bstxi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BstXI
    Description:
    BstXI 5 000 units
    Catalog Number:
    R0113L
    Price:
    277
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs bstxi
    BstXI
    BstXI 5 000 units
    https://www.bioz.com/result/bstxi/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    bstxi - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and cloning ... Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs). .. For multiplexing experiments, we also cloned a dual sgRNA vector to otherwise reduce false positives in bulk measurements (e.g., ELISA).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: The full-length Fig4 cDNA was previously cloned downstream of the chicken β-actin (CAG) promoter ( ). .. The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Amplification:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: One testis per mouse was used for cytology and the second was reserved for DNA extraction. .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. The wild-type sequence contains a Bst XI restriction site that is eliminated by the ketu mutation.

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and cloning ... Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc1 function in vivo
    Article Snippet: 2.4 The size and DNA sequence of the fusion genes present in cells grown photoheterotrophically were verified by restriction analyzes and DNA sequencing of plasmids isolated from R. capsulatus and amplified in E scherichia coli HB101. .. The double restriction digestion was performed with BstX I (New England Biolabs) and Sfu I (Roche Diagnostics) enzymes, yielding shorter DNA fragment (1950 bp) in case of cytochrome b gene or longer DNA fragment (3325 bp) for cytochrome bS b gene.

    Article Title: Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1
    Article Snippet: DNA sequencing was performed with the BigDye Terminator Cycle Sequencing Kit on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. For the c.3742G > A mutation, a 454 bp DNA fragment was amplified (forward: 5′-CGG CTG CCC TCA AAA TCC ACA T-3′; reverse: 5′-TGG CAG GTA AAG GCA TTG AGA CA-3′) and cut into 172 bp and 282 bp with BstXI (New England BioLabs Inc., Beverly, MA) at 37 °C for 4 h. For the c.6051+1G > A mutation, a 99 bp DNA fragment was amplified (forward: 5′-CCA CGG TGC CAG GGA AGG ATC-3′; reverse: 5′-CAA CGC TAG CTG TGC ACG AAG G-3′) and cut into 41 bp and 48 bp with ScrFI (New England BioLabs) at 37 °C for 4 h. Both mutations eliminated the respective restriction sites. .. Digested PCR products were run on 1.5% agarose gels.

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: Arm 1 (1,129 bp) was amplified from plasmid pLB574 (ref. ) using a digoxigenin-labelled primer. .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: A fragment containing the substitution c.1458G > C encoding the missense mutation p.Cys486Ser was amplified from the CAG- Fig4 construct using the forward primer 5′ GTGAT GCTTC TGTGA TGTCT TTTAC and a reverse primer containing the mutation (underlined): 5′ CCGTA GGAAG CTTGG TTGA G ACACC TGACA AACC. .. The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: Arm 1 (1129 bp) was PCR amplified from plasmid pRL574 using a digoxigenin-labeled primer. .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Synthesized:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. A guide RNA (target sequence 5′-AATAAAGGCTCTTTCCGTAC) was designed to target predicted exon 2 of Ythdc2 (NCBI Gene ID: 240255 and Ensembl Gene ID: ENSMUSG00000034653) and used for editing as described ( ).

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The CPD-containing DNA oligonucleotides were synthesized and purified using PAGE electrophoresis by Oligos Etc (Wilsonville, OR). .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    TA Cloning:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Purified DNA was ligated to the plasmid vector pCR® 2.1-TOPO® and used to transform One Shot® Mach1 ™ - T1® chemically competent cells using a Topo TA® cloning kit according to the manufacturer’s protocol (Invitrogen). .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Immunostaining:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: To screen for meiotic defects, spermatocyte squash preparation and immunostaining for SYCP3 and γH2AX (described below) were carried out using testes from pubertal G3 males that were ≥15 dpp or from adult G3 males. .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts).

    Electrophoresis:

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The CPD-containing DNA oligonucleotides were synthesized and purified using PAGE electrophoresis by Oligos Etc (Wilsonville, OR). .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Incubation:

    Article Title: Cip29 is phosphorylated following activation of the DNA damage response in Xenopus egg extracts
    Article Snippet: The reaction was stopped by the addition of lysis buffer (0.3M NaCl, 2mM Tris-HCl, pH 6.7, 10mM EDTA, 1% (w/v) SDS and 1 mg/ml proteinase K) and incubation at 65°C for 3 hours. .. Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB).

    Article Title: The Mre11/Rad50/Nbs1 complex functions in resection-based DNA end joining in Xenopus laevis
    Article Snippet: NHEJ reaction mixtures were incubated in lysis buffer [0.3 M NaCl, 2 mM Tris, pH 6.7 (HCl), 10 mM EDTA, 1% (w/v) SDS and 1 mg/ml proteinase K] at 65°C for 3 h. Following phenol/chloroform extraction, the DNA was ethanol precipitated, washed once with ethanol and dissolved in TE buffer. .. DNA was digested with 10 U BstXI enzyme (New England Biolabs) at 55°C for 3 h and 20 U Taq∝ I (New England Biolabs) at 65°C for 4 h and ethanol precipitated.

    Article Title: FlbD, a Myb Transcription Factor of Aspergillus nidulans, Is Uniquely Involved in both Asexual and Sexual Differentiation
    Article Snippet: The presence of the veA + allele was confirmed by PCR using genomic DNAs from selected progeny and the primers veA + forward and veA + reverse, with digestion of the PCR product with the BstXI enzyme (NEB, Ipswich, MA), as reported previously ( ). .. The presence of the veA + allele was confirmed by PCR using genomic DNAs from selected progeny and the primers veA + forward and veA + reverse, with digestion of the PCR product with the BstXI enzyme (NEB, Ipswich, MA), as reported previously ( ).

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: Finally, the plugs were incubated in 0.2% proteinase K (Gene Choice) buffer at 55°C for 2 days. .. To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902).

    Expressing:

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: Paragraph title: Mutagenesis of Fig4 cDNA and generation of expression constructs ... The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Article Title: Novel Model of Antigen-Specific Induction of Bile Duct Injury
    Article Snippet: The membrane-bound form of OVA consists of a fusion protein made up of the first 118 residues of the human transferrin receptor (including cytoplasmic tail and signal/anchor domain) linked to residues 139–385 of mature OVA, transferrin receptor-ova (TFR-OVA), targeting membrane expression of OVA on biliary epithelium. .. The 5′ flanking region of the ASBT gene was cut using BamHI and BstXI sites (all restriction enzymes from New England Biolabs, Ipswich, MA), resulting in a 3.0-kb fragment that was used in the ASBT-mOVA construct.

    Modification:

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs). .. This consists of two sgRNA cassettes in tandem driven by mouse U6 (mU6) and human U6 (hU6) promoters, respectively, and a co-expressed puromycin-p2A-BFP cloned into a pHR lentiviral vector.

    Transformation Assay:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Transformed clones were identified using white blue selection and inoculated into 10 ml Falcon tubes containing 3 ml of LB broth and 50 μg/ml kanamycin. .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Ligation reactions were transformed into chemically competent E. coli XL1-Blue (p STM3846 ) or Mach One E. coli (p STM3602 ; Invitrogen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Derivative Assay:

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: The V2 sequence (derived from AVPR2) was inserted in between GPCR and TEVp as primer overhangs via InFusion cloning. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: In brief, the anchoring segment was amplified from plasmid pRL574 and the unwinding segment was derived from 17 pseudo-repeats (or 17mer) of the 5s rRNA sequence . .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Gel Purification:

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: The insert was isolated from the plasmid backbone by agarose gel electrophoresis and gel purified using a QIAquick gel purification kit (Qiagen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Countercurrent Chromatography:

    Article Title: Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1
    Article Snippet: DNA sequencing was performed with the BigDye Terminator Cycle Sequencing Kit on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. For the c.3742G > A mutation, a 454 bp DNA fragment was amplified (forward: 5′-CGG CTG CCC TCA AAA TCC ACA T-3′; reverse: 5′-TGG CAG GTA AAG GCA TTG AGA CA-3′) and cut into 172 bp and 282 bp with BstXI (New England BioLabs Inc., Beverly, MA) at 37 °C for 4 h. For the c.6051+1G > A mutation, a 99 bp DNA fragment was amplified (forward: 5′-CCA CGG TGC CAG GGA AGG ATC-3′; reverse: 5′-CAA CGC TAG CTG TGC ACG AAG G-3′) and cut into 41 bp and 48 bp with ScrFI (New England BioLabs) at 37 °C for 4 h. Both mutations eliminated the respective restriction sites. .. Digested PCR products were run on 1.5% agarose gels.

    Electron Microscopy:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. The wild-type sequence contains a Bst XI restriction site that is eliminated by the ketu mutation.

    Transfection:

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

    Gas Chromatography:

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ). .. Arm 2 (2013 bp) was PCR amplified from plasmid pBR322 (NEB, Ipswich, MA) using a biotin-labeled primer.

    Ligation:

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: The forward primer contains a 5’ digoxigenin label, designed to be ~1.1kb away from the single BstXI cutting site located on the plasmid. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment. .. Unzipping segment preparation: PCR amplify the unzipping segment from plasmid p601 ( ).

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′). .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The lesion segment was made by annealing of two oligos (5′-/phos/GGTGTCACCAGCAGGCCGATTGGG TT GGGTATTCGCCGTGTCCCTCTCGATGGCTGTAAGTATCCTATAGG-3′ and 5′-/phos/ACCGCCTATAGGATACTTACAGCCATCGAGAGGGACACGGCGAATACCCAACCCAATCGGCCTGCTGGTGACACCCGAT-3′). .. The downstream segment was made via PCR from plasmid generated based on pRL574 (ref. ) and digested with BstXI (NEB) to create an overhang for ligation with the lesion segment. .. These three pieces of DNA segments were ligated and purified.

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Ligation reactions were transformed into chemically competent E. coli XL1-Blue (p STM3846 ) or Mach One E. coli (p STM3602 ; Invitrogen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ). .. The resulting DNA fragment was digested with BstEII (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to adapter 3 (5ʹ-/phos/GTAAC CTG TAC AGT GTA TAG AAT GAC GTA ACG CGC AAT CAT CGA TAT CTC GTA ATC ACG TGC AAG GC CTA-3ʹ).

    Footprinting:

    Article Title: Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA
    Article Snippet: Paragraph title: Dimethylsulfate footprinting ... Following the removal of DMS, DNA was heated at 65°C for 20 min in water, and treated with RNase H (17 U/mL) and PstI (NEB) for 30 min at 37°C in NEB3 buffer, and then with BstXI (NEB) at 55°C for 1 h to excise the insert.

    Infection:

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively). .. Plasmids were then isolated as described above and transformed into Δ STM3846 and Δ STM3602 mutants using heat shock or electroporation, respectively.

    Generated:

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The lesion segment was made by annealing of two oligos (5′-/phos/GGTGTCACCAGCAGGCCGATTGGG TT GGGTATTCGCCGTGTCCCTCTCGATGGCTGTAAGTATCCTATAGG-3′ and 5′-/phos/ACCGCCTATAGGATACTTACAGCCATCGAGAGGGACACGGCGAATACCCAACCCAATCGGCCTGCTGGTGACACCCGAT-3′). .. The downstream segment was made via PCR from plasmid generated based on pRL574 (ref. ) and digested with BstXI (NEB) to create an overhang for ligation with the lesion segment. .. These three pieces of DNA segments were ligated and purified.

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs). .. For multiplexing experiments, we also cloned a dual sgRNA vector to otherwise reduce false positives in bulk measurements (e.g., ELISA).

    Non-Homologous End Joining:

    Article Title: Cip29 is phosphorylated following activation of the DNA damage response in Xenopus egg extracts
    Article Snippet: Briefly, 20 μl of egg extract was combined with 12.5ng of linear DNA repair substrate and 1 μl of NHEJ mix (1mM ATP, 1mM MgCl2 and 50 μM dNTPs) and incubated at 21°C for 6h. .. Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB).

    Polymerase Chain Reaction:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: One testis per mouse was used for cytology and the second was reserved for DNA extraction. .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. The wild-type sequence contains a Bst XI restriction site that is eliminated by the ketu mutation.

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and cloning ... Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: FlbD, a Myb Transcription Factor of Aspergillus nidulans, Is Uniquely Involved in both Asexual and Sexual Differentiation
    Article Snippet: ΔflbD strains in a veA + background were obtained from a cross between strains TJAQ15 and FGSCA4. .. The presence of the veA + allele was confirmed by PCR using genomic DNAs from selected progeny and the primers veA + forward and veA + reverse, with digestion of the PCR product with the BstXI enzyme (NEB, Ipswich, MA), as reported previously ( ). .. All strains were grown at 37°C in glucose-supplemented minimal nitrate medium ( ).

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: The forward primer contains a 5’ digoxigenin label, designed to be ~1.1kb away from the single BstXI cutting site located on the plasmid. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment. .. Unzipping segment preparation: PCR amplify the unzipping segment from plasmid p601 ( ).

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The lesion segment was made by annealing of two oligos (5′-/phos/GGTGTCACCAGCAGGCCGATTGGG TT GGGTATTCGCCGTGTCCCTCTCGATGGCTGTAAGTATCCTATAGG-3′ and 5′-/phos/ACCGCCTATAGGATACTTACAGCCATCGAGAGGGACACGGCGAATACCCAACCCAATCGGCCTGCTGGTGACACCCGAT-3′). .. The downstream segment was made via PCR from plasmid generated based on pRL574 (ref. ) and digested with BstXI (NEB) to create an overhang for ligation with the lesion segment. .. These three pieces of DNA segments were ligated and purified.

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs). .. For multiplexing experiments, we also cloned a dual sgRNA vector to otherwise reduce false positives in bulk measurements (e.g., ELISA).

    Article Title: Torque modulates nucleosome stability and facilitates H2A/H2B dimer loss
    Article Snippet: The DNA construct for these experiments consisted of two separate segments. .. An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang. .. The unzipping segment was prepared by PCR from the plasmid p601 by using a biotin-labeled primer (5’-ATG ATT CCA CCG ATC TGG CTT/iBiodT/AC ACT TTA TGC) and a reverse primer (5’- AGC GGG TGT TGG CGG GTG TC) and then digested with BstXI and dephosphorylated using CIP (NEB) to introduce a nick into the final DNA template.

    Article Title: Chimeric Genes in Deletions and Duplications Associated with Intellectual Disability
    Article Snippet: PCR reactions for each forward-reverse pair of primers were processed on a PTC-200 thermocycler (BIO-RAD laboratories) (Supplementary Table 1). .. A total of 8 μ l of the long template PCR product were digested 1 hour at 55°C with 1X digestion buffer 3 (New England Biolabs, Hitchin, UK) and 10U of BstXI (New England Biolabs) for patient 1. .. Fragment analysis was performed with a 12% polyacrylamide gel electrophoresis.

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: We mutated the phosphatase active-site motif CX5 RT by the PCR extension method. .. The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: Arm 1 (1129 bp) was PCR amplified from plasmid pRL574 using a digoxigenin-labeled primer. .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Crocin Bleaching Assay:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. A guide RNA (target sequence 5′-AATAAAGGCTCTTTCCGTAC) was designed to target predicted exon 2 of Ythdc2 (NCBI Gene ID: 240255 and Ensembl Gene ID: ENSMUSG00000034653) and used for editing as described ( ).

    Pulsed-Field Gel:

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis. ... To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902).

    DNA Sequencing:

    Article Title: Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc1 function in vivo
    Article Snippet: 2.4 The size and DNA sequence of the fusion genes present in cells grown photoheterotrophically were verified by restriction analyzes and DNA sequencing of plasmids isolated from R. capsulatus and amplified in E scherichia coli HB101. .. The double restriction digestion was performed with BstX I (New England Biolabs) and Sfu I (Roche Diagnostics) enzymes, yielding shorter DNA fragment (1950 bp) in case of cytochrome b gene or longer DNA fragment (3325 bp) for cytochrome bS b gene.

    DNA Extraction:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts).

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and cloning ... Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Marker:

    Article Title: Can terminators be used as insulators into yeast synthetic gene circuits?
    Article Snippet: Genomic integration was carried out as described in [ ]. .. About 5 μ g of plasmidic DNA were linearized either along the URA3 marker with the restriction enzyme StuI (NEB-R0187S) or along the LEU2 marker with the restriction enzyme BstXI (NEB-R0113S). .. Transformed cells were grown on plates containing synthetic selective medium (SD-URA or SD-LEU; 2% glucose, 2% agar) for about 36 h at 30 °C.

    Electroporation:

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively). .. Complementing plasmids were transformed into chemically competent S. Typhimurium LB5000 (restriction negative, modification positive) , and transformants were obtained by selection on LB with carbenicillin.

    Mutagenesis:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Details of the ENU mutagenesis and breeding for screening purposes are provided elsewhere ( ) and were similar to previously described methods ( ; ). .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts).

    Article Title: FlbD, a Myb Transcription Factor of Aspergillus nidulans, Is Uniquely Involved in both Asexual and Sexual Differentiation
    Article Snippet: The flbB allele, originally isolated as fluH1 , corresponds to a point mutation changing codon 57 into a stop codon (AAG to TAG) that results in a truncated peptide (this work). flbE58 has not been sequenced yet but very likely corresponds to a loss-of-function allele ( ). .. The presence of the veA + allele was confirmed by PCR using genomic DNAs from selected progeny and the primers veA + forward and veA + reverse, with digestion of the PCR product with the BstXI enzyme (NEB, Ipswich, MA), as reported previously ( ).

    Article Title: Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1
    Article Snippet: DNA sequencing was performed with the BigDye Terminator Cycle Sequencing Kit on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. For the c.3742G > A mutation, a 454 bp DNA fragment was amplified (forward: 5′-CGG CTG CCC TCA AAA TCC ACA T-3′; reverse: 5′-TGG CAG GTA AAG GCA TTG AGA CA-3′) and cut into 172 bp and 282 bp with BstXI (New England BioLabs Inc., Beverly, MA) at 37 °C for 4 h. For the c.6051+1G > A mutation, a 99 bp DNA fragment was amplified (forward: 5′-CCA CGG TGC CAG GGA AGG ATC-3′; reverse: 5′-CAA CGC TAG CTG TGC ACG AAG G-3′) and cut into 41 bp and 48 bp with ScrFI (New England BioLabs) at 37 °C for 4 h. Both mutations eliminated the respective restriction sites. .. Digested PCR products were run on 1.5% agarose gels.

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: Paragraph title: Mutagenesis of Fig4 cDNA and generation of expression constructs ... The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Isolation:

    Article Title: Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc1 function in vivo
    Article Snippet: 2.4 The size and DNA sequence of the fusion genes present in cells grown photoheterotrophically were verified by restriction analyzes and DNA sequencing of plasmids isolated from R. capsulatus and amplified in E scherichia coli HB101. .. The double restriction digestion was performed with BstX I (New England Biolabs) and Sfu I (Roche Diagnostics) enzymes, yielding shorter DNA fragment (1950 bp) in case of cytochrome b gene or longer DNA fragment (3325 bp) for cytochrome bS b gene.

    Article Title: FlbD, a Myb Transcription Factor of Aspergillus nidulans, Is Uniquely Involved in both Asexual and Sexual Differentiation
    Article Snippet: The flbB allele, originally isolated as fluH1 , corresponds to a point mutation changing codon 57 into a stop codon (AAG to TAG) that results in a truncated peptide (this work). flbE58 has not been sequenced yet but very likely corresponds to a loss-of-function allele ( ). .. The presence of the veA + allele was confirmed by PCR using genomic DNAs from selected progeny and the primers veA + forward and veA + reverse, with digestion of the PCR product with the BstXI enzyme (NEB, Ipswich, MA), as reported previously ( ).

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Transformants were obtained by selection on LB agar supplemented with carbenicillin and were streaked twice to single colonies. .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively). .. Complementing plasmids were transformed into chemically competent S. Typhimurium LB5000 (restriction negative, modification positive) , and transformants were obtained by selection on LB with carbenicillin.

    Article Title: Novel Model of Antigen-Specific Induction of Bile Duct Injury
    Article Snippet: The 5′ flanking region of the ASBT gene was cut using BamHI and BstXI sites (all restriction enzymes from New England Biolabs, Ipswich, MA), resulting in a 3.0-kb fragment that was used in the ASBT-mOVA construct. .. The 5′ flanking region of the ASBT gene was cut using BamHI and BstXI sites (all restriction enzymes from New England Biolabs, Ipswich, MA), resulting in a 3.0-kb fragment that was used in the ASBT-mOVA construct.

    Labeling:

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: Labeling and producing the DNA templates is accomplished by standard enzymatic reactions and purification methods with biotin and digoxigenin labeled nucleic acids. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment.

    Mouse Assay:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: At these ages, spermatocytes in the relevant stages of meiotic prophase I are abundant in normal mice ( ). .. Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified. .. The PCR product containing the mutation was digested with BstX1 and the resulting mutant 420 bp fragment was ligated to the 7.2 kb fragment from the wild-type clone to generate the CAG- Fig4 -Cys486Ser construct.

    Sequencing:

    Article Title: Cip29 is phosphorylated following activation of the DNA damage response in Xenopus egg extracts
    Article Snippet: Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB). .. Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB).

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. CRISPR/Cas9-mediated genome editing was done by the MSKCC Mouse Genetics Core Facility to generate em alleles.

    Article Title: Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc1 function in vivo
    Article Snippet: 2.4 The size and DNA sequence of the fusion genes present in cells grown photoheterotrophically were verified by restriction analyzes and DNA sequencing of plasmids isolated from R. capsulatus and amplified in E scherichia coli HB101. .. The double restriction digestion was performed with BstX I (New England Biolabs) and Sfu I (Roche Diagnostics) enzymes, yielding shorter DNA fragment (1950 bp) in case of cytochrome b gene or longer DNA fragment (3325 bp) for cytochrome bS b gene.

    Article Title: The Mre11/Rad50/Nbs1 complex functions in resection-based DNA end joining in Xenopus laevis
    Article Snippet: DNA was digested with 10 U BstXI enzyme (New England Biolabs) at 55°C for 3 h and 20 U Taq∝ I (New England Biolabs) at 65°C for 4 h and ethanol precipitated. .. DNA was digested with 10 U BstXI enzyme (New England Biolabs) at 55°C for 3 h and 20 U Taq∝ I (New England Biolabs) at 65°C for 4 h and ethanol precipitated.

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: The V2 sequence (derived from AVPR2) was inserted in between GPCR and TEVp as primer overhangs via InFusion cloning. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified. .. For neuron-specific expression in transgenic mice, the mutant cDNA was PCR amplified from the CAG clone and cloned downstream of the 4 kb enolase (NSE) promoter as previously described ( ).

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: In brief, the anchoring segment was amplified from plasmid pRL574 and the unwinding segment was derived from 17 pseudo-repeats (or 17mer) of the 5s rRNA sequence . .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Construct:

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: Paragraph title: Generation of genetic constructs ... Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs).

    Article Title: Torque modulates nucleosome stability and facilitates H2A/H2B dimer loss
    Article Snippet: The DNA construct for these experiments consisted of two separate segments. .. An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang.

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: Paragraph title: Mutagenesis of Fig4 cDNA and generation of expression constructs ... The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified.

    Article Title: Novel Model of Antigen-Specific Induction of Bile Duct Injury
    Article Snippet: The membrane-bound form of OVA consists of a fusion protein made up of the first 118 residues of the human transferrin receptor (including cytoplasmic tail and signal/anchor domain) linked to residues 139–385 of mature OVA, transferrin receptor-ova (TFR-OVA), targeting membrane expression of OVA on biliary epithelium. .. The 5′ flanking region of the ASBT gene was cut using BamHI and BstXI sites (all restriction enzymes from New England Biolabs, Ipswich, MA), resulting in a 3.0-kb fragment that was used in the ASBT-mOVA construct. .. The TFR-OVA fragment was cut from the rat insulin promoter-mOVA plasmid by digestion with HindIII and XbaI, and then the HindIII site was blunted.

    Polyacrylamide Gel Electrophoresis:

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The CPD-containing DNA oligonucleotides were synthesized and purified using PAGE electrophoresis by Oligos Etc (Wilsonville, OR). .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Article Title: Chimeric Genes in Deletions and Duplications Associated with Intellectual Disability
    Article Snippet: A total of 8 μ l of the long template PCR product were digested 1 hour at 55°C with 1X digestion buffer 3 (New England Biolabs, Hitchin, UK) and 10U of BstXI (New England Biolabs) for patient 1. .. A total of 8 μ l of the long template PCR product were digested 1 hour at 55°C with 1X digestion buffer 3 (New England Biolabs, Hitchin, UK) and 10U of BstXI (New England Biolabs) for patient 1.

    CRISPR:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. The wild-type sequence contains a Bst XI restriction site that is eliminated by the ketu mutation.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ). .. Arm 2 (2013 bp) was PCR amplified from plasmid pBR322 (NEB, Ipswich, MA) using a biotin-labeled primer.

    Purification:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Purified DNA was ligated to the plasmid vector pCR® 2.1-TOPO® and used to transform One Shot® Mach1 ™ - T1® chemically competent cells using a Topo TA® cloning kit according to the manufacturer’s protocol (Invitrogen). .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: Labeling and producing the DNA templates is accomplished by standard enzymatic reactions and purification methods with biotin and digoxigenin labeled nucleic acids. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment.

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The CPD-containing DNA oligonucleotides were synthesized and purified using PAGE electrophoresis by Oligos Etc (Wilsonville, OR). .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: The insert was isolated from the plasmid backbone by agarose gel electrophoresis and gel purified using a QIAquick gel purification kit (Qiagen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: A fragment containing the substitution c.1458G > C encoding the missense mutation p.Cys486Ser was amplified from the CAG- Fig4 construct using the forward primer 5′ GTGAT GCTTC TGTGA TGTCT TTTAC and a reverse primer containing the mutation (underlined): 5′ CCGTA GGAAG CTTGG TTGA G ACACC TGACA AACC. .. The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified. .. The PCR product containing the mutation was digested with BstX1 and the resulting mutant 420 bp fragment was ligated to the 7.2 kb fragment from the wild-type clone to generate the CAG- Fig4 -Cys486Ser construct.

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: Wild-type T7 gp5 and exo-gp5 (D5A, D7A) were purified as previously described , . .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Plasmid Preparation:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. A guide RNA (target sequence 5′-AATAAAGGCTCTTTCCGTAC) was designed to target predicted exon 2 of Ythdc2 (NCBI Gene ID: 240255 and Ensembl Gene ID: ENSMUSG00000034653) and used for editing as described ( ).

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Transformed clones were identified using white blue selection and inoculated into 10 ml Falcon tubes containing 3 ml of LB broth and 50 μg/ml kanamycin. .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA). .. The primers ( ) and PCR conditions are as previously described ( ).

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: The forward primer contains a 5’ digoxigenin label, designed to be ~1.1kb away from the single BstXI cutting site located on the plasmid. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment.

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: Arm 1 (1,129 bp) was amplified from plasmid pLB574 (ref. ) using a digoxigenin-labelled primer. .. Resulting DNA fragments were digested with BstXI (NEB) to create an overhang and were subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5′-/phos/GCAGTACCGAGCTCATCCAATTCTACATGCCGC-3′) and adapter 2 (5′-/phos/GCCTTGCACGTGATTACGAGATATCGATGATTGCGGCGGCATGTAGAATTGGATGAGCTCGGTACTGCATCG-3′).

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: Finally, the plugs were incubated in 0.2% proteinase K (Gene Choice) buffer at 55°C for 2 days. .. To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902). .. In these experiments, each set of plugs was incubated with or without a restriction enzyme in 200 μl of the appropriate buffer solution, as recommended by the enzyme manufacturer.

    Article Title: T7 replisome directly overcomes DNA damage
    Article Snippet: The lesion segment was made by annealing of two oligos (5′-/phos/GGTGTCACCAGCAGGCCGATTGGG TT GGGTATTCGCCGTGTCCCTCTCGATGGCTGTAAGTATCCTATAGG-3′ and 5′-/phos/ACCGCCTATAGGATACTTACAGCCATCGAGAGGGACACGGCGAATACCCAACCCAATCGGCCTGCTGGTGACACCCGAT-3′). .. The downstream segment was made via PCR from plasmid generated based on pRL574 (ref. ) and digested with BstXI (NEB) to create an overhang for ligation with the lesion segment. .. These three pieces of DNA segments were ligated and purified.

    Article Title: Engineering cell sensing and responses using a GPCR-coupled CRISPR-Cas system
    Article Snippet: All sgRNAs were cloned into a pHR lentiviral U6-driven expression vector that co-expressed puromycin-p2A-BFP or upstream of the GPCR-V2-TEVp locus for ease of transfection of the three-component GPCR-CRISPR ChaCha system. .. Alternative sgRNA sequences were generated by PCR and inserted by InFusion cloning into the vector digested with BstXI and NotI (New England Biolabs). .. For multiplexing experiments, we also cloned a dual sgRNA vector to otherwise reduce false positives in bulk measurements (e.g., ELISA).

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: The insert was isolated from the plasmid backbone by agarose gel electrophoresis and gel purified using a QIAquick gel purification kit (Qiagen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Article Title: Torque modulates nucleosome stability and facilitates H2A/H2B dimer loss
    Article Snippet: The DNA construct for these experiments consisted of two separate segments. .. An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang. .. The unzipping segment was prepared by PCR from the plasmid p601 by using a biotin-labeled primer (5’-ATG ATT CCA CCG ATC TGG CTT/iBiodT/AC ACT TTA TGC) and a reverse primer (5’- AGC GGG TGT TGG CGG GTG TC) and then digested with BstXI and dephosphorylated using CIP (NEB) to introduce a nick into the final DNA template.

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: A fragment containing the substitution c.1458G > C encoding the missense mutation p.Cys486Ser was amplified from the CAG- Fig4 construct using the forward primer 5′ GTGAT GCTTC TGTGA TGTCT TTTAC and a reverse primer containing the mutation (underlined): 5′ CCGTA GGAAG CTTGG TTGA G ACACC TGACA AACC. .. The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified. .. The PCR product containing the mutation was digested with BstX1 and the resulting mutant 420 bp fragment was ligated to the 7.2 kb fragment from the wild-type clone to generate the CAG- Fig4 -Cys486Ser construct.

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: Arm 1 (1129 bp) was PCR amplified from plasmid pRL574 using a digoxigenin-labeled primer. .. The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ).

    Article Title: Novel Model of Antigen-Specific Induction of Bile Duct Injury
    Article Snippet: The 5′ flanking region of the ASBT gene was cut using BamHI and BstXI sites (all restriction enzymes from New England Biolabs, Ipswich, MA), resulting in a 3.0-kb fragment that was used in the ASBT-mOVA construct. .. The TFR-OVA fragment was cut from the rat insulin promoter-mOVA plasmid by digestion with HindIII and XbaI, and then the HindIII site was blunted.

    Software:

    Article Title: Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA
    Article Snippet: Following the removal of DMS, DNA was heated at 65°C for 20 min in water, and treated with RNase H (17 U/mL) and PstI (NEB) for 30 min at 37°C in NEB3 buffer, and then with BstXI (NEB) at 55°C for 1 h to excise the insert. .. DNA was electrotransferred to Hybond N+ nylon membrane (Amersham Pharmacia Biotech), cross-linked using the autocross-link option on a Stratalinker 2400 (Stratagene), and hybridized with 32 P-labeled oligonucleotide probes complementary to unique sequences immediately 5′ (HMD35, TG CAGCCCGACCCCTAGT) or 3′ (HMD33, GCCGCCACCGC GAGATCTCC) of the G-rich insert at 60°C for 4 h in 0.34 M Na2 HPO4 , 0.16 M NaH2 PO4 , 1 mM EDTA (pH 8.0), 7% SDS, and 5 μg/mL BSA.

    Microscopy:

    Article Title: Torque modulates nucleosome stability and facilitates H2A/H2B dimer loss
    Article Snippet: An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang. .. An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang.

    Selection:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Transformed clones were identified using white blue selection and inoculated into 10 ml Falcon tubes containing 3 ml of LB broth and 50 μg/ml kanamycin. .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: Transformants were obtained by selection on LB agar supplemented with carbenicillin and were streaked twice to single colonies. .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    Agarose Gel Electrophoresis:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Transformed clones were identified using white blue selection and inoculated into 10 ml Falcon tubes containing 3 ml of LB broth and 50 μg/ml kanamycin. .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA). .. The primers ( ) and PCR conditions are as previously described ( ).

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902). .. In these experiments, each set of plugs was incubated with or without a restriction enzyme in 200 μl of the appropriate buffer solution, as recommended by the enzyme manufacturer.

    Article Title: Novel Determinants of Intestinal Colonization of Salmonella enterica Serotype Typhimurium Identified in Bovine Enteric Infection
    Article Snippet: The insert was isolated from the plasmid backbone by agarose gel electrophoresis and gel purified using a QIAquick gel purification kit (Qiagen). .. Plasmids were isolated using the Qiagen miniprep kit (Qiagen), and correct inserts were verified by restriction digestion of plasmids using BamHI or BstXI (New England BioLabs; p STM3846 and p STM3602 , respectively).

    In Vitro:

    Article Title: ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
    Article Snippet: Genotyping of ketu animals was done by PCR amplification using ketu F and ketu R primers (oligonucleotide primer sequences are provided in ), followed by digestion of the amplified product with Bst XI (NEB, Ipswich, Massachusetts). .. A guide RNA (target sequence 5′-AATAAAGGCTCTTTCCGTAC) was designed to target predicted exon 2 of Ythdc2 (NCBI Gene ID: 240255 and Ensembl Gene ID: ENSMUSG00000034653) and used for editing as described ( ).

    Transgenic Assay:

    Article Title: Rescue of neurodegeneration in the Fig4 null mouse by a catalytically inactive FIG4 transgene
    Article Snippet: The CAG- Fig4 plasmid was digested with BstXI (New England Biolabs, Ipswich, MA, USA) and the products of 7.2 kb and 420 bp were gel purified. .. The PCR product containing the mutation was digested with BstX1 and the resulting mutant 420 bp fragment was ligated to the 7.2 kb fragment from the wild-type clone to generate the CAG- Fig4 -Cys486Ser construct.

    Staining:

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902). .. Pulsed-field gel electrophoresis was performed with a 1% agarose gel using a CHEF-DR II system (Bio-Rad Laboratories) and 0.5× Tris-borate-EDTA buffer at 14°C.

    Produced:

    Article Title: Cip29 is phosphorylated following activation of the DNA damage response in Xenopus egg extracts
    Article Snippet: Linear DNA repair substrate with 32 P-labelled 3’ hydroxyl overhang ends was produced as previously described [ ]. .. Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB).

    Article Title: Unzipping single DNA molecules to study nucleosome structure and dynamics
    Article Snippet: BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment. .. BstXI (New England Biolabs) digest the PCR product to generate a 3’ overhang for ligation of the unzipping segment.

    Concentration Assay:

    Article Title: Torque modulates nucleosome stability and facilitates H2A/H2B dimer loss
    Article Snippet: On the day of the experiment, the four DNA pieces (including 1 kb fragment with a single assembled nucleosome or tetrasome) were mixed in equal ratios at 5–10 nM concentration (25 nM for tetrasome experiments) and ligated at 16°C for 1 hour. .. An ~1.1 kbp anchoring segment was prepared by PCR from the plasmid pRL574 using a digoxigenin-labeled primer (5'-GTT GTA AAA CGA CGG CCA GTG AAT) and a reverse primer (5’-CCG TGA TCC AGA TCG TTG GTG AAC) and then digested with BstXI (NEB) to produce a ligatable overhang.

    Lysis:

    Article Title: Cip29 is phosphorylated following activation of the DNA damage response in Xenopus egg extracts
    Article Snippet: The reaction was stopped by the addition of lysis buffer (0.3M NaCl, 2mM Tris-HCl, pH 6.7, 10mM EDTA, 1% (w/v) SDS and 1 mg/ml proteinase K) and incubation at 65°C for 3 hours. .. Following phenol/chloroform extraction, the DNA was ethanol precipitated, dissolved in 10mM Tris-HCl containing 1mM EDTA, then digested with 10 units Bst XI (NEB) followed by 20 units Taq ∝ I (NEB).

    Article Title: The Mre11/Rad50/Nbs1 complex functions in resection-based DNA end joining in Xenopus laevis
    Article Snippet: NHEJ reaction mixtures were incubated in lysis buffer [0.3 M NaCl, 2 mM Tris, pH 6.7 (HCl), 10 mM EDTA, 1% (w/v) SDS and 1 mg/ml proteinase K] at 65°C for 3 h. Following phenol/chloroform extraction, the DNA was ethanol precipitated, washed once with ethanol and dissolved in TE buffer. .. DNA was digested with 10 U BstXI enzyme (New England Biolabs) at 55°C for 3 h and 20 U Taq∝ I (New England Biolabs) at 65°C for 4 h and ethanol precipitated.

    Article Title: Virulence Plasmid Diversity in Clostridium perfringens Type D Isolates
    Article Snippet: The agarose-embedded cells were lysed by incubation with gentle shaking of the plugs overnight at 37°C in lysis buffer (0.5 M EDTA [pH 8.0], 2.5% [vol/vol] 20% Sarkosyl, 0.25% lysozyme [Sigma], 0.2% deoxycholic acid). .. To help distinguish whether colocalizing signals obtained using probes for two different ORFs indicated that these two ORFs were present on the same plasmid or on two comigrating plasmids, restriction endonucleases ApaI, BamHI, BstXI, ClaI, KpnI, NcoI, SalI, ScaI, SmaI, StuI, and XhoI (New England Biolabs) were used to digest plugs containing DNA from two representative type D isolates (CN1183 and JGS1902).

    CTG Assay:

    Article Title: Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1
    Article Snippet: DNA sequencing was performed with the BigDye Terminator Cycle Sequencing Kit on an ABI 3130 Genetic Analyzer (Applied Biosystems). .. For the c.3742G > A mutation, a 454 bp DNA fragment was amplified (forward: 5′-CGG CTG CCC TCA AAA TCC ACA T-3′; reverse: 5′-TGG CAG GTA AAG GCA TTG AGA CA-3′) and cut into 172 bp and 282 bp with BstXI (New England BioLabs Inc., Beverly, MA) at 37 °C for 4 h. For the c.6051+1G > A mutation, a 99 bp DNA fragment was amplified (forward: 5′-CCA CGG TGC CAG GGA AGG ATC-3′; reverse: 5′-CAA CGC TAG CTG TGC ACG AAG G-3′) and cut into 41 bp and 48 bp with ScrFI (New England BioLabs) at 37 °C for 4 h. Both mutations eliminated the respective restriction sites. .. Digested PCR products were run on 1.5% agarose gels.

    Article Title: Helicase promotes replication re-initiation from an RNA transcript
    Article Snippet: The resulting DNA fragment was digested with BstXI (NEB, Ipswich, MA) to create an overhang and was subsequently annealed to a short DNA with a complementary overhang formed by adapter 1 (5ʹ-/phos/GCA GTA CCG AGC TCA TCC AAT TCT ACA TGC CGC-3ʹ) and adapter 2 (5ʹ-/phos/GCC TTG CAC GTG ATT ACG AGA TAT CGA TGA TTG CG GCG GCA TGT AGA ATT GGA TGA GCT CGG TAC TGC ATCG-3ʹ). .. Arm 2 (2013 bp) was PCR amplified from plasmid pBR322 (NEB, Ipswich, MA) using a biotin-labeled primer.

    Gel Extraction:

    Article Title: Targeted search for actinomycetes from near-shore and deep-sea marine sediments
    Article Snippet: Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA). .. Plasmid DNA was extracted using the QiaPrep® MiniPrep extraction kit according to manufacturer’s instructions (Qiagen), digested with BstX I (New England BioLabs, Ipswich, MA), and run on a 1% agarose gel to confirm the presence of the correct sized insert. eDNA was extracted from 10 g of Canary Basin sediment using an UltraClean Mega DNA soil kit (Mo Bio Laboratories, Solana Beach, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bstxi
    Bstxi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bstxi/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    bstxi - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results