xmai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    XmaI
    Description:
    XmaI 2 500 units
    Catalog Number:
    R0180L
    Price:
    277
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs xmai
    XmaI
    XmaI 2 500 units
    https://www.bioz.com/result/xmai/product/New England Biolabs
    Average 99 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    xmai - by Bioz Stars, 2019-07
    99/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: Paragraph title: Molecular cloning of cDNA expression vectors and lentiviral transduction ... HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Clone Assay:

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs). .. The resultant plasmid was electroporated into the PrfA-defective Lm strain XFL-7 (kindly provided by Hao Shen, University of Pennsylvania, Philadelphia, PA), which is derived from the Lm strain 10403S.

    Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
    Article Snippet: Paragraph title: lentiTandemGuide cloning ... lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: The plasmid pCI-neo was digested with NheI and XmaI (NEB). .. The MVA plasmid constructs were produced by digestion of pLW44 with BamHI (NEB).

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: cDNA expression plasmids were purchased from Addgene or GE Dharmacon Open Biosystems (Lafayette, CO, USA), amplified with PCR and subcloned into pSIN-EF2-Blast as shown in . .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems. .. Addgene plasmids G6PD/pRK5 (gift from Xiaolu Yang, #41521), plenti6.3/hCx43-stop (gift from Robin Shaw, #27383), pcDNA3-IGFBP5-V5 (gift from Steven Johnson, #11608), pEGFP-KIF2A (gift from Gohta Goshima and Ryota Uehara, #52401), hNICD3(3xFLAG)-pCDF1-MCS2-EF1-copGFP (gift from Brenda Lilly, #40640), and pcDNA3.1/Myc-His(-)-HSulf1 (gift from Steven Rosen, #13003) were used.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Primer sequences for all mutants are listed in Table . .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA). .. Following digestion of the product, the gene was ligated with the pNE-1 pneumococcal shuttle vector that was similarly digested.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: A construct containing the Δ1D2A sequence in a pCRII vector was used as a cloning template for construction of GLuc-Δ1D2A. .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Nucleotide sequence derived from FMDV O1 Manisa serotype and coding for the P1 polyprotein was synthesized by GenScript and cloned into a modified pTarget vector using BamHI-HF and NotI-HF restriction enzymes (New England Biolabs). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Amplification:

    Article Title: Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat
    Article Snippet: Four bar-coding bases between the target-specific primer and Illumina TruSeq adaptors ( ) were added to index multiple plants under each of the Illumina TruSeq barcodes. .. To screen the gw2 knockout mutants, the GW2T2 target region from all three homoeologs was amplified, and PCR products were digested with XmaI (NEB). .. If all three copies of the GW2T2 target site are mutated by CRISPR-Cas9, the PCR products should not be digested.

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: A fragment corresponding to HMW-MAA residues 2160 to 2258 was amplified by PCR using the primers 5’-TG CTCGAG GCCACTGAGCCTTACAATGCTGCC-3’ (forward primer, XhoI site underlined) and 5’- CCCGGG TTA CTACTTATCGTCGTCATCCTTGTAATC CTGGACGTCATGCTTGCCCG-3’ (reverse primer, XmaI site underlined, stop codon in bold and Flag sequence in italics). .. The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs).

    Article Title: Genome-wide profiling of methylated promoters in pancreatic adenocarcinoma
    Article Snippet: MCA was performed as described previously with minor modifications., Briefly 5 µg of DNA was digested with Sma I and XmaI (New England Biolabs). .. MCA was performed as described previously with minor modifications., Briefly 5 µg of DNA was digested with Sma I and XmaI (New England Biolabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xEcRE promoter [ ] was amplified via polymerase chain reaction (PCR) with primers introducing a restriction site for MscI. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
    Article Snippet: lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs). .. Digests were run on an agarose gel and gel purified. lentiGuide-sgRNA2 was linearized using NotI (New England Biolabs).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: AAV p5, p19, and p40 promoters were amplified by polymerase chain reaction by using plasmid pSub201 as the template. .. The plasmid pCI-neo was digested with NheI and XmaI (NEB).

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: cDNA expression plasmids were purchased from Addgene or GE Dharmacon Open Biosystems (Lafayette, CO, USA), amplified with PCR and subcloned into pSIN-EF2-Blast as shown in . .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Briefly, 500–1000 base pair DNA sequences flanking each side of the lytA gene were amplified using primers LytA-KO1, LytASup LytASdn, and LytA-KO4 (Table ) and fused by PCR to the spectinomycin resistance cassette amplified from the shuttle vector pNE-1. .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For insertion of GLuc-Δ1D2A into pTarget plasmid PCR amplification was performed with pCRII GLuc-Δ1D2A as a template and using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-GLuc-F and 2A-XmaI-R (Table ). .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For creation of the P1-2A-3C-Δ1D2A-SGLuc construct, insertion of 3C was performed by using PCR amplification with primer NotI-3CLeb89-F and 3CLeb89-ns-EcoRI-R (Table ). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena
    Article Snippet: The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites. .. The resulting plasmid (pFZZ-PAC) was used as a backbone plasmid for further constructs.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry.

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: For mutant generation with pMAD-based plasmids , ~600nt regions of complementarity both upstream and downstream of a targeted region were either ordered as gBlocks (IDT) and amplified with gBlock-Up and Down oligonucleotides ( ) complimentary to uniform flanks on each gBlock corresponding to the 40 nts on either side of the pMAD multi-cloning site, or PCR amplified with Phusion High fidelity polymerase and reagents (Finnzymes, F-553) using genomic DNA as a template and then joined by a second splice overlap extension PCR reaction using the first two PCR products as template to generate a Upstream-Downstream (UD) PCR product ( , lmo0919 deletion). .. PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S).

    Synthesized:

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Nucleotide sequence derived from FMDV O1 Manisa serotype and coding for the P1 polyprotein was synthesized by GenScript and cloned into a modified pTarget vector using BamHI-HF and NotI-HF restriction enzymes (New England Biolabs). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Construct:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: EC766 was constructed by amplifying fts Z from plasmid pKD3 (kindly provided by Jo Luktenhaus) by PCR using primers ECftsZ_F and ECftsZ_R ( ) with Pst I and Xma I sites incorporated PCR was carried out with Phusion Taq (NEB, Ipswitch, MA, USA) under standard conditions. .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: Paragraph title: Plasmid constructs ... The plasmid pCI-neo was digested with NheI and XmaI (NEB).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: A construct containing the Δ1D2A sequence in a pCRII vector was used as a cloning template for construction of GLuc-Δ1D2A. .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Paragraph title: Creation of FMDV VLP producing constructs ... The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena
    Article Snippet: The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites. .. The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Electrophoresis:

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen). .. Illumina paired-end sequencing adaptors were ligated using Rapid T4 DNA ligase (Enzymatics).

    Incubation:

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB). .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB).

    Luciferase:

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: The digested plasmid was used as the backbone to construct all plasmids having the AAV promoters driving the firefly luciferase gene. .. The plasmid pCI-neo was digested with NheI and XmaI (NEB).

    Expressing:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: To transfect the SPO11 disruption (pΔSPO11-NEO4; ), pTOP2Gi-NEO5, and C-terminally GFP-tagged Asf1 expression (pASF1-GFP-NEO2; ) vectors into paromomycin-resistant mutant strains, we replaced the NEO-based drug resistance markers in the vectors with a puromycin resistance marker (PAC; ). .. NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: To generate the hERα expression plasmid, full length D . magna EF1α-1 promoter [ ] and full length human esr1 [ ] were joined into a pRC21 backbone with full length EF1α-1 3’UTR via InFusion (TAKARA, Kusatsu, Shiga, Japan); the resulting construct was termed pRC21-hERa. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: Where indicated, glycerol was replaced with 0.4% glucose for repression of expression from PBAD . .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB).

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: Paragraph title: Molecular cloning of cDNA expression vectors and lentiviral transduction ... HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Modification:

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems. .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Nucleotide sequence derived from FMDV O1 Manisa serotype and coding for the P1 polyprotein was synthesized by GenScript and cloned into a modified pTarget vector using BamHI-HF and NotI-HF restriction enzymes (New England Biolabs). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Transformation Assay:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs). .. The MTT2-PAC cassette was excised from the vector and integrated into backbone vectors using T4 DNA ligase (New England BioLabs).

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. The plasmid was additionally transferred via conjugation to cadmium-susceptible L. monocytogenes strains F2365 and H7550-Cds , yielding F2365:: cadA4 and H7550-Cds :: cadA4 , respectively ( ).

    Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
    Article Snippet: lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs). .. KOD PCR reaction used the following cycling conditions: 95°C for 2 minutes; 50 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 70°C for 30 seconds; 60°C for 5 minutes.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: The lytA gene was replaced with a spectinomycin cassette following transformation of S. pneumoniae strains by standard methods and selected for by plating on blood agar plates supplemented with spectinomycin (500 μg/mL). .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. Transformants were screened by PCR and Sanger sequencing for the presence of the appropriate insert.

    Over Expression:

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: Strain EC766 (ftsZ*, PBAD ) was created for the controlled induction of filamentous cells via overexpression of the fts Z gene under control of the arabinose inducible PBAD promoter. .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB).

    Derivative Assay:

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs). .. The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Nucleotide sequence derived from FMDV O1 Manisa serotype and coding for the P1 polyprotein was synthesized by GenScript and cloned into a modified pTarget vector using BamHI-HF and NotI-HF restriction enzymes (New England Biolabs). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Electron Microscopy:

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. Electrocompetent L. monocytogenes strains were transformed with the respective plasmid and mutagenesis carried out as described previously ( ).

    Ligation:

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen). .. Illumina paired-end sequencing adaptors were ligated using Rapid T4 DNA ligase (Enzymatics).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA). .. Following digestion of the product, the gene was ligated with the pNE-1 pneumococcal shuttle vector that was similarly digested.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Ligation of digested GLuc sequence into digested pCRII vector was performed using T4 DNA ligase (Roche). .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Generated:

    Article Title: Single molecule analysis of DNA wrapping and looping by a circular 14mer wheel of the bacteriophage 186 CI repressor
    Article Snippet: The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs). .. The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs).

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems. .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Mutants lacking the lytA gene were generated in strains T4R and WU2 by overlap extension PCR mutagenesis as previously described [ ]. .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA).

    Sequencing:

    Article Title: Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat
    Article Snippet: To screen the gw2 knockout mutants, the GW2T2 target region from all three homoeologs was amplified, and PCR products were digested with XmaI (NEB). .. The genome specificity of the primers flanking the GW2T2 target sites ( ) was validated by performing PCR with DNA of Chinese Spring nullisomic-tetrasomic lines ( ).

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: A fragment corresponding to HMW-MAA residues 2160 to 2258 was amplified by PCR using the primers 5’-TG CTCGAG GCCACTGAGCCTTACAATGCTGCC-3’ (forward primer, XhoI site underlined) and 5’- CCCGGG TTA CTACTTATCGTCGTCATCCTTGTAATC CTGGACGTCATGCTTGCCCG-3’ (reverse primer, XmaI site underlined, stop codon in bold and Flag sequence in italics). .. The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs). .. The fragment was ligated into a pGG55-based plasmid downstream and fused to a gene encoding for the first 441 residues of the LLO protein, whose expression is driven by the hly promoter.

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen). .. The 3′ recessed ends of the DNA created by XmaI digestion were filled in with 3′-dA tails added by Klenow DNA polymerase lacking 3′-to-5′ exonuclease activity (NEB) and dCTP, dGTP and dATP mix (0.4 mM of each).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Creation of the GLuc-Δ1D2A chimera in the pCRII vector was confirmed by sequencing with T7 and GLuc-NS-NheI-R (Table ), as described above. .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For creation of the P1-2A-3C-Δ1D2A-SGLuc construct, insertion of 3C was performed by using PCR amplification with primer NotI-3CLeb89-F and 3CLeb89-ns-EcoRI-R (Table ). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs). .. Confirmation of insertion was performed by sequencing with primers NotI-3CLeb89-F, 3CLeb89-EcoRI-R, and Seq-R (Table ), and analyzed as described above.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry.

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. 2μl of each ligation were transformed into chemically competent E. coli Top10 (Invitrogen, Carlsbad, California, C404003) cells according to the manufacturer’s instructions.

    Recombinant:

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: Primers P1 and P2 ( ) were designed with restriction sites for XmaI and SacI, respectively, and used to amplify a DNA fragment that included 333 nt of the intergenic region upstream of cadC ( LMOSA _ 2321 ), harboring the putative promoter, as well as the coding sequences for cadC and cadA4 . .. The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. This plasmid was electroporated into E. coli S17-1 ( ) resulting in E. coli S17-1_pPL_ cadA4 , and transferred into the cadA4 transposon mutant I1A2 via conjugation as described previously , yielding strain I1A2:: cad A4.

    Pulsed-Field Gel:

    Article Title: Methicillin-Resistant Staphylococcus pseudintermedius in a Veterinary Teaching Hospital
    Article Snippet: Localization of 11 exotoxin genes, encoding for staphylococcal enterotoxins SEA ( sea ), SEB ( seb ), SEC ( sec ), SED ( sed ), SEE ( see ), SEG ( seg ), SEH ( seh ), SEI ( sei ), SEJ ( sei ); exfoliative toxin A, B (ETA; eta , ETB; etb ); TSST-1 ( tst ); Panton-Valentine leukocidin ( lukS and lukF ) were detected by PCR as reported previously ( , , ). .. Chromosomal DNAs of the CPS strains digested with SmaI, AscI, and XmaI (New England Biolabs, Beverly, MA) were analyzed by pulsed-field gel electrophoresis (PFGE) as described previously ( ) with minor modifications. .. The PFGE conditions for SmaI-, XmaI-, and AscI-digested DNAs were as follows: a switch time of 3.0 to 9.0 s and a run time of 9 h and a switch time of 8.0 to 45.0 s and a run time of 12 h (for SmaI and XmaI); a switch time of 5.0 to 40.0 s and a run time of 22 h (for AscI); included angle, 120°; and voltage, 6 V/cm.

    Molecular Cloning:

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: Paragraph title: Molecular cloning of cDNA expression vectors and lentiviral transduction ... HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Methylation:

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Paragraph title: Digital restriction enzyme analysis of methylation (DREAM) ... Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Genome-wide profiling of methylated promoters in pancreatic adenocarcinoma
    Article Snippet: MCA was performed as described previously with minor modifications., Briefly 5 µg of DNA was digested with Sma I and XmaI (New England Biolabs). .. Unmethylated Sma I sites are eliminated by Sma I digestion (which does not cut CCCGGG sites if they contain a methylated CpG), which leaves a blunt end fragment.

    Mutagenesis:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: To transfect the SPO11 disruption (pΔSPO11-NEO4; ), pTOP2Gi-NEO5, and C-terminally GFP-tagged Asf1 expression (pASF1-GFP-NEO2; ) vectors into paromomycin-resistant mutant strains, we replaced the NEO-based drug resistance markers in the vectors with a puromycin resistance marker (PAC; ). .. NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs).

    Article Title: Single molecule analysis of DNA wrapping and looping by a circular 14mer wheel of the bacteriophage 186 CI repressor
    Article Snippet: CI–His6 and CI(HTH− )His6 were prepared as described previously ( ) and stored at −80°C in TEG150 buffer [50 mM Tris–HCl, 150 mM NaCl, 0.1 mM ethylenediaminetetraacetic acid and 10% glycerol (pH 7.4)]. .. The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs). .. The required digestion product was gel extracted and purified (QIAGEN gel purification kit).

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Paragraph title: Mutant construction ... Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen). .. Ligation and confirmation by sequencing with T7 and Seq-R primers (Table ) was performed as described above.

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: For mutant generation with pMAD-based plasmids , ~600nt regions of complementarity both upstream and downstream of a targeted region were either ordered as gBlocks (IDT) and amplified with gBlock-Up and Down oligonucleotides ( ) complimentary to uniform flanks on each gBlock corresponding to the 40 nts on either side of the pMAD multi-cloning site, or PCR amplified with Phusion High fidelity polymerase and reagents (Finnzymes, F-553) using genomic DNA as a template and then joined by a second splice overlap extension PCR reaction using the first two PCR products as template to generate a Upstream-Downstream (UD) PCR product ( , lmo0919 deletion). .. PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S).

    Conjugation Assay:

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. This plasmid was electroporated into E. coli S17-1 ( ) resulting in E. coli S17-1_pPL_ cadA4 , and transferred into the cadA4 transposon mutant I1A2 via conjugation as described previously , yielding strain I1A2:: cad A4.

    Mouse Assay:

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Polymerase Chain Reaction:

    Article Title: Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat
    Article Snippet: Four bar-coding bases between the target-specific primer and Illumina TruSeq adaptors ( ) were added to index multiple plants under each of the Illumina TruSeq barcodes. .. To screen the gw2 knockout mutants, the GW2T2 target region from all three homoeologs was amplified, and PCR products were digested with XmaI (NEB). .. If all three copies of the GW2T2 target site are mutated by CRISPR-Cas9, the PCR products should not be digested.

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: A fragment corresponding to HMW-MAA residues 2160 to 2258 was amplified by PCR using the primers 5’-TG CTCGAG GCCACTGAGCCTTACAATGCTGCC-3’ (forward primer, XhoI site underlined) and 5’- CCCGGG TTA CTACTTATCGTCGTCATCCTTGTAATC CTGGACGTCATGCTTGCCCG-3’ (reverse primer, XmaI site underlined, stop codon in bold and Flag sequence in italics). .. The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs). .. The fragment was ligated into a pGG55-based plasmid downstream and fused to a gene encoding for the first 441 residues of the LLO protein, whose expression is driven by the hly promoter.

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Genomic DNA (5 μg) was digested with 5 μl of FastDigest SmaI endonuclease (Fermentas) for 3 h at 37 °C. .. Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen). .. The 3′ recessed ends of the DNA created by XmaI digestion were filled in with 3′-dA tails added by Klenow DNA polymerase lacking 3′-to-5′ exonuclease activity (NEB) and dCTP, dGTP and dATP mix (0.4 mM of each).

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: Primers P1 and P2 ( ) were designed with restriction sites for XmaI and SacI, respectively, and used to amplify a DNA fragment that included 333 nt of the intergenic region upstream of cadC ( LMOSA _ 2321 ), harboring the putative promoter, as well as the coding sequences for cadC and cadA4 . .. The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. This plasmid was electroporated into E. coli S17-1 ( ) resulting in E. coli S17-1_pPL_ cadA4 , and transferred into the cadA4 transposon mutant I1A2 via conjugation as described previously , yielding strain I1A2:: cad A4.

    Article Title: Genome-wide profiling of methylated promoters in pancreatic adenocarcinoma
    Article Snippet: MCA was performed as described previously with minor modifications., Briefly 5 µg of DNA was digested with Sma I and XmaI (New England Biolabs). .. Methylated Sma I sites are then digested with the non-methylation-sensitive Sma I isoschizomer XmaI, leaving a CCGG overhang (sticky end).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs).

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: EC766 was constructed by amplifying fts Z from plasmid pKD3 (kindly provided by Jo Luktenhaus) by PCR using primers ECftsZ_F and ECftsZ_R ( ) with Pst I and Xma I sites incorporated PCR was carried out with Phusion Taq (NEB, Ipswitch, MA, USA) under standard conditions. .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB). .. The ligation was transformed into DH5α cells via electroporation and the resulting colonies assessed for the presence of the fts Z insert via colony PCR using primers pBAD24_F and ECftsZ_R , Taq polymerase and Thermopol buffer, under standard conditions (NEB).

    Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
    Article Snippet: lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs). .. lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: AAV p5, p19, and p40 promoters were amplified by polymerase chain reaction by using plasmid pSub201 as the template. .. The plasmid pCI-neo was digested with NheI and XmaI (NEB).

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: cDNA expression plasmids were purchased from Addgene or GE Dharmacon Open Biosystems (Lafayette, CO, USA), amplified with PCR and subcloned into pSIN-EF2-Blast as shown in . .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Primer sequences for all mutants are listed in Table . .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA). .. Following digestion of the product, the gene was ligated with the pNE-1 pneumococcal shuttle vector that was similarly digested.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For insertion of GLuc-Δ1D2A into pTarget plasmid PCR amplification was performed with pCRII GLuc-Δ1D2A as a template and using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-GLuc-F and 2A-XmaI-R (Table ). .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen). .. Ligation and confirmation by sequencing with T7 and Seq-R primers (Table ) was performed as described above.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For creation of the P1-2A-3C-Δ1D2A-SGLuc construct, insertion of 3C was performed by using PCR amplification with primer NotI-3CLeb89-F and 3CLeb89-ns-EcoRI-R (Table ). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: For mutant generation with pMAD-based plasmids , ~600nt regions of complementarity both upstream and downstream of a targeted region were either ordered as gBlocks (IDT) and amplified with gBlock-Up and Down oligonucleotides ( ) complimentary to uniform flanks on each gBlock corresponding to the 40 nts on either side of the pMAD multi-cloning site, or PCR amplified with Phusion High fidelity polymerase and reagents (Finnzymes, F-553) using genomic DNA as a template and then joined by a second splice overlap extension PCR reaction using the first two PCR products as template to generate a Upstream-Downstream (UD) PCR product ( , lmo0919 deletion). .. PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. 2μl of each ligation were transformed into chemically competent E. coli Top10 (Invitrogen, Carlsbad, California, C404003) cells according to the manufacturer’s instructions.

    Purification:

    Article Title: Dnmt3a is essential for hematopoietic stem cell differentiation
    Article Snippet: Genomic DNA (5 μg) was digested with 5 μl of FastDigest SmaI endonuclease (Fermentas) for 3 h at 37 °C. .. Subsequently, 50 U (5 μl) of XmaI endonuclease (NEB) was added, and the digestion was continued for an additional 16 h. The digested DNA was purified using QIAquick PCR purification kit (Qiagen). .. The 3′ recessed ends of the DNA created by XmaI digestion were filled in with 3′-dA tails added by Klenow DNA polymerase lacking 3′-to-5′ exonuclease activity (NEB) and dCTP, dGTP and dATP mix (0.4 mM of each).

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: Primers P1 and P2 ( ) were designed with restriction sites for XmaI and SacI, respectively, and used to amplify a DNA fragment that included 333 nt of the intergenic region upstream of cadC ( LMOSA _ 2321 ), harboring the putative promoter, as well as the coding sequences for cadC and cadA4 . .. The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. This plasmid was electroporated into E. coli S17-1 ( ) resulting in E. coli S17-1_pPL_ cadA4 , and transferred into the cadA4 transposon mutant I1A2 via conjugation as described previously , yielding strain I1A2:: cad A4.

    Article Title: BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis
    Article Snippet: lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37°C for four hours (New England Biolabs). .. KOD PCR reaction used the following cycling conditions: 95°C for 2 minutes; 50 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 70°C for 30 seconds; 60°C for 5 minutes.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA). .. The ligation was transformed into E. coli strain DH5α.

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For insertion of GLuc-Δ1D2A into pTarget plasmid PCR amplification was performed with pCRII GLuc-Δ1D2A as a template and using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-GLuc-F and 2A-XmaI-R (Table ). .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen). .. Ligation and confirmation by sequencing with T7 and Seq-R primers (Table ) was performed as described above.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: For mutant generation with pMAD-based plasmids , ~600nt regions of complementarity both upstream and downstream of a targeted region were either ordered as gBlocks (IDT) and amplified with gBlock-Up and Down oligonucleotides ( ) complimentary to uniform flanks on each gBlock corresponding to the 40 nts on either side of the pMAD multi-cloning site, or PCR amplified with Phusion High fidelity polymerase and reagents (Finnzymes, F-553) using genomic DNA as a template and then joined by a second splice overlap extension PCR reaction using the first two PCR products as template to generate a Upstream-Downstream (UD) PCR product ( , lmo0919 deletion). .. PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. 2μl of each ligation were transformed into chemically competent E. coli Top10 (Invitrogen, Carlsbad, California, C404003) cells according to the manufacturer’s instructions.

    Plasmid Preparation:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs). .. NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs).

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Article Title: Cancer immunotherapy targeting the HMW-MAA protein results in a broad antitumor response and reduction of pericytes in the tumor vasculature
    Article Snippet: A fragment corresponding to HMW-MAA residues 2160 to 2258 was amplified by PCR using the primers 5’-TG CTCGAG GCCACTGAGCCTTACAATGCTGCC-3’ (forward primer, XhoI site underlined) and 5’- CCCGGG TTA CTACTTATCGTCGTCATCCTTGTAATC CTGGACGTCATGCTTGCCCG-3’ (reverse primer, XmaI site underlined, stop codon in bold and Flag sequence in italics). .. The PCR product was ligated into pCR2.1-TOPO plasmid (Invitrogen), confirmed by sequencing and subsequently excised by double digestion with XhoI and XmaI (New England Biolabs). .. The fragment was ligated into a pGG55-based plasmid downstream and fused to a gene encoding for the first 441 residues of the LLO protein, whose expression is driven by the hly promoter.

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: Primers P1 and P2 ( ) were designed with restriction sites for XmaI and SacI, respectively, and used to amplify a DNA fragment that included 333 nt of the intergenic region upstream of cadC ( LMOSA _ 2321 ), harboring the putative promoter, as well as the coding sequences for cadC and cadA4 . .. The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. This plasmid was electroporated into E. coli S17-1 ( ) resulting in E. coli S17-1_pPL_ cadA4 , and transferred into the cadA4 transposon mutant I1A2 via conjugation as described previously , yielding strain I1A2:: cad A4.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Both the PCR fragment and the mCherry plasmid were digested with MscI and EcoO109I (NewEngland BioLabs, Ipswitch, MA, USA) and joined via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-EcRE:mCherry. .. To generate the ERE reporter plasmid, the EcRE repeats were excised out of pRC21-EcRE:mCherry with EcoO109I and XmaI (NewEngland BioLabs). .. A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site.

    Article Title: Harnessing Single Cell Sorting to Identify Cell Division Genes and Regulators in Bacteria
    Article Snippet: EC766 was constructed by amplifying fts Z from plasmid pKD3 (kindly provided by Jo Luktenhaus) by PCR using primers ECftsZ_F and ECftsZ_R ( ) with Pst I and Xma I sites incorporated PCR was carried out with Phusion Taq (NEB, Ipswitch, MA, USA) under standard conditions. .. Vector pBAD24 and the fts Z PCR product were digested with Xma I and Pst I (NEB) and ligated with a T4 DNA ligase (NEB). .. The ligation was transformed into DH5α cells via electroporation and the resulting colonies assessed for the presence of the fts Z insert via colony PCR using primers pBAD24_F and ECftsZ_R , Taq polymerase and Thermopol buffer, under standard conditions (NEB).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: AAV p5, p19, and p40 promoters were amplified by polymerase chain reaction by using plasmid pSub201 as the template. .. The plasmid pCI-neo was digested with NheI and XmaI (NEB). .. The digested plasmid was used as the backbone for the pCI-Rep/Cap plasmid.

    Article Title: PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma
    Article Snippet: HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems. .. HDAC4 cDNA was blunt-end cloned from pCMV-SPORT-6 (Open Biosystems) into pSIN-EF2-Blast digested with Xma I (NEB). cDNAs for CCND2, EML4, HDAC4, PAX7, PAX3 and TWF1 were cloned from plasmids purchased from GE Dharmacon Open Biosystems.

    Article Title: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release
    Article Snippet: Briefly, 500–1000 base pair DNA sequences flanking each side of the lytA gene were amplified using primers LytA-KO1, LytASup LytASdn, and LytA-KO4 (Table ) and fused by PCR to the spectinomycin resistance cassette amplified from the shuttle vector pNE-1. .. Complemented mutants in strains TIGR4 and T4R were developed through cloning the spxB gene from T4R by amplifying the gene by PCR with primers SpxB-F and SpxB-R followed by digestion of the product with EcoRI and XmaI enzymes (New England Biolabs, Ipswich, MA).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: For insertion of GLuc-Δ1D2A into pTarget plasmid PCR amplification was performed with pCRII GLuc-Δ1D2A as a template and using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-GLuc-F and 2A-XmaI-R (Table ). .. Template pTarget GLuc was digested with AscI and XmaI restriction enzymes (New England Biolabs) and purified using QIAquick PCR purification kit (Qiagen).

    Article Title: Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression
    Article Snippet: Nucleotide sequence derived from FMDV O1 Manisa serotype and coding for the P1 polyprotein was synthesized by GenScript and cloned into a modified pTarget vector using BamHI-HF and NotI-HF restriction enzymes (New England Biolabs). .. The sequence for Δ1D2A-SGLuc was inserted 3′ of the 3C sequence by digestion of the template with EcoRI-HF and XmaI restriction enzymes (New England Biolabs).

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena
    Article Snippet: To create double-mutant strains (described in ), we replaced the NEO4 cassette with a puromycin resistance marker (PAC ) [ ]. .. The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites. .. The MTT2-PAC cassette was excised from pTOP2Gi-PAC and integrated into the SalI–ApaI sites of pFZZ-NEO4 with T4 DNA ligase (New England BioLabs).

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Term-seq reveals abundant ribo-regulation of antibiotics resistance in bacteria
    Article Snippet: For mutant generation with pMAD-based plasmids , ~600nt regions of complementarity both upstream and downstream of a targeted region were either ordered as gBlocks (IDT) and amplified with gBlock-Up and Down oligonucleotides ( ) complimentary to uniform flanks on each gBlock corresponding to the 40 nts on either side of the pMAD multi-cloning site, or PCR amplified with Phusion High fidelity polymerase and reagents (Finnzymes, F-553) using genomic DNA as a template and then joined by a second splice overlap extension PCR reaction using the first two PCR products as template to generate a Upstream-Downstream (UD) PCR product ( , lmo0919 deletion). .. PCR products were subsequently purified with QIAquick PCR purification columns (Qiagen, Hilden, Germany, 28104), digested with the SalI and XmaI restriction enzymes (New England BioLabs, NEB, Ipswich, Massachusetts), purified again as before, and ligated into SalI/XmaI digested pMAD plasmid for 1 hr at 25°C with T4 DNA ligase (NEB, M0202S). .. 2μl of each ligation were transformed into chemically competent E. coli Top10 (Invitrogen, Carlsbad, California, C404003) cells according to the manufacturer’s instructions.

    Sample Prep:

    Article Title: Single molecule analysis of DNA wrapping and looping by a circular 14mer wheel of the bacteriophage 186 CI repressor
    Article Snippet: Paragraph title: AFM sample preparation ... The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs).

    Ethanol Precipitation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Knock-Out:

    Article Title: Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat
    Article Snippet: Four bar-coding bases between the target-specific primer and Illumina TruSeq adaptors ( ) were added to index multiple plants under each of the Illumina TruSeq barcodes. .. To screen the gw2 knockout mutants, the GW2T2 target region from all three homoeologs was amplified, and PCR products were digested with XmaI (NEB). .. If all three copies of the GW2T2 target site are mutated by CRISPR-Cas9, the PCR products should not be digested.

    Produced:

    Article Title: Single molecule analysis of DNA wrapping and looping by a circular 14mer wheel of the bacteriophage 186 CI repressor
    Article Snippet: CI–His6 and CI(HTH− )His6 were prepared as described previously ( ) and stored at −80°C in TEG150 buffer [50 mM Tris–HCl, 150 mM NaCl, 0.1 mM ethylenediaminetetraacetic acid and 10% glycerol (pH 7.4)]. .. The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs). .. The required digestion product was gel extracted and purified (QIAGEN gel purification kit).

    Article Title: Vaccinia virus as a subhelper for AAV replication and packaging
    Article Snippet: The plasmid pCI-neo was digested with NheI and XmaI (NEB). .. The plasmid pH22 was digested with BsaI (NEB) and used as the insert for the pCI-Rep/Cap plasmid.

    Concentration Assay:

    Article Title: Novel Cadmium Resistance Determinant in Listeria monocytogenes
    Article Snippet: The PCR product was digested with XmaI and SacI (New England BioLabs, Ipswich, MA, USA), gel purified, and ligated using T4 DNA ligase (Promega) to similarly digested shuttle vector pPL2 , yielding the recombinant plasmid pPL2_ cadA4 . .. I1A2, F2365, and H7550-Cds were also transformed with the empty vector pPL2, yielding I1A2::pPL2, F2365::pPL2 and H7550-Cds ::pPL2, respectively ( ).

    Article Title: Single molecule analysis of DNA wrapping and looping by a circular 14mer wheel of the bacteriophage 186 CI repressor
    Article Snippet: The 1584-bp-long DNA fragments were produced by cutting the pBS-HSL series of plasmids ( Supplementary Data ) containing wild-type or mutant 186 operators (FL, pR-pL and FR) with NgoMIV and XmaI (New England BioLabs). .. The 5′-biotin-CTTTCTTGCAGCCTTTACGG-3′ and 5′-TTTACAAATGCTTCTCCTTCTCC-3′ generated a 528-bp-long DNA containing only the pR and pL operators, with a biotin tag on the pR proximal side.

    FLAG-tag:

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena
    Article Snippet: Plasmid pFZZ-NEO4 [ ] contains FZZ (three tandem repeats of the FLAG epitope, a TEV protease-sensitive site, and a protein A epitope) and a NEO4 drug-resistant marker [ ]. .. The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites.

    Marker:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: Paragraph title: Replacement of paromomycin resistance markers with a puromycin resistant marker ... NEO cassettes were removed from the vectors by digesting with SalI plus XmaI (New England BioLabs).

    Article Title: Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis
    Article Snippet: Transgene-containing vectors: pLD53.SC2, which contains EGFP, or pLD53.SC296, which contains EGFP-L10a. .. Both available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) pSV.RecA vector: available from the laboratory of Nathaniel Heintz, The Rockefeller University, through Judy Walsh ( ) Swiss Webster female mice (Taconic) Bacterial artificial chromosomes (BACs in DH10B host bacteria; Invitrogen Corporation, BACPAC Resources at CHORI or Riken Bioresources Center) PIR1 chemically competent E. coli (Invitrogen, cat. no. C1010-10) PIR2 chemically competent E. coli (Invitrogen, cat. no. C1111-10) MAX efficiency DH5α-competent cells (Invitrogen, cat. no. 18258-012) PCR primers (Invitrogen and Biosynthesis; see REAGENT SETUP) AscI restriction endonuclease (New England Biolabs, cat. no. R0558L) EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101L) MluI restriction endonuclease (New England Biolabs, cat. no. R0198L) SwaI restriction endonuclease (New England Biolabs, cat. no. R0604L) T4 DNA ligase (New England Biolabs, cat. no. M0202L) XmaI restriction endonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs, cat. no. NO350S) 2-log DNA ladder (New England Biolabs, cat. no. N3200L) 1-Butanol (Fisher Scientific, cat. no. A399) 2-Propanol (Isopropanol, Fisher Scientific, cat. no. A416) Ammonium acetate (Fisher Scientific, cat. no. A637) Ampicillin (amp; Sigma-Aldrich, cat. no. A9518; see REAGENT SETUP) Calcium chloride dihydrate (CaCl2 , Fisher Scientific, cat. no. C70–500) Cesium chloride (CsCl, Fischer Scientific, cat. no. BP1595-500) Chloramphenicol (chlor; Sigma-Aldrich, cat. no. C0378; see REAGENT SETUP) Chloroform (Fisher Scientific, cat. no. C298–500) Ethidium bromide solution (10 mg ml−1 ; Sigma-Aldrich, cat. no. E1510) ! .. Ethanol (Pharmco-AAPER) EDTA (Sigma-Aldrich, cat. no. E5134) FailSafe PCR System (Epicentre, cat. no. FS99250) Glacial acetic acid (Fisher Scientific, cat. no. A38S) !

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena
    Article Snippet: To create double-mutant strains (described in ), we replaced the NEO4 cassette with a puromycin resistance marker (PAC ) [ ]. .. The NEO4 cassette was removed from the plasmid by digestion with SalI and XmaI (New England BioLabs). pTOP2Gi-PAC [ ] carries PAC under the control of the MTT2 copper-inducible promoter [ ] between SalI and XmaI sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xmai
    Xmai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xmai/product/New England Biolabs
    Average 99 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    xmai - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    Image Search Results