ) as a reference gene. .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. Escherichia coli XL10 Gold Ultracompetent Cells (Agilent Technologies) were transformed with amplification products and the success of mutagenesis confirmed by DNA sequencing.

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The DNA sequence of the wild-type, and 10-residue shortened HTLV-1 protease was amplified from the clone coding for HTLV-1 125 PR and HTLV-1 115 PR, respectively, by PCR using the following primer set: forward, 5'-CCT CCA GTT ATA CCG TTA GAT CCC GCC-3'; reverse, 5'-CGC GGA TCC TCA CAA GAT TAC AGG -3'. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: The GenomeWalker protocol (Clontech, Palo Alto, CA) was used to recover sequences flanking the T-DNA left border. .. Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer. .. A left border–specific primer (JM35) GCCTTTTCAGAA-ATGGATAAATAGCCTTGCTTCC was used in combination with the modified AP1 primer.

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: The reactions were terminated by heating to 95°C for 5 min following immediate cooling on ice. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. Note that the CC C motif is located in the middle of the substrate, yielding similar fragments following cleavage with the restriction enzyme.

    Article Title: TGF-?1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements
    Article Snippet: We obtained a human genomic DNA-BAC clone from BACPAC Resources (Children’s Hospital of the Oakland Research Institute, Oakland, CA) with an insert containing the human FAK promoter, exon 1 and intron 1 sequences as indicated in the GenBank data base. .. The BAC plasmid was cut with Sac I and Stu I (New England Biolabs, Ipswich, MA) releasing a fragment 1.65 kb in size that was subcloned into the pBluescript® II SK (+) vector (Strategene, La Jolla, CA) for amplification. .. The pBSK-FAK-promoter clone was subsequently cut with Nar I, end-filled, and then cut with Kpn I (New England Biolabs) to produce a 1.3 kb fragment that was subcloned into a pGL2 Basic vector (Promega, Madison, WI) to generate the FAK-promoter-luciferase construct used in the Dual Luciferase® Reporter Assay System (Promega).

    Positive Control:

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C.

    Synthesized:

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: Following the protocol described in section 2.3.1, dsDNA was synthesized in vitro with oligonucleotides encoding five NNK (where N is an equimolar mixture of A, G, C, and T, and K is an equimolar mixture of G and T) codons in the BC and FG loop regions of the FN3 coding sequence. .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Construct:

    Article Title: A concept of eliminating nonhomologous recombination for scalable and safe AAV vector generation for human gene therapy
    Article Snippet: Paragraph title: Plasmid constructs ... The plasmid pRB21was digested with SmaI and StuI (NEB, Ipswich, MA), and then dephosphorylated by calf intestinal alkaline phosphatase (NEB, Ipswich, MA).

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega).

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: Chimera viruses were constructed by exchanging DNA fragments between pSMV-G7 and pSMV-G7d, taking advantage of single restriction sites common to the two viruses (Fig. ). .. To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above.

    Article Title: TGF-?1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements
    Article Snippet: Paragraph title: Wt.FAK (FAK-A) promoter construct ... The BAC plasmid was cut with Sac I and Stu I (New England Biolabs, Ipswich, MA) releasing a fragment 1.65 kb in size that was subcloned into the pBluescript® II SK (+) vector (Strategene, La Jolla, CA) for amplification.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Incubation:

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: The substrate with 26-nt 3′ overhangs was generated as follows. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C. .. Subsequently, the reaction mixture was diluted six times with water and incubated at 85 °C for 15 min. DNA purification was performed as described above.

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: After overnight incubation at 30°C, colonies were scraped together and DNA was extracted with the Wizard Plus SV Mini-Prep kit (Promega; Madison, WI). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: The reaction mixture was incubated for 1 min at 94°C; subjected to 30 cycles of 0.5 min at 94°C, 0.5 min at 55°C, and 0.5 min at 72°C; and finally incubated for 10 min at 72°C on an ABI 2720 thermocycler (Applied Biosystems, Inc., Carlsbad, CA). .. Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl.

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: The reactions were terminated by heating to 95°C for 5 min following immediate cooling on ice. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. Note that the CC C motif is located in the middle of the substrate, yielding similar fragments following cleavage with the restriction enzyme.

    Expressing:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Relative quantification of gene expression was determined using the 2−ΔCt method , with elongation factor 1α (ef1α ) as a reference gene. .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. Escherichia coli XL10 Gold Ultracompetent Cells (Agilent Technologies) were transformed with amplification products and the success of mutagenesis confirmed by DNA sequencing.

    Article Title: Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically
    Article Snippet: Paragraph title: Genotyping of NOD Mice for gld Expression ... The 320-bp PCR products were then digested with Stu I (New England BioLabs, Beverly, MA) at 37°C overnight and resolved on a 1.2% Nusieve agarose gel (FMC BioProducts, Rockland, ME).

    Modification:

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Degenerate and non-generate primers were used to obtain the following partial coding sequence (cds) of Pasteuria spp. genes: 16s rDNA gene, LMS_F39-GCGGCGTGCCTAMTACA (modified from ), and LMS_R1239-CGACTTCGCYTCCCTCTGTAACGG (this study); and spoIIAA_AB , LMS_F-AGGTTGTTGATGTGGTGTT and LMS_R-TTTCCCTGCTGGCTTTCT. .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: The GenomeWalker protocol (Clontech, Palo Alto, CA) was used to recover sequences flanking the T-DNA left border. .. Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer. .. A left border–specific primer (JM35) GCCTTTTCAGAA-ATGGATAAATAGCCTTGCTTCC was used in combination with the modified AP1 primer.

    Transformation Assay:

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Purified DNA was transformed by electroporation into competent DH5α E. coli (Life Technologies). .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Transformed cells were plated on Luria broth agar amended with Kanamycin (50 μg/ml) (LB/KN) agar plates. .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: The pSMV-G7 and pSMV-G7d plasmids propagated in ElectroMax DH5α-E cells were found to be insensitive to digestion with StuI located at position 5793 of the genome (Fig. ). .. To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. To exchange DNA fragments representing nucleotides 1 to 2337 of each genome, the KpnI site (Fig. ) and a NotI site located 699 nucleotides upstream of the viral genome were used.

    Countercurrent Chromatography:

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The DNA sequence of the wild-type, and 10-residue shortened HTLV-1 protease was amplified from the clone coding for HTLV-1 125 PR and HTLV-1 115 PR, respectively, by PCR using the following primer set: forward, 5'-CCT CCA GTT ATA CCG TTA GAT CCC GCC-3'; reverse, 5'-CGC GGA TCC TCA CAA GAT TAC AGG -3'. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Electroporation:

    Article Title: Formation of carcinogenic chromosomal rearrangements in human thyroid cells after induction of double-strand DNA breaks by restriction endonucleases
    Article Snippet: Paragraph title: Electroporation of restriction enzymes and detection of RET/PTC rearrangements ... PvuII, StuI, EcoRV, ScaI, and NruI RE (New England Bio Labs, Ipswick, MA, USA) were electroporated into human thyroid primary cells or HTori-3 cells by a previously described method ( ).

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Purified DNA was transformed by electroporation into competent DH5α E. coli (Life Technologies). .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above.

    Transfection:

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Relative quantification of gene expression was determined using the 2−ΔCt method , with elongation factor 1α (ef1α ) as a reference gene. .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. Escherichia coli XL10 Gold Ultracompetent Cells (Agilent Technologies) were transformed with amplification products and the success of mutagenesis confirmed by DNA sequencing.

    Gas Chromatography:

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: The GenomeWalker protocol (Clontech, Palo Alto, CA) was used to recover sequences flanking the T-DNA left border. .. Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer. .. A left border–specific primer (JM35) GCCTTTTCAGAA-ATGGATAAATAGCCTTGCTTCC was used in combination with the modified AP1 primer.

    Southern Blot:

    Article Title: Promyelocytic leukemia protein in retinoic acid-induced chromatin remodeling of Oct4 gene promoter
    Article Snippet: The purified DNA was subjected to Southern blot analysis. .. Isolated nuclei from P19 cells were digested with 100 U of XbaI, StuI, HhaI, NcoI and AvrII (New England Biolabs) for 30 min.

    Ligation:

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Because sequencing through a long adenosine tract at the 3′ end of the L1 insertions is not effective, the 3′ flanking genomic region was sequenced by ligation mediated PCR based on [ , ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Cell Culture:

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C. .. To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C.

    Generated:

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: The substrate with 26-nt 3′ overhangs was generated as follows. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    DNA Sequencing:

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Sequencing:

    Article Title: Assessment of canine BEST1 variations identifies new mutations and establishes an independent bestrophinopathy model (cmr3)
    Article Snippet: Coding changes identified in the BMD were screened in all individuals of the breed by either direct sequencing, as described above (BEST1 sequence comparison), or restriction enzyme tests. .. Thus, cBEST1 exon 10 was amplified and subsequently digested at 37 °C overnight with StuI, BstNI, and BbsI (New England Biolabs, Ipswich, MA) to assess the Lys438Arg, Trp440Cys, and Val473Gly substitutions, respectively.

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. In brief, the above pCS2+ constructs containing the open reading frame of SLC39A14 transcript 1 and 2 were amplified by PCR.

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: Paragraph title: Cloning and sequencing of the R. monacensis plasmid. ... To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C.

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: This destroyed the HindIII site and inserted a single recognition sequence for StuI (AGGCCT) flanked on each side by four recognition sequences for the nickase Nt.BbvCI (CC*TCAGC; the cleavage position is indicated by the asterisk) that are oriented as an inverted repeat with respect to the StuI site. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: Following the protocol described in section 2.3.1, dsDNA was synthesized in vitro with oligonucleotides encoding five NNK (where N is an equimolar mixture of A, G, C, and T, and K is an equimolar mixture of G and T) codons in the BC and FG loop regions of the FN3 coding sequence. .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The DNA sequence of the wild-type, and 10-residue shortened HTLV-1 protease was amplified from the clone coding for HTLV-1 125 PR and HTLV-1 115 PR, respectively, by PCR using the following primer set: forward, 5'-CCT CCA GTT ATA CCG TTA GAT CCC GCC-3'; reverse, 5'-CGC GGA TCC TCA CAA GAT TAC AGG -3'. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs). .. Clones displaying the expected digestion pattern were subjected to fluorescent sequencing (Applied Biosystems, Foster City, CA) using HIV-1-specific primers.

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Because sequencing through a long adenosine tract at the 3′ end of the L1 insertions is not effective, the 3′ flanking genomic region was sequenced by ligation mediated PCR based on [ , ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Cloning and sequencing: Positive PCR reactions as needed were extended using Crimson Taq DNA polymerase (New England Biolabs, Inc.), cloned into pCR®4.0-TOPO® vector and transformed into One Shot® chemically competent cells (Invitrogen). .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. Positive transformants were identified by a PCR-based screening method with SMV-specific primers for the exchanged genomic fragments.

    Article Title: TGF-?1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements
    Article Snippet: The BAC plasmid was cut with Sac I and Stu I (New England Biolabs, Ipswich, MA) releasing a fragment 1.65 kb in size that was subcloned into the pBluescript® II SK (+) vector (Strategene, La Jolla, CA) for amplification. .. The pBSK-FAK-promoter clone was subsequently cut with Nar I, end-filled, and then cut with Kpn I (New England Biolabs) to produce a 1.3 kb fragment that was subcloned into a pGL2 Basic vector (Promega, Madison, WI) to generate the FAK-promoter-luciferase construct used in the Dual Luciferase® Reporter Assay System (Promega).

    Sonication:

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Because sequencing through a long adenosine tract at the 3′ end of the L1 insertions is not effective, the 3′ flanking genomic region was sequenced by ligation mediated PCR based on [ , ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min). .. Sheared plasmid DNA was primer extended using an oligo specific to the 3′ end of the synL1_neo rescue plasmid (3′_rescue_1: 5′ ATATATGAGTAACCTGAGGC 3′ or 3′_rescue_1_secondpA: 5′ GTGGGCATTCTGTCTTGTTC 3′).

    Recombinant:

    Article Title: A concept of eliminating nonhomologous recombination for scalable and safe AAV vector generation for human gene therapy
    Article Snippet: The plasmid pRB21was digested with SmaI and StuI (NEB, Ipswich, MA), and then dephosphorylated by calf intestinal alkaline phosphatase (NEB, Ipswich, MA). .. AAV rep78 and rep52 , and AAV2 vp1 , vp2 , vp3 genes were polymerase chain reaction (PCR) amplified by using plasmid pH22 as the template.

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: Paragraph title: 2.3.3 Construction of phage libraries that were 99-100% recombinant ... The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. Positive transformants were identified by a PCR-based screening method with SMV-specific primers for the exchanged genomic fragments.

    Cellular Antioxidant Activity Assay:

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The DNA sequence of the wild-type, and 10-residue shortened HTLV-1 protease was amplified from the clone coding for HTLV-1 125 PR and HTLV-1 115 PR, respectively, by PCR using the following primer set: forward, 5'-CCT CCA GTT ATA CCG TTA GAT CCC GCC-3'; reverse, 5'-CGC GGA TCC TCA CAA GAT TAC AGG -3'. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Molecular Weight:

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Restriction fragments were subsequently purified using a High Pure PCR Purification kit (Roche Diagnostics, Basel, Switzerland).

    Polymerase Cycling Assembly:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    In Vivo:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    DNA Purification:

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: A blunt-ended substrate was generated by digestion of pOH-S with StuI (New England Biolabs), followed by DNA purification using a Macherey Nagel NucleoSpin® gel and PCR cleanup kit. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Mutagenesis:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: pT7–αHL was described previously ( ). pT7–αHL–PLM–D8 was prepared from pT7–αHL–RL4–D8 ( ) by cassette mutagenesis. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ).

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments. .. The pB6-derived plasmids were grown in DH5α E. coli cells and purified with QIAprep spin plasmid kit (Qiagen).

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs). .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs).

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: Paragraph title: Cloning of Tagged Mutant Allele ... Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer.

    Isolation:

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C. .. Resistant colonies growing at 37°C were cultured in LB medium with 50 μg per ml CHL.

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: The purified fragment was then treated with T4 DNA polymerase and T4 DNA ligase (New England Biolabs) and used to transform XL-10 Gold Ultracompetent Escherichia coli cells (Stratagene, La Jolla, CA). .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs). .. Clones displaying the expected digestion pattern were subjected to fluorescent sequencing (Applied Biosystems, Foster City, CA) using HIV-1-specific primers.

    Article Title: Promyelocytic leukemia protein in retinoic acid-induced chromatin remodeling of Oct4 gene promoter
    Article Snippet: Restriction enzyme accessibility assays were carried out as described [ ]. .. Isolated nuclei from P19 cells were digested with 100 U of XbaI, StuI, HhaI, NcoI and AvrII (New England Biolabs) for 30 min. .. The purified genomic DNA was re-digested with 100 U of HindIII.

    Size-exclusion Chromatography:

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: PCR was performed on a BioRad iCycler thermocycler (Hercules, CA) using the following reaction conditions: 95 o C (1 min); 40 cycles of 95 o C (1 min), 61o C (16s rDNA) or 50 o C (spoII) (30 sec), 72 o C (1.5 min); 72 o C (7 min); 4 o C (hold). .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Labeling:

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: LSU1 primer was fluorescently labeled at the 5′ terminus with either Red-ATTO565 or Yellow-ATTO550 (Microsynth AG, Balgach, Switzerland). .. Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl.

    Mouse Assay:

    Article Title: Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically
    Article Snippet: Paragraph title: Genotyping of NOD Mice for gld Expression ... The 320-bp PCR products were then digested with Stu I (New England BioLabs, Beverly, MA) at 37°C overnight and resolved on a 1.2% Nusieve agarose gel (FMC BioProducts, Rockland, ME).

    Polymerase Chain Reaction:

    Article Title: A concept of eliminating nonhomologous recombination for scalable and safe AAV vector generation for human gene therapy
    Article Snippet: The plasmid pRB21was digested with SmaI and StuI (NEB, Ipswich, MA), and then dephosphorylated by calf intestinal alkaline phosphatase (NEB, Ipswich, MA). .. This digested plasmid was used as the backbone to construct all plasmids having individual AAV2 rep and cap genes.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega).

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: A blunt-ended substrate was generated by digestion of pOH-S with StuI (New England Biolabs), followed by DNA purification using a Macherey Nagel NucleoSpin® gel and PCR cleanup kit. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: After overnight incubation at 30°C, colonies were scraped together and DNA was extracted with the Wizard Plus SV Mini-Prep kit (Promega; Madison, WI). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen). .. After transformation, cells were recovered at 37°C with 200 rpm shaking for 30 min, before serial dilutions of the recovered cells were plated (to determine transformation efficiency) on 2xYT agar plates with carbenicillin (50 μg/mL), and incubated overnight at 30°C.

    Article Title: Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically
    Article Snippet: The gld genotype was determined by polymerase chain reaction (PCR) on tail DNA by using a pair of primers (5′-CAGCAGCCCAAAGCTTTATG-3′ and 5′-CTCAACTCTCTCTGATCAATTTTGAGGA-3′) as previously described. .. The 320-bp PCR products were then digested with Stu I (New England BioLabs, Beverly, MA) at 37°C overnight and resolved on a 1.2% Nusieve agarose gel (FMC BioProducts, Rockland, ME). .. The digestion yielded 280- and 40-bp fragments for the wild-type allele, whereas Stu I does not digest the 320-bp PCR product for the mutated allele.

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The PCR fragments were inserted into linearized pCR-Blunt (Invitrogen) vector. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: A fragment of the expected size was isolated and purified using Qiaquick gel extraction and PCR purification kits (Qiagen, Valencia, CA), respectively. .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs).

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Because sequencing through a long adenosine tract at the 3′ end of the L1 insertions is not effective, the 3′ flanking genomic region was sequenced by ligation mediated PCR based on [ , ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Cloning and sequencing: Positive PCR reactions as needed were extended using Crimson Taq DNA polymerase (New England Biolabs, Inc.), cloned into pCR®4.0-TOPO® vector and transformed into One Shot® chemically competent cells (Invitrogen). .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: The reaction mixture was incubated for 1 min at 94°C; subjected to 30 cycles of 0.5 min at 94°C, 0.5 min at 55°C, and 0.5 min at 72°C; and finally incubated for 10 min at 72°C on an ABI 2720 thermocycler (Applied Biosystems, Inc., Carlsbad, CA). .. Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Restriction fragments were subsequently purified using a High Pure PCR Purification kit (Roche Diagnostics, Basel, Switzerland).

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: The GenomeWalker protocol (Clontech, Palo Alto, CA) was used to recover sequences flanking the T-DNA left border. .. Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer. .. A left border–specific primer (JM35) GCCTTTTCAGAA-ATGGATAAATAGCCTTGCTTCC was used in combination with the modified AP1 primer.

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: The reactions were terminated by heating to 95°C for 5 min following immediate cooling on ice. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. Note that the CC C motif is located in the middle of the substrate, yielding similar fragments following cleavage with the restriction enzyme.

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. ElectroMax DH5α-E cells were transformed by electroporation with a MicroPulser (Bio-Rad Laboratories).

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Paragraph title: Fungal 28S rDNA TRFLP assay . ... Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. Completion of the restriction reaction was verified using positive control substrate containing CCU instead of CC C .

    Gel Extraction:

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: A fragment of the expected size was isolated and purified using Qiaquick gel extraction and PCR purification kits (Qiagen, Valencia, CA), respectively. .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs).

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min). .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: Primers were synthesized by Integrated DNA Technologies (Coralville, IA). .. To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C. .. Restriction fragments were treated with a DNA Terminator end repair kit, ligated into the pSMART-LCKan vector with Clone Smart DNA ligase, and electroporated into E. cloni 10G electrocompetent cells according to the manufacturer's suggested protocols (Lucigen, Madison, WI).

    Purification:

    Article Title: Formation of carcinogenic chromosomal rearrangements in human thyroid cells after induction of double-strand DNA breaks by restriction endonucleases
    Article Snippet: PvuII, StuI, EcoRV, ScaI, and NruI RE (New England Bio Labs, Ipswick, MA, USA) were electroporated into human thyroid primary cells or HTori-3 cells by a previously described method ( ). .. PvuII, StuI, EcoRV, ScaI, and NruI RE (New England Bio Labs, Ipswick, MA, USA) were electroporated into human thyroid primary cells or HTori-3 cells by a previously described method ( ).

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: After overnight incubation at 30°C, colonies were scraped together and DNA was extracted with the Wizard Plus SV Mini-Prep kit (Promega; Madison, WI). .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen). .. After transformation, cells were recovered at 37°C with 200 rpm shaking for 30 min, before serial dilutions of the recovered cells were plated (to determine transformation efficiency) on 2xYT agar plates with carbenicillin (50 μg/mL), and incubated overnight at 30°C.

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: The purified fragment was then treated with T4 DNA polymerase and T4 DNA ligase (New England Biolabs) and used to transform XL-10 Gold Ultracompetent Escherichia coli cells (Stratagene, La Jolla, CA). .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs).

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Purified DNA was transformed by electroporation into competent DH5α E. coli (Life Technologies). .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl.

    Article Title: Promyelocytic leukemia protein in retinoic acid-induced chromatin remodeling of Oct4 gene promoter
    Article Snippet: The purified DNA was subjected to Southern blot analysis. .. Isolated nuclei from P19 cells were digested with 100 U of XbaI, StuI, HhaI, NcoI and AvrII (New England Biolabs) for 30 min.

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: Paragraph title: Deamination assay using purified A3G preparation ... One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C.

    Article Title: Loss and Gain of Elicitor Function of Soybean Mosaic Virus G7 Provoking Rsv1-Mediated Lethal Systemic Hypersensitive Response Maps to P3
    Article Snippet: The pSMV-G7 and pSMV-G7d plasmids propagated in ElectroMax DH5α-E cells were found to be insensitive to digestion with StuI located at position 5793 of the genome (Fig. ). .. To obtain StuI-sensitive templates, Escherichia coli strain GM2163 (New England Biolabs) was transformed with pSMV-G7 or pSMV-G7d, and the plasmids were purified as described above. .. To exchange DNA fragments representing nucleotides 1 to 2337 of each genome, the KpnI site (Fig. ) and a NotI site located 699 nucleotides upstream of the viral genome were used.

    Plasmid Preparation:

    Article Title: A concept of eliminating nonhomologous recombination for scalable and safe AAV vector generation for human gene therapy
    Article Snippet: Single-cell–derived cell lines were then evaluated by rAAV production using plasmid transfection in 96-well plate. .. The plasmid pRB21was digested with SmaI and StuI (NEB, Ipswich, MA), and then dephosphorylated by calf intestinal alkaline phosphatase (NEB, Ipswich, MA). .. This digested plasmid was used as the backbone to construct all plasmids having individual AAV2 rep and cap genes.

    Article Title: An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster
    Article Snippet: The T+ G+ vector containing a 10 kb genomic fragment coding for both tre1 and Gr5a was used in the generation of the amino acid-substituted constructs . .. A 1700 base pair fragment containing the target sequence for nucleotide replacement was excised by digesting with SphI and StuI restriction endonucleases (NEB) and cloned into a modified pSP72 vector containing an inserted StuI restriction site and lacking a PstI site. .. The resulting pSP72 vector containing the 1700bp tre1 insert was subsequently digested using PstI and Bpu10I (NEB) to excise a 160 base pair fragment of tre1 genomic DNA that housed the target sequence.

    Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
    Article Snippet: Relative quantification of gene expression was determined using the 2−ΔCt method , with elongation factor 1α (ef1α ) as a reference gene. .. (i) For transient transfection of HEK-293 cells and expression studies in zebrafish embryos: the coding sequences of human SLC39A14 transcript 1 and 2 were amplified from foetal liver cDNA with Q5 High Fidelity DNA polymerase (NEB) according to the manufacturer's recommendations using phosphorylated primers (Fwd 5′-CTGGGACCTTGCGGTGAG-3′ and Rev 5′-CTTCCAGTCCCACAGGCTCT-3′) and cloned into pCS2+ vector linearized with StuI (NEB) and dephosphorylated with thermosensitive alkaline phosphatase (Promega). .. Escherichia coli XL10 Gold Ultracompetent Cells (Agilent Technologies) were transformed with amplification products and the success of mutagenesis confirmed by DNA sequencing.

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: Primers were synthesized by Integrated DNA Technologies (Coralville, IA). .. To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C. .. Restriction fragments were treated with a DNA Terminator end repair kit, ligated into the pSMART-LCKan vector with Clone Smart DNA ligase, and electroporated into E. cloni 10G electrocompetent cells according to the manufacturer's suggested protocols (Lucigen, Madison, WI).

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: The resulting pOH-S plasmid allowed us to prepare a linear DNA substrate with 3′ overhangs of 26 nucleotides (nt) in length. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: C-terminal residues of mature Human T-Lymphotropic Virus Type 1 protease are critical for dimerization and catalytic activity
    Article Snippet: The PCR fragments were inserted into linearized pCR-Blunt (Invitrogen) vector. .. The plasmids were digested with StuI and BamHI restriction enzymes (New England Biolabs) to get the final protease fragments.

    Article Title: Inhibition of Envelope-Mediated CD4+-T-Cell Depletion by Human Immunodeficiency Virus Attachment Inhibitors
    Article Snippet: The purified fragment was then treated with T4 DNA polymerase and T4 DNA ligase (New England Biolabs) and used to transform XL-10 Gold Ultracompetent Escherichia coli cells (Stratagene, La Jolla, CA). .. Plasmid DNA from individual colonies was isolated using a Qiaprep Spin miniprep kit (Qiagen) and screened with the restriction enzyme StuI (New England Biolabs). .. Clones displaying the expected digestion pattern were subjected to fluorescent sequencing (Applied Biosystems, Foster City, CA) using HIV-1-specific primers.

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: The 5′ end of the de novo L1 insertion was sequenced using primers specific to the L1 rescue plasmid and primer walking until the 5′ end of the insert was recovered as described in [ ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Article Title: Molecular and Morphological Characterization and Biological Control Capabilities of a Pasteuria ssp. Parasitizing Rotylenchulus reniformis, the Reniform Nematode
    Article Snippet: Positive transformants were grown overnight in LB/KN broth and plasmids were extracted using Zyppy Plasmid Miniprep Kit (Zymo Research Corp.). .. Plasmids were screened for positive transformants by restriction digestion using EcoRI and StuI ( ) restriction enzymes (New England Biolabs, Inc.) in a double digest.

    Article Title: The TITAN5 Gene of Arabidopsis Encodes a Protein Related to the ADP Ribosylation Factor Family of GTP Binding Proteins
    Article Snippet: The GenomeWalker protocol (Clontech, Palo Alto, CA) was used to recover sequences flanking the T-DNA left border. .. Two modifications were made to the instructions provided: (1) the blunt-end enzymes BstZ17I, HpaI, SnaBI, and StuI (New England Biolabs, Beverly, MA) were used because their recognition sites are common in Arabidopsis genomic DNA but are missing from the T-DNA vector; and (2) for primary polymerase chain reaction (PCR) amplification, the AP1 primer suggested by Clontech was modified to GTAATACGACTCACTATAGGGCA to avoid the 3′-terminal GC in the standard AP1 primer. .. A left border–specific primer (JM35) GCCTTTTCAGAA-ATGGATAAATAGCCTTGCTTCC was used in combination with the modified AP1 primer.

    Article Title: TGF-?1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements
    Article Snippet: We obtained a human genomic DNA-BAC clone from BACPAC Resources (Children’s Hospital of the Oakland Research Institute, Oakland, CA) with an insert containing the human FAK promoter, exon 1 and intron 1 sequences as indicated in the GenBank data base. .. The BAC plasmid was cut with Sac I and Stu I (New England Biolabs, Ipswich, MA) releasing a fragment 1.65 kb in size that was subcloned into the pBluescript® II SK (+) vector (Strategene, La Jolla, CA) for amplification. .. The pBSK-FAK-promoter clone was subsequently cut with Nar I, end-filled, and then cut with Kpn I (New England Biolabs) to produce a 1.3 kb fragment that was subcloned into a pGL2 Basic vector (Promega, Madison, WI) to generate the FAK-promoter-luciferase construct used in the Dual Luciferase® Reporter Assay System (Promega).

    Software:

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C.

    Agarose Gel Electrophoresis:

    Article Title: Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically
    Article Snippet: The gld genotype was determined by polymerase chain reaction (PCR) on tail DNA by using a pair of primers (5′-CAGCAGCCCAAAGCTTTATG-3′ and 5′-CTCAACTCTCTCTGATCAATTTTGAGGA-3′) as previously described. .. The 320-bp PCR products were then digested with Stu I (New England BioLabs, Beverly, MA) at 37°C overnight and resolved on a 1.2% Nusieve agarose gel (FMC BioProducts, Rockland, ME). .. The digestion yielded 280- and 40-bp fragments for the wild-type allele, whereas Stu I does not digest the 320-bp PCR product for the mutated allele.

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min). .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    In Vitro:

    Article Title: Improvements to the Kunkel mutagenesis protocol for constructing primary and secondary phage-display libraries
    Article Snippet: Following the protocol described in section 2.3.1, dsDNA was synthesized in vitro with oligonucleotides encoding five NNK (where N is an equimolar mixture of A, G, C, and T, and K is an equimolar mixture of G and T) codons in the BC and FG loop regions of the FN3 coding sequence. .. The DNA was then digested with SacII, SmaI or StuI for 8 h (New England BioLabs), purified with the QIAquick PCR purification kit (Qiagen), and used to transform TG1 cells (Lucigen).

    Chromosome Walking:

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: The 5′ end of the de novo L1 insertion was sequenced using primers specific to the L1 rescue plasmid and primer walking until the 5′ end of the insert was recovered as described in [ ]. .. Briefly, a pool of five to six L1 rescue vectors was digested with Stu I (NEB) to relax supercoils, and then sheared by sonication using a Bioruptor (Diagenode, high, 30 s on, 90 s off, for 12 min).

    Spectrophotometry:

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Concentrations of PCR products from nail samples were estimated on 0.8% (wt/vol) agarose gels with a known amount of DNA Molecular Weight Marker XIV (Roche) and ranged from no detection to 150 ng/μl.

    Concentration Assay:

    Article Title: DNA2 Cooperates with the WRN and BLM RecQ Helicases to Mediate Long-range DNA End Resection in Human Cells
    Article Snippet: After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C. .. After digestion of pOH-S with StuI and its heat inactivation, Nt.BbvCI (New England Biolabs) was added, and the reaction was incubated further for 2 h at 37 °C.

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl.

    BAC Assay:

    Article Title: TGF-?1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements
    Article Snippet: We obtained a human genomic DNA-BAC clone from BACPAC Resources (Children’s Hospital of the Oakland Research Institute, Oakland, CA) with an insert containing the human FAK promoter, exon 1 and intron 1 sequences as indicated in the GenBank data base. .. The BAC plasmid was cut with Sac I and Stu I (New England Biolabs, Ipswich, MA) releasing a fragment 1.65 kb in size that was subcloned into the pBluescript® II SK (+) vector (Strategene, La Jolla, CA) for amplification. .. The pBSK-FAK-promoter clone was subsequently cut with Nar I, end-filled, and then cut with Kpn I (New England Biolabs) to produce a 1.3 kb fragment that was subcloned into a pGL2 Basic vector (Promega, Madison, WI) to generate the FAK-promoter-luciferase construct used in the Dual Luciferase® Reporter Assay System (Promega).

    Marker:

    Article Title: Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
    Article Snippet: Primers were synthesized by Integrated DNA Technologies (Coralville, IA). .. To clone restriction enzyme digestion fragments of the R. monacensis pRM plasmid bearing the pMOD658 transposon carrying a CHL acetyltransferase (CAT) resistance marker, DNA prepared from transformant Rmona658A and Rmona658B populations was digested overnight individually with EcoRI, EcoRV, HindIII, HpaI, NcoI, SpeI, SphI, or StuI (New England Biolabs or Promega) in the manufacturer's 1× buffers at 37°C. .. Restriction fragments were treated with a DNA Terminator end repair kit, ligated into the pSMART-LCKan vector with Clone Smart DNA ligase, and electroporated into E. cloni 10G electrocompetent cells according to the manufacturer's suggested protocols (Lucigen, Madison, WI).

    Article Title: Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism
    Article Snippet: Restriction enzyme digestions were performed at 37°C for 60 min. Twenty microliters of PCR product; 1 μl of AvaI, 1 μl of AvaII, and 1 μl of StuI restriction endonucleases (New England BioLabs, Ipswich, MA); and 5 μl of 10× reaction buffer (NEBuffer 4) were mixed with deionized water to give a total reaction volume of 50 μl. .. Restriction fragments were subsequently purified using a High Pure PCR Purification kit (Roche Diagnostics, Basel, Switzerland).

    Staining:

    Article Title: Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair
    Article Snippet: One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C. .. One μl of the reaction mixture was used for PCR amplification with Redmix (Larova) in a total volume of 20 μl using the following program: 1 cycle at 95°C for 3 min, followed by 30 cycles of annealing at 61°C for 30 s and denaturing at 94°C for 30 s. PCR products (10 μl) were incubated with the StuI restriction enzyme (NEB, UK) for 1 h at 37°C.

    Homologous Recombination:

    Article Title: Stochastic detection of Pim protein kinases reveals electrostatically enhanced association of a peptide substrate
    Article Snippet: A DNA cassette encoding the Pimtide sequence, flanking glycine/serine linkers, and AgeI and StuI sites at the 5′ and 3′ ends, respectively, was prepared by assembly PCR using the following oligonucleotides: 5′-GCGCGCACCGGTGATGATAG-3′, 5′-GCCGCTACTGCCGCTTCCGCTGCTATCATCACCGGTGCGC-3′, 5′-AGCGGCAGTAGCGGCGCACGTAAACGTCGTCGTCATCCGA-3′, 5′-GCTACCCGCGGTCGGTGGGCCGCTCGGATGACGACGACGT-3′, 5′-CCGACCGCGGGTAGCTCCGGGAGCGGCTCTAGCAAAATTG-3′, and 5′-CCCGGGAGGCCTCCAATTTTGCTAGAGCCGCTC-3′. .. The cassette was digested with AgeI and StuI (New England Biolabs) and ligated into pT7–αHL–RL4–D8 that had also been digested with AgeI and StuI. pT7–αHL–D127N was generated from pT7–αHL by in vivo homologous recombination ( , ). .. Two PCR reactions were performed using pT7–αHL as the template.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs stui
    Stui, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stui/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    stui - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    Image Search Results