ndei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NdeI
    Description:
    NdeI 20 000 units
    Catalog Number:
    R0111L
    Price:
    264
    Size:
    20 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs ndei
    NdeI
    NdeI 20 000 units
    https://www.bioz.com/result/ndei/product/New England Biolabs
    Average 99 stars, based on 290 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2019-08
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Paragraph title: Polygalacturonase gene cloning ... The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The luxA and luxB genes were inserted into the pET16b vector containing the selected artificial riboswitches using a traditional cloning approach. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: GST was cloned out of the pGEX-6P-1 vector. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: The recombinant plasmid for the expression of UK114 in E. coli was obtained by cloning the Nde I/Xho I-digested DNA fragment encoding goat UK114 into the corresponding sites of the pET15b expression vector (Novagen). .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Paragraph title: CDT Cloning, Expression, and Purification ... The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Amplification:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Colony PCR amplification of the pglA gene (gene ID:1142827) was performed using Platinum taq polymerase (Invitrogen, Carlsbad, CA) and pglA specific primers XFPGF and XFPGRH with the following PCR parameters: 94°C (2 min) followed by 35 cycles of 94°C (1 min) 60°C (1 min) 72°C (2 min) and a final extension of 72°C (6 min). .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc3, Scc1 and other cohesin subunits were amplified from yeast Genomic DNA (Millipore). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: These primers were engineered such that 5′ NdeI and 3′ BamHI restriction sites (underlined in ) were incorporated into the amplicon. .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The recombinant M. haemofelis DnaK ( M. haemofelis rDnaK) gene was obtained in two steps: first, the M. haemofelis DnaK gene was amplified as two overlapping fragments from DNA extracted from blood of cat QLA5 (using primer pairs F1-35Mp/R934-956Mhf and F666-691Mhf/R1750-1783Mhf; Table ). .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Mass Spectrometry:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The purified HIS-tagged DPS protein was then cleaved with thrombin to yield the native DPS protein and dialyzed against 10 mM tris, pH 7.4, 500 mM KCl before storing in final 30% glycerol condition at 20 °C.

    Synthesized:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The DNA template and primers were synthesized by GenScript and PCR was performed with the template described above. .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    TA Cloning:

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pGEM-T TA-cloning vector and GoTaq DNA polymerase were acquired from Promega (Madison, WI). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Construct:

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: All constructs contained an N-terminal His6 tag encoded in the pET28a plasmid (Novagen). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: Paragraph title: 4.1. Construct for the Expression of Goat UK114 in E. coli ... The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The vectors pXOP-SCFP3A-N1, pXOP-SYFP2-N1, and pXOP-SYFP2-SCFP3A were constructed for use in the generation of transgenic Xenopus laevis . .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Nuclear Magnetic Resonance:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Expressing:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: Paragraph title: Expression systems and plasmid construction ... The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: Paragraph title: 4.1. Construct for the Expression of Goat UK114 in E. coli ... The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Paragraph title: CDT Cloning, Expression, and Purification ... The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: These expression vectors were used to transfect HEK293T cells. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Transformation Assay:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: DNA was transformed into competent E. coli DH5α (Life Technologies). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The transformed bacteria were plated on Luria–Bertani (LB) agar petri dishes supplemented with 100 μg ml−1 carbenicillin and grown aerobically at 37 °C overnight. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. To insert the gene into the vector, the digested gene and vector were incubated with 40 units/μl T4 ligase in T4 buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, pH 7.5) for 18 hours at 16°C.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Over Expression:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Paragraph title: Cloning, protein overexpression and purification ... The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: Paragraph title: Over-expression and purification of Dps and IHF ... The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Derivative Assay:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Electroporation:

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The purified products were blunt end ligated (Quick Ligase, NEB) and afterwards transformed into E. coli BL21(DE3) gold (Stratagene) by electroporation. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Ligation:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was transformed into NEB DH5α chemically competent cells (NEB).

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. To insert the gene into the vector, the digested gene and vector were incubated with 40 units/μl T4 ligase in T4 buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, pH 7.5) for 18 hours at 16°C.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Immunohistofluorescence:

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: Paragraph title: Over-expression and purification of Dps and IHF ... The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Generated:

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. The first fragment containing the SnoopTag-BLA component was amplified from SpyTag-BLA-SpyCatcher using primers 5′- ATTACATATGGGAAAACTGGGGGACATCGAATTCATCAAAGTAAACAAAGGTTCAGGGGGTTCCGGTCACC and 5′- CTAAACACGGCACCACGCAGCGGCTTTCCACTGCCACCACTCCCCCAATGC.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    other:

    Article Title: Site-specific incorporation of 3-nitrotyrosine as a probe of pKa perturbation of redox-active tyrosines in ribonucleotide reductase
    Article Snippet: Nco I, Xho I, Sal I, Bgl II, Nde I and Pst I were from New England Biolabs.

    DNA Sequencing:

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Sequencing:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Based on phage SETP3 genomic sequence available at NCBI database (reference sequence: NC_009232.2), primers (Invitrogen) were designed to amplify the putative endolysin gene by PCR from the isolated phage phi68 genomic DNA template, using Phusion High-Fidelity DNA Polymerase (NEB, UK). .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Plasmids were purified using QIAprep Minispin kit (Qiagen).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. .. A . vitis strain S4 (kindly provided by T. Burr, Cornell, NY) was grown on solid 523 medium [ ] at room temperature for 48 hours.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: A 4xERE sequence [ ] was amplified with primers introducing a restriction site for XmaI, it contains an EcoO109I site. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Recombinant:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. E. coli BL21(DE3) harboring the endolysin vector was grown in 600 mL Luria Broth (LB) supplemented with 50 µg/mL kanamycin to an optical density (OD600 nm ) of 0.6 (4 h, 120 rpm at 37°C).

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Paragraph title: Construction of recombinant plasmids ... The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: The recombinant plasmid for the expression of UK114 in E. coli was obtained by cloning the Nde I/Xho I-digested DNA fragment encoding goat UK114 into the corresponding sites of the pET15b expression vector (Novagen). .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: Paragraph title: Production of recombinant Rv2346c protein ... The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: The recombinant M. haemofelis DnaK ( M. haemofelis rDnaK) gene was obtained in two steps: first, the M. haemofelis DnaK gene was amplified as two overlapping fragments from DNA extracted from blood of cat QLA5 (using primer pairs F1-35Mp/R934-956Mhf and F666-691Mhf/R1750-1783Mhf; Table ). .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Molecular Weight:

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Molecular Cloning:

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Paragraph title: Gene construction and molecular cloning. ... The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ).

    Mutagenesis:

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The catalytically inactive variants of the ribozyme and of the selected twister-based riboswitches were prepared performing site direct mutagenesis by PCR using the suitable pET16b_eGFP containing the aptazyme active form as template. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: Paragraph title: Site-directed mutagenesis of GST, ubiquitin, subtiligase, and PTEN ... The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc3 and mutant variants thereof were cloned into pETM-30 vector using NcoI and NotI restriction enzyme cleavage sites. .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Isolation:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Based on phage SETP3 genomic sequence available at NCBI database (reference sequence: NC_009232.2), primers (Invitrogen) were designed to amplify the putative endolysin gene by PCR from the isolated phage phi68 genomic DNA template, using Phusion High-Fidelity DNA Polymerase (NEB, UK). .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: Thermoanaerobacterium polysaccharolyticum (ATCC strain no. BAA-17) was originally isolated from the waste pile of a canning factory in Hoopeston, Illinois ( ). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Size-exclusion Chromatography:

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Labeling:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Purification:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The purified products were blunt end ligated (Quick Ligase, NEB) and afterwards transformed into E. coli BL21(DE3) gold (Stratagene) by electroporation. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. IPTG-induction (0.5 mM IPTG final concentration) of late-log ER2566 cells (OD590 = 0.5 to 0.6) harboring appropriate plasmids was carried out at 16 °C to 18 °C overnight for protein production.

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: Paragraph title: 4.4. Expression and Purification of Recombinant Survivin ... The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Paragraph title: Constructs, expression and purification ... Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Polymerase Chain Reaction:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: The insert was cloned into the SpyTag/SpyCatcher cassette using the method previously described to make pET28a SpyTag-PhyC-SpyCatcher (GenBank accession number KU608330) and pET28a SpyTag DA-PhyC-SpyCatcher. pET28a PhyC without the SpyTag/SpyCatcher fusions was cloned by amplifying the PhyC gene from pET28a SpyTag-PhyC-SpyCatcher using primers 5′- TATACATATGGGAAAACATAAACTGAGCGATCCGTATCATTTCAC and 5′- TTTTAAGCTTTCATTATTTGCCCGAACGATCGGTCAATTTACG. .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a. .. SnoopTag is based on the N-terminal β-strand of RrgA’s D4 domain (residues 734–748, numbering from PDB ID 2WW8) .

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: The catalytically inactive variants of the ribozyme and of the selected twister-based riboswitches were prepared performing site direct mutagenesis by PCR using the suitable pET16b_eGFP containing the aptazyme active form as template. .. The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Evaluation of a New Survivin ELISA and UBC®Rapid for the Detection of Bladder Cancer in Urine
    Article Snippet: The standard PCR protocol included the primers p1 (5′-GTATACCATATGGGTGCCCGG-3′) and p2 (5′-CGGATCCTCAATCCATGGCAGC-3′). .. The PCR product was cut with NdeI and BamHI (New England Biolabs, Ipswich, MA, USA) for an in-frame ligation of the survivin coding sequence into pET16b (Merck Millipore Novagen, Darmstadt, Germany), which provides the coding sequence for an N-terminal polyhistidine-tag. .. The resulting pET16b_His-Survivin plasmid was transformed into E. coli BL 21 CodonPlus RIPL (Agilent Technologies, Santa Clara, CA, USA) cells for heterologous protein expression.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: This PCR fragment was also digested with EcoO109I and XmaI (NewEngland BioLabs) and joined into the backbone plasmid via MightyMix ligation (TAKARA); the resulting construct was termed pRC21-ERE:mCherry. .. For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The sequence of a ∼550-bp Xenopus rhodopsin promoter, characterized previously, was amplified by PCR to include NdeI, PmeI, and I-SceI sites at the 5′ end and an NheI site at the 3′ end. pXOP-SCFP3A-N1 and pXOP-SYFP2-N1 were generated using pSCFP3A-N1 and pSYFP2-N1. .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: Escherichia coli JM109 and BL21-CodonPlus(DE3) RIL competent cells and the PicoMaxx high-fidelity PCR system were purchased from Stratagene (La Jolla, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Spectroscopy:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Each plasmid was verified by sequencing and subsequently transformed into the expression host BL21 (DE3) competent cells (NEB) to yield pSECalU16-E. coli , pSECalU17-E. coli, and pSECalU19-E. coli, respectively.

    Gel Extraction:

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Amplification was performed using the Advantage GC2 polymerase enzyme (Clontech) and the following PCR condit ions: initial denaturation at 95 °C for 3 min; 25 cycles at 94 °C for 30 s, 65–62 °C for 30 s, 68 °C for 35 s; final extension temperature at 68 °C for 5 min. Each PCR product was gel purified using the QIAquick gel extraction kit (Qiagen). .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific).

    Plasmid Preparation:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Structure-Guided Functional Characterization of Enediyne Self-Sacrifice Resistance Proteins, CalU16 and CalU19
    Article Snippet: Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively. .. Restriction digestion with NdeI/Hin dIII (New Englands Biolabs, NEB) followed by ligation using T4 DNA ligase (NEB) into a linearized dephosphorylated pET28a (Novagen) yielded pSECalU16, pSECalU17, and pSECalU19 for calU16 , calU17 , and calU19 , respectively.

    Article Title: SpyRing interrogation: analyzing how enzyme resilience can be achieved with phytase and distinct cyclization chemistries
    Article Snippet: All constructs contained an N-terminal His6 tag encoded in the pET28a plasmid (Novagen). .. The amplified product was inserted into pET28a using restriction digestion with NdeI (NEB) and HindIII (NEB), followed by ligation using T4 DNA ligase (NEB). pET28a SpyTag-BLA-SpyCatcher (GenBank KJ645919, Addgene ID 70943), pET28a SpyTag DA-BLA-SpyCatcher and pET28a BLA were described previously . pDEST14 SpyCatcher , pET28a Spy0128 and pET28a RrgACatcher G842T (SnoopCatcher G848D) were as described. pET28a SnoopTag-BLA-SnoopCatcher (GenBank accession number KU608331) was cloned using overlap extension PCR followed by digestion with NdeI and HindIII and ligation into pET28a.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. .. A . vitis strain S4 (kindly provided by T. Burr, Cornell, NY) was grown on solid 523 medium [ ] at room temperature for 48 hours.

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Twister ribozymes as highly versatile expression platforms for artificial riboswitches
    Article Snippet: Paragraph title: Expression systems and plasmid construction ... The eGFP gene was removed from the pET16b backbone upon digest with NdeI (NEB) and BamHI (NEB) restriction enzymes.

    Article Title: Probing the nucleotide-binding activity of a redox sensor: two-component regulatory control in chloroplasts
    Article Snippet: Coding sequences for the full-length Arabidopsis CSK protein (CSK_F) and for a truncated version (CSK_T) (amino acids 301 to 611) were amplified from a CSK cDNA clone using primer pairs listed in Table . .. The PCR fragment for CSK_F was digested with NdeI and BamHI endonucleases (New England BioLabs) and cloned into a customised pJC20 expression vector (ATCC). .. The PCR fragment for CSK_T was cloned into a Gateway pENTR entry vector (Invitrogen) and then mobilised into a customised pETG-10A destination expression vector (EMBL).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: The aa sequences of these enzymes and other homologs have very low sequence similarity to the BisI family enzymes (less than 15% identity), suggesting that Type IIP enzymes cleaving BisI-related sites evolved independently. .. Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. The gblock coding for Rfl17I (with an N-terminal 6xHis tag) was cloned into the expression vector pBAD241 (flanked by NdeI and HindIII, the target gene under the control of PBAD promoter, inducible by arabinose) (N.Guan, unpublished).

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: GST was cloned out of the pGEX-6P-1 vector. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Article Title: Programmable Single and Multiplex Base-Editing in Bombyx mori Using RNA-Guided Cytidine Deaminases
    Article Snippet: DNA encoding rAPOBEC1, the XTEN linker, partial nCas9 with the A840H mutation, and UGI was B. mori codon-optimized, synthesized by GenScript service, and then inserted into the pUC57-T-simple plasmid. .. The complete BE3 vector was constructed by inserting the same fragment of Cas9 and nCas(A840H) into the synthesized plasmid after digestion of Nde I and Bam HI (New England BioLabs). .. The gRNA-expression vector pUC57-gRNA was described previously ( ). gRNA sequences (Table S1 in File S1 ) were synthesized as two complementary oligonucleotides, annealed, and inserted into the pUC57-gRNA plasmid after Bbs I digestion.

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: Paragraph title: Plasmid construction ... For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs).

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB).

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB).

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Each PCR product was purified using the QIAquick PCR purification kit (Qiagen). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites. .. Digested vector and amplicons were ligated and electroporated into E. coli DH5α.

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence. .. The SV40 early polyadenylation signal sequence present in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with NotI and AflII (New England Biolabs, Ipswich, Massachusetts) and replaced by the SV40 late polyadenylation signal sequence.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Positron Emission Tomography:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: Forward primer ( AGATAT CATATG TCAAACCGAAACATTAGC ) and reverse primer ( GTGGTG CTCGAG CTACTTAG ) contained Nde I and Xho I restriction sites, respectively (underlined) . .. The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. The presence of the insert in the plasmid was confirmed by DNA sequencing (Macrogen, Amsterdam) (GenBank accession number for Lys68 nucleotide sequence, KJ475444).

    Article Title: Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF
    Article Snippet: The E. coli Dps gene sequence is derived from NCBI GenBank (Accession number: CAA49169) and synthesized (1st Base, Singapore). .. The synthesized gene was cloned into pET vector using NdeI and XhoI (New England Biolabs) for expression and purification. .. The pET expression vector was chosen such that the DPS protein was expressed with a cleavable N-terminal 6X-HIS-tag.

    Article Title: Imine Deaminase Activity and Conformational Stability of UK114, the Mammalian Member of the Rid Protein Family Active in Amino Acid Metabolism
    Article Snippet: PCR amplification was carried out using the primers UK-Nde-FOR (5′-AGCATATTCGACTGA CATATG TCGTCTTTGGTCAGAAGGAT -3′) and UK-Xho-REV (5′-ATCGTCGGGCTCA CTCGAG CTA GAGTGATGCTGTCGTGAGA -3′), where the Nde I and Xho I sites are underlined, the coding sequence of UK114 is in italic and the stop codon is in bold, the Phusion® Hot Start High-Fidelity DNA Polymerase (New England Biolabs, NEB), and a previously described plasmid harboring the cDNA of the goat UK114 as a template [ ]. .. The purified PCR product of about 450 bp and pET-15b were double-digested with Nde I and Xho I (NEB). .. The gel-purified PCR band and the linearized vector were ligated (Quick Ligation Kit, NEB) and transformed into E. coli DH5α cells.

    Article Title: Rv2346c enhances mycobacterial survival within macrophages by inhibiting TNF-α and IL-6 production via the p38/miRNA/NF-κB pathway
    Article Snippet: The PCR product was cut and purified via DNA gel extraction kit (AXYGEN, NY, USA). .. The purified PCR product and pET-30a( + ) (Novagen, Germany) were digested with NdeI and HindIII (NEB) (Thermo Scientific, DE, USA) and ligated together with T4 DNA ligase (Thermo Scientific). .. The pET-30a( + ) vector containing the Rv2346c-encoding gene was transformed by electroporation into E. coli strain BL21(DE3) (Novagen) and the cells were subsequently grown on Luria-Bertani (LB) agar plates containing 50 µg/ml kanamycin at 37 °C overnight.

    Article Title: Comparative Analyses of Two Thermophilic Enzymes Exhibiting both ?-1,4 Mannosidic and ?-1,4 Glucosidic Cleavage Activities from Caldanaerobius polysaccharolyticus
    Article Snippet: The pET-28a vector and the pET-46b EK/LIC cloning kit were obtained from Novagen (San Diego, CA). .. The NdeI, XhoI, and DpnI restriction endonucleases were purchased from New England Biolabs (Ipswich, MA).

    Agarose Gel Electrophoresis:

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: PCR for mutagenesis was carried out as follows: 95°C for 30 sec, then 18 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 30 sec, followed by a final 2 min at 68°C, then 4°C for 5 min. Amplification of the GST gene was confirmed by agarose gel electrophoresis. .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB). .. The gene was incubated with 1 unit/μl SmaI in NEBuffer 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1mM DTT, pH 7.9) for 2 hours at 25°C, then incubated with 1 unit/μl NdeI for 2 hours at 37°C.

    Article Title: Identification, Characterization, and Application of a Recombinant Antigen for the Serological Investigation of Feline Hemotropic Mycoplasma Infections
    Article Snippet: Those primers also inserted NdeI and XhoI cleavage sites at the 5′ and 3′ ends of the gene, respectively. .. The resulting PCR product (1,824 bp) was extracted from an agarose gel, digested with restriction enzymes NdeI and XhoI (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions, and ligated to the 4,690-bp XhoI-NdeI fragment of vector pMG211 ( ). .. The vector contained an ampicillin resistance gene, a salicylate-inducible promoter, and the genetic information for a C-terminal 6×His tag followed by a stop codon.

    Transgenic Assay:

    Article Title: F?rster resonance energy transfer as a tool to study photoreceptor biology
    Article Snippet: The vectors pXOP-SCFP3A-N1, pXOP-SYFP2-N1, and pXOP-SYFP2-SCFP3A were constructed for use in the generation of transgenic Xenopus laevis . .. The CMV promoter sequence in pSCFP3A-N1 and pSYFP2-N1 was removed by digestion with the restriction enzymes NdeI and NheI (New England Biolabs, Ipswich, Massachusetts) and was replaced by the PCR-amplified Xenopus rhodopsin promoter sequence.

    Ethanol Precipitation:

    Article Title: Genomic integration and ligand-dependent activation of the human estrogen receptor α in the crustacean Daphnia magna
    Article Snippet: For genomic integration, pRC21-hERa as the backbone was digested with SalI and NdeI (NewEngland BioLabs). pRC21-ERE:mCherry was digested with BssHII and NdeI (NewEngland BioLabs). .. After digestion, all three fragments were joined via MightyMix ligation (TAKARA); in the resulting construct the ERE reporter and the ER halves face opposite directions, it was termed pRC21-estrogensensor.

    Incubation:

    Article Title: Enzyme-catalyzed expressed protein ligation
    Article Snippet: 1 μl of template was incubated with 200 nM forward and reverse primers and 2 mM dNTP mix (0.5 mM each dNTP) in 50 μl reaction buffer (20 mM Tris-HCl, 2 mM MgSO4 , 10 mM KCl, 10 mM (NH4 )2 SO4 , 0.1% Triton X-100, 0.1 mg/ml BSA, pH 8.8) along with 1 μl Pfu Ultra II polymerase (Agilent). .. The amplified GST gene was isolated from the agarose gel using a gel extraction kit (Qiagen) and the ends of the gene were trimmed using the NdeI and SmaI restriction enzymes (NEB).

    Produced:

    Article Title: Structural basis for Scc3-dependent cohesin recruitment to chromatin
    Article Snippet: Scc1 constructs were cloned using the NcoI and NotI sites of a pACYC-DUET vector for co-expression with Scc3, or into vectors containing the cognate Smc head domain in their second ORF for Smc/kleisin complexes (see below). .. Codon optimised genes comprising the Smc1 and Smc3 ATPase domains were produced by gene synthesis (Thermofisher), to include C-terminal 6xHistidine tags, and ligated into the NdeI-XhoI sites of pRsf-DUET1 and pACYC-DUET1 respectively via Gibson Assembly (NEB). .. Pds5 and Wapl were cloned and expressed as described previously ( ).

    Concentration Assay:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. E. coli BL21(DE3) harboring the endolysin vector was grown in 600 mL Luria Broth (LB) supplemented with 50 µg/mL kanamycin to an optical density (OD600 nm ) of 0.6 (4 h, 120 rpm at 37°C).

    Article Title: Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes
    Article Snippet: Synthetic gene blocks (gblock) with optimized E. coli codons were synthesized by IDT (Coralville, Iowa) and cloned into the NdeI and XhoI sites of the pTYB1 (NEB) expression vector by using a Gibson assembly kit (NEB). .. After isolation of plasmids containing the correct size inserts, the inserts were sequenced to confirm the correct sequences were present coding for the wild-type REase.

    DNA Purification:

    Article Title: Cytolethal Distending Toxin Family Members Are Differentially Affected by Alterations in Host Glycans and Membrane Cholesterol
    Article Snippet: Genomic DNA was purified from mid-log-phase cultures using the Wizard DNA Purification kit (Promega, Madison, WI). .. The purified amplicons and pET15b vector were digested with NdeI and BamHI (New England Biolabs) to generate directional annealing sites.

    Lysis:

    Article Title: A Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids
    Article Snippet: The PCR amplification product was purified (DNA Clean & Concentrator-5k, Zymo Research, USA) and digested using Nde I and Xho I enzymes (NEB, UK), and cloned in the pET-28a expression vector (Novagen) with an N-terminal His6 tag. .. Recombinant protein expression was induced for 18 h at 16°C by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ndei
    Ndei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 290 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ndei/product/New England Biolabs
    Average 99 stars, based on 290 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results