apai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    ApaI
    Description:
    ApaI 25 000 units
    Catalog Number:
    r0114l
    Price:
    285
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs apai
    ApaI
    ApaI 25 000 units
    https://www.bioz.com/result/apai/product/New England Biolabs
    Average 90 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    apai - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study"

    Article Title: The Composition of Human Milk and Infant Faecal Microbiota Over the First Three Months of Life: A Pilot Study

    Journal: Scientific Reports

    doi: 10.1038/srep40597

    Pulse-field gel electrophoresis patterns of ( a ) XbaI-digested genomic DNA of B. breve isolates and ( b ) ApaI-digested genomic DNA of L. plantarum isolates from human milk and infant faeces. The unedited versions of these images can be found as Supplementary Figures S3 and S4 .
    Figure Legend Snippet: Pulse-field gel electrophoresis patterns of ( a ) XbaI-digested genomic DNA of B. breve isolates and ( b ) ApaI-digested genomic DNA of L. plantarum isolates from human milk and infant faeces. The unedited versions of these images can be found as Supplementary Figures S3 and S4 .

    Techniques Used: Nucleic Acid Electrophoresis

    2) Product Images from "The Impact of Inadequate Terminal Disinfection on an Outbreak of Imipenem-Resistant Acinetobacter baumannii in an Intensive Care Unit"

    Article Title: The Impact of Inadequate Terminal Disinfection on an Outbreak of Imipenem-Resistant Acinetobacter baumannii in an Intensive Care Unit

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0107975

    Pulsed-field gel electrophoresis (PFGE) profiles of 48 imipenem-resistant A. baumannii isolates digested with ApaI. Red line indicated the 85% similarity values of PFGE profiles. P: clinical isolate from patient; E: environmental isolate.
    Figure Legend Snippet: Pulsed-field gel electrophoresis (PFGE) profiles of 48 imipenem-resistant A. baumannii isolates digested with ApaI. Red line indicated the 85% similarity values of PFGE profiles. P: clinical isolate from patient; E: environmental isolate.

    Techniques Used: Pulsed-Field Gel, Electrophoresis

    3) Product Images from "Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay"

    Article Title: Discrimination between Onchocerca volvulus and O. ochengi filarial larvae in Simulium damnosum (s.l.) and their distribution throughout central Ghana using a versatile high-resolution speciation assay

    Journal: Parasites & Vectors

    doi: 10.1186/s13071-016-1832-7

    Genetic discrimination of O. volvulus and O. ochengi . a Sequence of the PCR 79-bp amplicon used to discriminate between O. volvulus and O. ochengi . Nucleotide differences between the two species are highlighted in bold, and the ApaI restriction site present in the O. volvulus sequence is underlined. b Normalised HRM melt curves from cloned positive control 79-bp products (pGem_Ov and pGem_Oo), adult O. volvulus and O. ochengi DNA, and 4 larvae samples from both species, each in duplicate. Curve colour of the larval samples is automatically determined based on the clustering of melt curves to the O. volvulus (green) and O. ochengi (red) adult samples. c The same samples are presented as in ( b ), showing HRM difference curves, which accentuate differences between the melt curve clusters in ( b ), normalised to the O. ochengi cluster. d Representative RFLP analysis of amplicons generated in the HRM assay for each species, showing digestion of the O. volvulus sequence, but not the O. ochengi sequence, with ApaI
    Figure Legend Snippet: Genetic discrimination of O. volvulus and O. ochengi . a Sequence of the PCR 79-bp amplicon used to discriminate between O. volvulus and O. ochengi . Nucleotide differences between the two species are highlighted in bold, and the ApaI restriction site present in the O. volvulus sequence is underlined. b Normalised HRM melt curves from cloned positive control 79-bp products (pGem_Ov and pGem_Oo), adult O. volvulus and O. ochengi DNA, and 4 larvae samples from both species, each in duplicate. Curve colour of the larval samples is automatically determined based on the clustering of melt curves to the O. volvulus (green) and O. ochengi (red) adult samples. c The same samples are presented as in ( b ), showing HRM difference curves, which accentuate differences between the melt curve clusters in ( b ), normalised to the O. ochengi cluster. d Representative RFLP analysis of amplicons generated in the HRM assay for each species, showing digestion of the O. volvulus sequence, but not the O. ochengi sequence, with ApaI

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, Clone Assay, Positive Control, Generated, HRM Assay

    4) Product Images from "Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction"

    Article Title: Lack of association between glutathione peroxidase1 (GPx1) activity, Pro198Leu polymorphism and stenosis of coronary arteries: A population-based prediction

    Journal: Meta Gene

    doi: 10.1016/j.mgene.2014.09.007

    Digestion of PCR product. The PCR products were digested with ApaI and were run on gel (3%). A; TT Homozygote (undigested fragment 1195 bp). B; CT Heterozygote (undigested and digested fragments 1195 bp, 1131 bp and 64 bp). C; CC Homozygote (digested fragments 1131 bp and 64 bp).
    Figure Legend Snippet: Digestion of PCR product. The PCR products were digested with ApaI and were run on gel (3%). A; TT Homozygote (undigested fragment 1195 bp). B; CT Heterozygote (undigested and digested fragments 1195 bp, 1131 bp and 64 bp). C; CC Homozygote (digested fragments 1131 bp and 64 bp).

    Techniques Used: Polymerase Chain Reaction

    5) Product Images from "Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection"

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection

    Journal: Virulence

    doi: 10.1080/21505594.2015.1112491

    CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.
    Figure Legend Snippet: CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.

    Techniques Used: Amplification

    6) Product Images from "Basement membrane collagen IV: Isolation of functional domains"

    Article Title: Basement membrane collagen IV: Isolation of functional domains

    Journal: Methods in cell biology

    doi: 10.1016/bs.mcb.2017.08.010

    Expression of recombinant α1–α6 NC1 domains. (A) Map of the pRc-X expression vector showing positions of BM40 signal peptide, FLAG tag and NheI, ApaI/SacII sites used for cloning human NC1 domains. (B) SDS-PAGE of purified α1–α6 NC1 proteins (2 µg/lane). Small variations of MW are due to the presence of short additional Gly-X-Y repeats from collagenous domain in the α1, α3, α4, and α5 NC1s.
    Figure Legend Snippet: Expression of recombinant α1–α6 NC1 domains. (A) Map of the pRc-X expression vector showing positions of BM40 signal peptide, FLAG tag and NheI, ApaI/SacII sites used for cloning human NC1 domains. (B) SDS-PAGE of purified α1–α6 NC1 proteins (2 µg/lane). Small variations of MW are due to the presence of short additional Gly-X-Y repeats from collagenous domain in the α1, α3, α4, and α5 NC1s.

    Techniques Used: Expressing, Recombinant, Plasmid Preparation, FLAG-tag, Clone Assay, SDS Page, Purification

    Related Articles

    Diagnostic Assay:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software. .. Western blotting analysis .

    Clone Assay:

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: The landscape of structure derived from inactive ΔEMCV IRES sequence was cloned upstream of Rluc gene in the upstream hairpin (uphp) bicistronic plasmid ( ). .. For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc.

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: Paragraph title: Cloning ... YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites.

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc. .. Cell lines and Transfection HeLa S3 cells were maintained in DMEM (Invitrogen) with 10% fetal bovine serum (GIBCO, Invitrogen).

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: The PCR product was then cloned into pTKP003-CFP to replace the CFP-encoding gene with mRFPmars. .. Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation.

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: Paragraph title: Cloning, Cell Culture, Transfection, Real-Time PCR and Analysis. ... The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega).

    Amplification:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: Briefly, the regions around the mutation site in the MT-TL1 gene, were PCR amplified using mtDNA-specific primer pairs: F 5´- GTTCGTTTGTTCAACGATT −3´; R 5´- GGTAAGATTACCGTTACCG −3´, with addition of [α- P]dCTP (Hartmann Analytic, SRF205/09.25) in the last synthesis cycle. .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software.

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. Intragenic regions of six virulence genes ( clpP , dal , inlB , inlC , lisR , and prfA ) were amplified, resolved, purified, and sequenced as previously described ( ).

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc. .. Coxsackievirus 2A protease gene was amplified from CVB3 cDNA (a generous gift from Nora Chapman, Nebraska) using the primers with BamH1 and EcoR1 sites respectively and cloned in pCDN3.1 His C (pCD2Apro ).

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Using appropriate primers obtained DNA products were amplified for ApaI (Foward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65 °C annealing temperature), BsmI (Forward: 5’ CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and Reverse: 5’ AACCAGCGGGAAGAGGTCAAGGG 3 ‘with 65 °C as an annealing temperature), FokI (Forward: 5’ AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and Reverse: 5’ ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 67 °C annealing temperature), and TaqI (Forward: 5’ CAGAGCATGGACAGGGAGCAAG 3′ and Reverse: 5’GCAACTCCTCATGGCTGAGGTCTCA 3′ at an annealing temperature of 65 °C) VDR polymorphisms. .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively. .. Amplification conditions start with an initial denaturation step of 5 min at 94 °C, followed by 30 cycles of 30 sec denaturation (94 °C), 20 sec annealing (62 °C) and 30 sec extension (72 °C), ended by a final extension for 5 min (72 °C) and finally cooling to 4°C.

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: For each sample, triplicate duplexed ddPCR reactions were prepared that contained 5 µl of sample extract, 12.5 µl of 2X ddPCR Supermix for probes (BioRad #186-3024), 2 µl Internal Amplification Control (IAC), 900 nM of forward and reverse primers, and 250 nM of each of 16S rRNA gene and IAC probe in 25 µl. .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions.

    Transduction:

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The plasmid was then transferred into S. aureus SH1000 by Φ11 transduction and transductants were verified by fluorescence microscopy.

    Construct:

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: Paragraph title: Plasmid constructs ... For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc.

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: Paragraph title: Plasmid constructs ... For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc.

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends. .. The construct for expression of GFP-TOPBP1 Δcentral (deleted aa 526–1,000) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes Bpu1102I and Eco32I followed by ligation with annealed oligos RTP41 (5′-TGAGCCCTTGAATGATTCTACT-3′) and RTP42 (5′-AGTAGAATCATTCAAGGGC-3′).

    SYBR Green Assay:

    Article Title: Human Amniotic Epithelial Cells are Reprogrammed More Efficiently by Induced Pluripotency than Adult Fibroblasts
    Article Snippet: Briefly, PCR was performed in an end volume of 20 μL, containing 10 μL SYBR Green Mastermix (Applied Biosystems) and 250 nM of both primers. .. The amplicons were digested with 5 μL of ApaI (New England BioLabs: R0114S) overnight at 37°C.

    Incubation:

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Luciferase:

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: All the bicistronic constructs contain respective 5′UTR sequences (pRIRF2F, pRHAVF and pRBipF) cloned between Renilla luciferase (RLuc) and firefly luciferase (FLuc) genes, in pCDNA 3.1 in between HindIII and EcoRI sites. .. For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc.

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: Plasmid constructs The bicistronic constructs containing respective 5′UTR sequences of full length IRF2 (NCBI accession number NM_002199) and 3′ deletion IRF2 (pRΔEIRF2F, pRΔEmIRF2F) were cloned downstream of the landscape of structure derived form the inactive part of ΔEMCV IRES sequence between Renilla luciferase (RLuc) and Firefly luciferase (FLuc) genes, in HindIII and EcoRI sites. .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc.

    Expressing:

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The resulting plasmid, pTKP005-RFP, was introduced into S. aureus RN4220 by electroporation, resulting in transformants expressing mRFPmars (verified by fluorescence microscopy).

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: .. The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega). .. This bovine PRKG2 vector was then mutated to contain the PRKG2 exon 15 R678X mutation by site-directed mutagenesis using the QuikChange II kit (Stratagene).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends. .. The construct for expression of GFP-TOPBP1 Δcentral (deleted aa 526–1,000) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes Bpu1102I and Eco32I followed by ligation with annealed oligos RTP41 (5′-TGAGCCCTTGAATGATTCTACT-3′) and RTP42 (5′-AGTAGAATCATTCAAGGGC-3′).

    Modification:

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: The IAC consisted of modified version of the inhibition control described in Fout et al . .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions.

    Derivative Assay:

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: The landscape of structure derived from inactive ΔEMCV IRES sequence was cloned upstream of Rluc gene in the upstream hairpin (uphp) bicistronic plasmid ( ). .. For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc.

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: Plasmid constructs The bicistronic constructs containing respective 5′UTR sequences of full length IRF2 (NCBI accession number NM_002199) and 3′ deletion IRF2 (pRΔEIRF2F, pRΔEmIRF2F) were cloned downstream of the landscape of structure derived form the inactive part of ΔEMCV IRES sequence between Renilla luciferase (RLuc) and Firefly luciferase (FLuc) genes, in HindIII and EcoRI sites. .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc.

    Electroporation:

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The resulting plasmid, pTKP005-RFP, was introduced into S. aureus RN4220 by electroporation, resulting in transformants expressing mRFPmars (verified by fluorescence microscopy).

    Transfection:

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: Paragraph title: Cloning, Cell Culture, Transfection, Real-Time PCR and Analysis. ... The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: Plasmids Plasmid transfections were performed using FuGENE 6 (Roche) according to the manufacturer’s instructions. .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends.

    Ligation:

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: .. Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The resulting plasmid, pTKP005-RFP, was introduced into S. aureus RN4220 by electroporation, resulting in transformants expressing mRFPmars (verified by fluorescence microscopy).

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: .. The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega). .. This bovine PRKG2 vector was then mutated to contain the PRKG2 exon 15 R678X mutation by site-directed mutagenesis using the QuikChange II kit (Stratagene).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends. .. The construct for expression of GFP-TOPBP1 Δcentral (deleted aa 526–1,000) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes Bpu1102I and Eco32I followed by ligation with annealed oligos RTP41 (5′-TGAGCCCTTGAATGATTCTACT-3′) and RTP42 (5′-AGTAGAATCATTCAAGGGC-3′).

    Cell Culture:

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: Paragraph title: Cloning, Cell Culture, Transfection, Real-Time PCR and Analysis. ... The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega).

    Digital PCR:

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: Paragraph title: Droplet digital PCR (ddPCR) ... The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions.

    Generated:

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc. .. Cell lines and Transfection HeLa S3 cells were maintained in DMEM (Invitrogen) with 10% fetal bovine serum (GIBCO, Invitrogen).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends. .. The construct for expression of GFP-TOPBP1 Δcentral (deleted aa 526–1,000) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes Bpu1102I and Eco32I followed by ligation with annealed oligos RTP41 (5′-TGAGCCCTTGAATGATTCTACT-3′) and RTP42 (5′-AGTAGAATCATTCAAGGGC-3′).

    Inhibition:

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions. .. IAC primer and probe sequences were modified from Fout et al . to increase amplification efficiency (forward primer GCAAGCCCCAGAAACCG; reverse primer CAAGATGACCGGGATTTACGA; probe VIC-TCACCCATCCACCACCT-MGBFQ).

    Gel Extraction:

    Article Title: Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium
    Article Snippet: .. Trizol (Life Technologies, catalog number: 15596018) Platinum Taq DNA Polymerase High Fidelity (Life Technologies, catalog number: 11304-011) pLG66a ( ) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706) Agarose (Lonza, catalog number: 50004) Ethidium bromide, 1% solution (Fisher BioReagents, catalog number: BP1302-10) pTP163 (suicide KO plasmid; ) LB broth (Fisher BioReagents, catalog number: BP1426-2) Glycerol (Fisher BioReagents, catalog number: BP2291) Bacto agar (Becton Dickinson, catalog number: 214010) Hygromycin B solution (50 mg/ml) (Corning, catalog number: 30-240-CR) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106) Apa I restriction endonuclease (New England Biolabs, catalog number: R0114L) Antarctic Phosphatase (New England Biolabs, catalog number: M0289S) T4 DNA ligase (New England Biolabs, catalog number: M0202S) NEB-10 beta chemically competent E. coli (New England Biolabs, catalog number: C3019I) Kanamycin monosulfate (MP Biomedicals, catalog number: 194531) GoTaq Green Master Mix (Promega Corporation, catalog number: M7128-C) Molecular Biology Grade Water, DNase-, RNase-, and Protease-free (Corning, catalog number: 46-000-CM) E. coli strain S17-1 ( ; generous gift from Drs. Michael Norgard and Greg Robertson, U.T. .. Southwestern Medical Center, Dallas, TX) Calcium chloride dehydrate (Fisher BioReagents, catalog number: BP510-100) Mueller Hinton Broth powder (Becton Dickinson, catalog number: 211443) Tryptone (Fisher BioReagents, catalog number: BP1421-500) Sodium chloride (Fisher BioReagents, catalog number: BP358-212) IsoVitaleX Enrichment (BD, catalog number: 211876) Glucose (Fisher BioReagents, catalog number: BP350-1) Iron(III) pyrophosphate (Sigma-Aldrich, catalog number: P6526-100G) Phosphate-buffered saline (PBS) 1×, without calcium and magnesium (Corning, Mediatech, catalog number: 21040CV) Membrane filters, 0.025 μm, 25 mm (EMD Millipore, catalog number: VSWP02500) Hemoglobin powder (Neogen Acumedia, catalog number: 7195) Polymyxin B sulfate (MP Biomedicals, catalog number: 100565) Magnesium chloride hexahydrate (Fisher BioReagents, catalog number: BP214-500) D-Sucrose (Fisher BioReagents, catalog number: BP220-212) Sodium hydroxide (Fisher BioReagents, catalog number: BP359-500) LB broth (see Recipes) LB agar (see Recipes) Supplemented Mueller Hinton Broth (sMHB) (see Recipes) Supplemented Mueller Hinton Agar (sMHA) (see Recipes) Chocolate agar plates containing hygromycin and polymyxin B (see Recipes) sMHA containing 10 mg/L kanamycin and 8% sucrose (sMHA-kan10-suc) (see Recipes)

    Sequencing:

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: The landscape of structure derived from inactive ΔEMCV IRES sequence was cloned upstream of Rluc gene in the upstream hairpin (uphp) bicistronic plasmid ( ). .. For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc.

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites. .. DNA sequences were confirmed using Sanger sequencing (BigDye terminator kit) and resolved with Automatic Sequencer 3730XL (Applied Biosystems, Foster City, CA, USA) in Macrogen (Rockville, MD, USA).

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: Plasmid constructs The bicistronic constructs containing respective 5′UTR sequences of full length IRF2 (NCBI accession number NM_002199) and 3′ deletion IRF2 (pRΔEIRF2F, pRΔEmIRF2F) were cloned downstream of the landscape of structure derived form the inactive part of ΔEMCV IRES sequence between Renilla luciferase (RLuc) and Firefly luciferase (FLuc) genes, in HindIII and EcoRI sites. .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc.

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega). .. The resulting vectors were verified using restriction fragment length polymorphism (RFLP) and DNA sequence analysis.

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: To generate siRNA-insensitive GFP-TOPBP1* mutants, silent mutations were introduced into the siTOPBP1#3 target sequence in the TOPBP1 coding region of the pEGFP-C1-hTOPBP1 plasmid using the QuikChange II Site-Directed Mutagenesis kit (Stratagene). .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends.

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions. .. IAC primer and probe sequences were modified from Fout et al . to increase amplification efficiency (forward primer GCAAGCCCCAGAAACCG; reverse primer CAAGATGACCGGGATTTACGA; probe VIC-TCACCCATCCACCACCT-MGBFQ).

    DNA Extraction:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Paragraph title: DNA Extraction and Genotyping ... Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively.

    Screening Assay:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: Ruminant isolates were also analyzed with an mSNP typing screening assay able to identify five ECs (ECI, ECII, ECIII, ECIV, and ECV) of L. monocytogenes ( ). .. PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ).

    Fluorescence:

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: Cloning For bimolecular fluorescence complementation (BiFC) stefin B gene (C3E31) (NM_000100.2) was inserted in a pcDNA4 vector (V1020-20, Invitrogen, Carlsbad, CA, USA) via XhoI and XbaI (R0146S and R0145S, New England Biolabs, Ipswich, MA, USA) restriction sites. .. YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites.

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: Paragraph title: Construction of bacterial RFP fluorescence reporter ... Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation.

    Mutagenesis:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: Briefly, the regions around the mutation site in the MT-TL1 gene, were PCR amplified using mtDNA-specific primer pairs: F 5´- GTTCGTTTGTTCAACGATT −3´; R 5´- GGTAAGATTACCGTTACCG −3´, with addition of [α- P]dCTP (Hartmann Analytic, SRF205/09.25) in the last synthesis cycle. .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software.

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites. .. For the design of the G4R mutant the following primers were used: 5′-CGAGGTCATGATGTGCCGGGCGCCCTCCGCCAC-3' and 5' GTGGCGGAGGGCGCCCGGCACATCATGACCTCG-3'.

    Article Title: Human Amniotic Epithelial Cells are Reprogrammed More Efficiently by Induced Pluripotency than Adult Fibroblasts
    Article Snippet: A point mutation at A3243G of mitochondria DNA (mtDNA) was evaluated by non-gel-based PCR-restriction fragment analyses employing melting temperature characteristics of the fragments (PCR-RFMT) with previously published primers and the protocol (Jahangir Tafrechi et al., ). .. The amplicons were digested with 5 μL of ApaI (New England BioLabs: R0114S) overnight at 37°C.

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega). .. This bovine PRKG2 vector was then mutated to contain the PRKG2 exon 15 R678X mutation by site-directed mutagenesis using the QuikChange II kit (Stratagene).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: To generate siRNA-insensitive GFP-TOPBP1* mutants, silent mutations were introduced into the siTOPBP1#3 target sequence in the TOPBP1 coding region of the pEGFP-C1-hTOPBP1 plasmid using the QuikChange II Site-Directed Mutagenesis kit (Stratagene). .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends.

    Isolation:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. PFGE profiles were subsequently compared with a set of 311 well-characterized L. monocytogenes strains isolated from environmental, food, and human clinical samples ( ).

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: Droplet digital PCR (ddPCR) DNA was isolated from 6 dpf and 10 dpf axenic, conventionalized, and conventionally colonized larvae using the ZR-Duet DNA/RNA MiniPrep Plus Kit (Zymo Research #D7003) according to the manufacturer’s protocol. .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions.

    Bimolecular Fluorescence Complementation Assay:

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: Cloning For bimolecular fluorescence complementation (BiFC) stefin B gene (C3E31) (NM_000100.2) was inserted in a pcDNA4 vector (V1020-20, Invitrogen, Carlsbad, CA, USA) via XhoI and XbaI (R0146S and R0145S, New England Biolabs, Ipswich, MA, USA) restriction sites. .. YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites.

    Size-exclusion Chromatography:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively. .. Amplification conditions start with an initial denaturation step of 5 min at 94 °C, followed by 30 cycles of 30 sec denaturation (94 °C), 20 sec annealing (62 °C) and 30 sec extension (72 °C), ended by a final extension for 5 min (72 °C) and finally cooling to 4°C.

    Labeling:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software. .. Western blotting analysis .

    Purification:

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ). .. Intragenic regions of six virulence genes ( clpP , dal , inlB , inlC , lisR , and prfA ) were amplified, resolved, purified, and sequenced as previously described ( ).

    Article Title: Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium
    Article Snippet: .. Trizol (Life Technologies, catalog number: 15596018) Platinum Taq DNA Polymerase High Fidelity (Life Technologies, catalog number: 11304-011) pLG66a ( ) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706) Agarose (Lonza, catalog number: 50004) Ethidium bromide, 1% solution (Fisher BioReagents, catalog number: BP1302-10) pTP163 (suicide KO plasmid; ) LB broth (Fisher BioReagents, catalog number: BP1426-2) Glycerol (Fisher BioReagents, catalog number: BP2291) Bacto agar (Becton Dickinson, catalog number: 214010) Hygromycin B solution (50 mg/ml) (Corning, catalog number: 30-240-CR) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106) Apa I restriction endonuclease (New England Biolabs, catalog number: R0114L) Antarctic Phosphatase (New England Biolabs, catalog number: M0289S) T4 DNA ligase (New England Biolabs, catalog number: M0202S) NEB-10 beta chemically competent E. coli (New England Biolabs, catalog number: C3019I) Kanamycin monosulfate (MP Biomedicals, catalog number: 194531) GoTaq Green Master Mix (Promega Corporation, catalog number: M7128-C) Molecular Biology Grade Water, DNase-, RNase-, and Protease-free (Corning, catalog number: 46-000-CM) E. coli strain S17-1 ( ; generous gift from Drs. Michael Norgard and Greg Robertson, U.T. .. Southwestern Medical Center, Dallas, TX) Calcium chloride dehydrate (Fisher BioReagents, catalog number: BP510-100) Mueller Hinton Broth powder (Becton Dickinson, catalog number: 211443) Tryptone (Fisher BioReagents, catalog number: BP1421-500) Sodium chloride (Fisher BioReagents, catalog number: BP358-212) IsoVitaleX Enrichment (BD, catalog number: 211876) Glucose (Fisher BioReagents, catalog number: BP350-1) Iron(III) pyrophosphate (Sigma-Aldrich, catalog number: P6526-100G) Phosphate-buffered saline (PBS) 1×, without calcium and magnesium (Corning, Mediatech, catalog number: 21040CV) Membrane filters, 0.025 μm, 25 mm (EMD Millipore, catalog number: VSWP02500) Hemoglobin powder (Neogen Acumedia, catalog number: 7195) Polymyxin B sulfate (MP Biomedicals, catalog number: 100565) Magnesium chloride hexahydrate (Fisher BioReagents, catalog number: BP214-500) D-Sucrose (Fisher BioReagents, catalog number: BP220-212) Sodium hydroxide (Fisher BioReagents, catalog number: BP359-500) LB broth (see Recipes) LB agar (see Recipes) Supplemented Mueller Hinton Broth (sMHB) (see Recipes) Supplemented Mueller Hinton Agar (sMHA) (see Recipes) Chocolate agar plates containing hygromycin and polymyxin B (see Recipes) sMHA containing 10 mg/L kanamycin and 8% sucrose (sMHA-kan10-suc) (see Recipes)

    Polymerase Chain Reaction:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software. .. Western blotting analysis .

    Article Title: Ruminant Rhombencephalitis-Associated Listeria monocytogenes Strains Constitute a Genetically Homogeneous Group Related to Human Outbreak Strains
    Article Snippet: Paragraph title: Duplex PCR, mSNP typing, PFGE, and MVLST. ... PFGE was performed by including genomic DNA in agarose plugs prior to digestion with the AscI and ApaI restriction enzymes (New England BioLabs), followed by PFGE with a Chef DR III system (Bio-Rad, Hercules, CA) , and pulsotypes were analyzed as described elsewhere ( ).

    Article Title: Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium
    Article Snippet: .. Trizol (Life Technologies, catalog number: 15596018) Platinum Taq DNA Polymerase High Fidelity (Life Technologies, catalog number: 11304-011) pLG66a ( ) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706) Agarose (Lonza, catalog number: 50004) Ethidium bromide, 1% solution (Fisher BioReagents, catalog number: BP1302-10) pTP163 (suicide KO plasmid; ) LB broth (Fisher BioReagents, catalog number: BP1426-2) Glycerol (Fisher BioReagents, catalog number: BP2291) Bacto agar (Becton Dickinson, catalog number: 214010) Hygromycin B solution (50 mg/ml) (Corning, catalog number: 30-240-CR) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106) Apa I restriction endonuclease (New England Biolabs, catalog number: R0114L) Antarctic Phosphatase (New England Biolabs, catalog number: M0289S) T4 DNA ligase (New England Biolabs, catalog number: M0202S) NEB-10 beta chemically competent E. coli (New England Biolabs, catalog number: C3019I) Kanamycin monosulfate (MP Biomedicals, catalog number: 194531) GoTaq Green Master Mix (Promega Corporation, catalog number: M7128-C) Molecular Biology Grade Water, DNase-, RNase-, and Protease-free (Corning, catalog number: 46-000-CM) E. coli strain S17-1 ( ; generous gift from Drs. Michael Norgard and Greg Robertson, U.T. .. Southwestern Medical Center, Dallas, TX) Calcium chloride dehydrate (Fisher BioReagents, catalog number: BP510-100) Mueller Hinton Broth powder (Becton Dickinson, catalog number: 211443) Tryptone (Fisher BioReagents, catalog number: BP1421-500) Sodium chloride (Fisher BioReagents, catalog number: BP358-212) IsoVitaleX Enrichment (BD, catalog number: 211876) Glucose (Fisher BioReagents, catalog number: BP350-1) Iron(III) pyrophosphate (Sigma-Aldrich, catalog number: P6526-100G) Phosphate-buffered saline (PBS) 1×, without calcium and magnesium (Corning, Mediatech, catalog number: 21040CV) Membrane filters, 0.025 μm, 25 mm (EMD Millipore, catalog number: VSWP02500) Hemoglobin powder (Neogen Acumedia, catalog number: 7195) Polymyxin B sulfate (MP Biomedicals, catalog number: 100565) Magnesium chloride hexahydrate (Fisher BioReagents, catalog number: BP214-500) D-Sucrose (Fisher BioReagents, catalog number: BP220-212) Sodium hydroxide (Fisher BioReagents, catalog number: BP359-500) LB broth (see Recipes) LB agar (see Recipes) Supplemented Mueller Hinton Broth (sMHB) (see Recipes) Supplemented Mueller Hinton Agar (sMHA) (see Recipes) Chocolate agar plates containing hygromycin and polymyxin B (see Recipes) sMHA containing 10 mg/L kanamycin and 8% sucrose (sMHA-kan10-suc) (see Recipes)

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: .. Briefly, the PCR products of VDR were digested with the two restriction enzymes ApaI and TaqI at 37 °C overnight. .. DNA fragments were subjected to 8% polyacrylamide gel elect-rphoresis and stained with Silver Nitrate.

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: The PCR product was then cloned into pTKP003-CFP to replace the CFP-encoding gene with mRFPmars. .. Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol. .. Digestions for BsmI and TaqI were at 65 °C left overnight, and 3 h at 25 °C for ApaI , while FokI was incubated at 37 °C for 3 h. Restricted products were electrophoresed on either 10% polyacrylamide or 1.5% agarose gels and then visualized by the Gel Doc TM EZ imager (Bio-Rad systems, USA).

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Genotyping of the VDR polymorphisms were performed using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. .. Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively.

    Microscopy:

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The resulting plasmid, pTKP005-RFP, was introduced into S. aureus RN4220 by electroporation, resulting in transformants expressing mRFPmars (verified by fluorescence microscopy).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software. .. Western blotting analysis .

    Salting Out:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: DNA Extraction and Genotyping Genomic DNA was extracted using the salting out method from 5 ml of peripheral blood samples which collected in tubes containing 200 µl EDTA (0.5 M), as an anti-clotting factor, and stored at -20°C until DNA extraction. .. Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively.

    Plasmid Preparation:

    Article Title: Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium
    Article Snippet: .. Trizol (Life Technologies, catalog number: 15596018) Platinum Taq DNA Polymerase High Fidelity (Life Technologies, catalog number: 11304-011) pLG66a ( ) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706) Agarose (Lonza, catalog number: 50004) Ethidium bromide, 1% solution (Fisher BioReagents, catalog number: BP1302-10) pTP163 (suicide KO plasmid; ) LB broth (Fisher BioReagents, catalog number: BP1426-2) Glycerol (Fisher BioReagents, catalog number: BP2291) Bacto agar (Becton Dickinson, catalog number: 214010) Hygromycin B solution (50 mg/ml) (Corning, catalog number: 30-240-CR) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106) Apa I restriction endonuclease (New England Biolabs, catalog number: R0114L) Antarctic Phosphatase (New England Biolabs, catalog number: M0289S) T4 DNA ligase (New England Biolabs, catalog number: M0202S) NEB-10 beta chemically competent E. coli (New England Biolabs, catalog number: C3019I) Kanamycin monosulfate (MP Biomedicals, catalog number: 194531) GoTaq Green Master Mix (Promega Corporation, catalog number: M7128-C) Molecular Biology Grade Water, DNase-, RNase-, and Protease-free (Corning, catalog number: 46-000-CM) E. coli strain S17-1 ( ; generous gift from Drs. Michael Norgard and Greg Robertson, U.T. .. Southwestern Medical Center, Dallas, TX) Calcium chloride dehydrate (Fisher BioReagents, catalog number: BP510-100) Mueller Hinton Broth powder (Becton Dickinson, catalog number: 211443) Tryptone (Fisher BioReagents, catalog number: BP1421-500) Sodium chloride (Fisher BioReagents, catalog number: BP358-212) IsoVitaleX Enrichment (BD, catalog number: 211876) Glucose (Fisher BioReagents, catalog number: BP350-1) Iron(III) pyrophosphate (Sigma-Aldrich, catalog number: P6526-100G) Phosphate-buffered saline (PBS) 1×, without calcium and magnesium (Corning, Mediatech, catalog number: 21040CV) Membrane filters, 0.025 μm, 25 mm (EMD Millipore, catalog number: VSWP02500) Hemoglobin powder (Neogen Acumedia, catalog number: 7195) Polymyxin B sulfate (MP Biomedicals, catalog number: 100565) Magnesium chloride hexahydrate (Fisher BioReagents, catalog number: BP214-500) D-Sucrose (Fisher BioReagents, catalog number: BP220-212) Sodium hydroxide (Fisher BioReagents, catalog number: BP359-500) LB broth (see Recipes) LB agar (see Recipes) Supplemented Mueller Hinton Broth (sMHB) (see Recipes) Supplemented Mueller Hinton Agar (sMHA) (see Recipes) Chocolate agar plates containing hygromycin and polymyxin B (see Recipes) sMHA containing 10 mg/L kanamycin and 8% sucrose (sMHA-kan10-suc) (see Recipes)

    Article Title: Translational control of the interferon regulatory factor 2 mRNA by IRES element
    Article Snippet: .. For constructing IRF2 monocistronic plasmid (pIRF2Fluc), IRF2-Fluc was digested with HindIII and ApaI enzymes (NEB) from the plasmid pRIRF2F and ligated in HindIII, ApaI digested pCDNA 3.1-Fluc. .. Coxsackievirus 2A protease gene was amplified from CVB3 cDNA (a generous gift from Nora Chapman, Nebraska) using the primers with BamH1 and EcoR1 sites respectively and cloned in pCDN3.1 His C (pCD2Apro ).

    Article Title: Human Stefin B Role in Cell's Response to Misfolded Proteins and Autophagy
    Article Snippet: Cloning For bimolecular fluorescence complementation (BiFC) stefin B gene (C3E31) (NM_000100.2) was inserted in a pcDNA4 vector (V1020-20, Invitrogen, Carlsbad, CA, USA) via XhoI and XbaI (R0146S and R0145S, New England Biolabs, Ipswich, MA, USA) restriction sites. .. YFP halves were inserted via XbaI and ApaI (R0114S, New England Biolabs) restriction sites.

    Article Title: Role of Polypyrimidine Tract Binding Protein in Mediating Internal Initiation of Translation of Interferon Regulatory Factor 2 RNA
    Article Snippet: .. For constructing IRF2 monocistronic plasmid pIRF2Fluc and mIRF2Luc were generated from respective bicistronic plasmids by releasing out the insert IRF2 Fluc by HindIII and ApaI enzymes (NEB) and cloned in pCDNA 3.1- Fluc. .. Cell lines and Transfection HeLa S3 cells were maintained in DMEM (Invitrogen) with 10% fetal bovine serum (GIBCO, Invitrogen).

    Article Title: Intracellular Staphylococcus aureus eludes selective autophagy by activating a host cell kinase
    Article Snippet: .. Inserts and the plasmid were restriction-digested using ApaI (New England Bioloabs, R0114S) and EcoRI (New England Bioloabs, R3101S) prior to ligation. .. The resulting plasmid, pTKP005-RFP, was introduced into S. aureus RN4220 by electroporation, resulting in transformants expressing mRFPmars (verified by fluorescence microscopy).

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: .. The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega). .. This bovine PRKG2 vector was then mutated to contain the PRKG2 exon 15 R678X mutation by site-directed mutagenesis using the QuikChange II kit (Stratagene).

    Article Title: TOPBP1 regulates RAD51 phosphorylation and chromatin loading and determines PARP inhibitor sensitivity
    Article Snippet: To generate siRNA-insensitive GFP-TOPBP1* mutants, silent mutations were introduced into the siTOPBP1#3 target sequence in the TOPBP1 coding region of the pEGFP-C1-hTOPBP1 plasmid using the QuikChange II Site-Directed Mutagenesis kit (Stratagene). .. The construct for expression of GFP-TOPBP1 ΔN (deleted aa 1–519) was generated by double digestion of pEGFP-C1-hTopBP1 with restriction enzymes ApaI and Bpu1102I followed by blunting by mung bean nuclease (New England Biolabs) and ligation of the blunted ends.

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions. .. IAC primer and probe sequences were modified from Fout et al . to increase amplification efficiency (forward primer GCAAGCCCCAGAAACCG; reverse primer CAAGATGACCGGGATTTACGA; probe VIC-TCACCCATCCACCACCT-MGBFQ).

    Software:

    Article Title: Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA
    Article Snippet: .. Labeled PCR products were then digested with the restriction enzyme, diagnostic for the site polymorphisms created by the mutations ( Apa I) (New England Biolabs, R0114S), and products of replicate digestions were separated by polyacrylamide gel electrophoresis and phosphoimages were analyzed with Ge l -Pro Analyzer software. .. Western blotting analysis .

    Real-time Polymerase Chain Reaction:

    Article Title: A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle
    Article Snippet: Paragraph title: Cloning, Cell Culture, Transfection, Real-Time PCR and Analysis. ... The insert was then shuttled to the pcDNA3 expression vector (Invitrogen) by digestion with XbaI and ApaI restriction enzymes (New England Biolabs) followed by ligation with T4 ligase (Promega).

    Agarose Gel Electrophoresis:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively. .. All PCR products were subjected to electrophoresis on 1.5% agarose gel prepared in 1× TAE, stained with ethidium bromide and visualized by exposure to ultraviolet light.

    Electrophoresis:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively. .. All PCR products were subjected to electrophoresis on 1.5% agarose gel prepared in 1× TAE, stained with ethidium bromide and visualized by exposure to ultraviolet light.

    Point Mutation Assay:

    Article Title: Human Amniotic Epithelial Cells are Reprogrammed More Efficiently by Induced Pluripotency than Adult Fibroblasts
    Article Snippet: Paragraph title: Mitochondria DNA point mutation assay ... The amplicons were digested with 5 μL of ApaI (New England BioLabs: R0114S) overnight at 37°C.

    DNA Purification:

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA). .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Article Title: Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney disease
    Article Snippet: Genotyping DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA). .. The PCR products were then digested with enzymes ApaI, BsmI, FokI, and TaqI (New England Biolabs, Beverly, MA, USA) according to the supplier’s protocol.

    Gene Assay:

    Article Title: Microbial colonization is required for normal neurobehavioral development in zebrafish
    Article Snippet: The 16S rRNA gene assay previously described was applied (forward primer CGGTGAATACGTTCYCGG; reverse primer AAGGAGGTGATCCRGCCGCA; probe FAM-CTTGTACACACCGCCCG-Iowa Black Fluorescent Quencher). .. The amplifiable sequence from the inhibition control was inserted into a custom minigene (Integrated DNA Technologies) via a pIDTSMART-AMP vector and linearized with ApaI restriction enzyme (New England BioLabs, Inc., #R0114S), according to the manufacturer’s instructions.

    Staining:

    Article Title: Vitamin D Receptor (VDR) Polymorphisms and Late-Onset Alzheimer’s Disease: An Association Study
    Article Snippet: Both ApaI (G > T) and TaqI (C > T) polymorphisms were assessed by a forward primer 5′- CCGGTCAGCAGTCATAGAGG -3′ and reverse primer 5′-GAATGGGCTGGGTGGA-TAG-3′, followed by digestion with the restriction enzymes ApaI and TaqI (New England BioLabs, USA), respectively. .. All PCR products were subjected to electrophoresis on 1.5% agarose gel prepared in 1× TAE, stained with ethidium bromide and visualized by exposure to ultraviolet light.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs apai
    Apai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apai/product/New England Biolabs
    Average 90 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    apai - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results