mspi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MspI
    Description:
    MspI 25 000 units
    Catalog Number:
    R0106L
    Price:
    264
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mspi
    MspI
    MspI 25 000 units
    https://www.bioz.com/result/mspi/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mspi - by Bioz Stars, 2019-08
    99/100 stars

    Images

    1) Product Images from "AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping"

    Article Title: AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping

    Journal: Scientific Reports

    doi: 10.1038/srep07300

    AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.
    Figure Legend Snippet: AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.

    Techniques Used: Generated, Methylation, Polymerase Chain Reaction

    Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.
    Figure Legend Snippet: Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.

    Techniques Used: Sequencing, Sample Prep, Multiplex Assay, Methylation

    Related Articles

    Clone Assay:

    Article Title: Methyl coenzyme M reductase (mcrA) gene abundance correlates with activity measurements of methanogenic H2/CO2-enriched anaerobic biomass
    Article Snippet: The 50 μl final volume PCR reaction component concentrations were as described above and conditions for the PUC primers were: denaturing at 94°C (1 min), annealing at 55°C (1 min) and extension at 72°C (1 min), and a final extension at 72°C (10 min). .. Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA). .. Clones with unique RFLP patterns and all clones from DNA II and the cDNA library were purified using Qiaquick PCR Purification Kit (Qiagen), normalized to a concentration of 50 ng μl−1 and sequenced at the University of Chicago Cancer Research Center DNA Sequencing Facility.

    Centrifugation:

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing
    Article Snippet: After DNA purification using the QIAamp genomic DNA micro isolation kit from human brain, 2-5 μg of genomic DNA was used to carry out the MspI (New England Biolabs) digestion at 37°C for 7 hours using 20 units of enzyme per μg of DNA. .. After DNA purification using the QIAamp genomic DNA micro isolation kit from human brain, 2-5 μg of genomic DNA was used to carry out the MspI (New England Biolabs) digestion at 37°C for 7 hours using 20 units of enzyme per μg of DNA.

    Amplification:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada). .. In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada).

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Fungal rRNA was amplified using a cDNA incubation step at 50°C followed by 40 cycles of PCR with an annealing temperature of 53°C. .. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: The selective amplification reactions were based on the nine primer combinations Eco RI_2/Mse I_5 (abbreviated as ‘E2 + M5’), E2 + M6, E3 + M2, E4 + M3, E4 + M8, E6 + M7, E7 + M3, E8 + M3 and E8 + M7; each primer included three selective bases (sequences of adaptors and primers given in Table ), and the Eco RI primers were labeled with 5-FAM. .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: Association of temporomandibular dysfunction with the 102T-C polymorphism in the serotonin receptor gene in Brazilian patients
    Article Snippet: Genomic DNA was isolated from peripheral blood leukocytes using the Illustra Blood Genomic Prep Mini Spin Kit (GE Healthcare UK Limited™, UK) as per the manufacturer's protocol. .. To detect the 102T-C (GenBank NM_000621.3; rs#6313) polymorphism, nuclear DNA fragments that encompassed the polymorphic site in the HTR2A gene (MIM ID *182135) were amplified by PCR and digested with 10 U MspI (New England Biolab® ) for 2.5 h at 37°C [ ]. .. Standard polymerase chain reaction (PCR) was performed in 25 µl, containing 200 ng genomic DNA, 10 pmol of each primer, and FideliTaq™ PCR Master Mix (2x) (GE Healthcare UK Limited™, UK), as per the manufacturer's protocol.

    Article Title: A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication
    Article Snippet: Our ddRAD libraries were constructed using a method of combining a normal ddRAD-seq protocol [ ] with an amplicon tagging protocol for Access Array technology (Fluidigm, South San Francisco, CA, USA) (also see Additional file : Figure S1). .. Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ].

    Article Title: Variation in the RAD51 gene and familial breast cancer
    Article Snippet: PCR amplification conditions were 5 minutes initial denaturation at 94°C, 30 cycles of 20 seconds at 94°C/20 s at 55°C/20 s at 72°C, and 10 minutes final extension at 72°C. .. Msp I (NEB, Ipswich, MA, USA) digestion (as specified by the manufacturer) of the 205 bp PCR product yielded fragments of 89 bp and 116 bp for the wildtype G allele, with a single fragment of 205 bp for the A allele.

    Article Title: R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family
    Article Snippet: Once the candidate mutation was identified, restriction enzyme MspI (5′…C^CGG…3′) recognizing the potential mutation site was used for all 28 family members with genomic DNA available. .. The PCR amplified products were digested with MspI at 37 °C for 5 h, according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA). .. Samples were then electrophoresed on a 2% (W/V) agarose gel with 0.5 μg/ml ethidium bromide.

    Article Title: Genome-scale DNA methylome and transcriptome profiling of human neutrophils
    Article Snippet: Briefly, genomic DNA was digested overnight with MspI (New England Biolabs, Ipswich, MA), followed by end-repair and addition of 3′-A overhangs. .. These fragments were bisulfite-converted with the EZ DNA methylation kit (Zymo Research, Irvine, CA).

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB). .. After ligation of individually-barcoded adaptors [provided in ref. 104] individuals were combined into pools of 50 samples.

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: For all samples, we amplified the 16S rRNA gene using the primers GM3 (5’-AGA GTT TGA TCM TGG C-3’) and GM4 (5’-TAC CTT GTT ACG ACT T-3’) and the following PCR program: initial denaturation at 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 90 s, followed by a final extension step at 72 °C for 10 min and a final holding temperature of 4 °C. .. We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Firstly, a DNA strand of 83 bp length was PCR amplified using 15 N-labeled dCTP (Silantes) instead of unlabeled dCTP in the reaction mixture. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel.

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB). .. For the “C” or “C + mC + hmC” libraries, the aliquots of DNA without glucosylation were directly digested with HpaII or MspI (NEB), respectively.

    Polymerase Chain Reaction:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada). .. Then, the ligation fragments were purified by an AMPure XP kit (Beckman Coulter, Brea, CA, USA).

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Fungal rRNA was amplified using a cDNA incubation step at 50°C followed by 40 cycles of PCR with an annealing temperature of 53°C. .. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Each PCR was replicated once, and two aliquots of each reaction were electrophoresed independently through denaturing polyacrylamide gels (5% (v/v) Long Ranger; 36 cm in length) for 2 h at 65 W. Only reproducible fragments in the size range 100–500 bp of two replications were recorded as present (1) or absent (0). .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples
    Article Snippet: Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs). .. Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs).

    Article Title: Association of temporomandibular dysfunction with the 102T-C polymorphism in the serotonin receptor gene in Brazilian patients
    Article Snippet: Genomic DNA was isolated from peripheral blood leukocytes using the Illustra Blood Genomic Prep Mini Spin Kit (GE Healthcare UK Limited™, UK) as per the manufacturer's protocol. .. To detect the 102T-C (GenBank NM_000621.3; rs#6313) polymorphism, nuclear DNA fragments that encompassed the polymorphic site in the HTR2A gene (MIM ID *182135) were amplified by PCR and digested with 10 U MspI (New England Biolab® ) for 2.5 h at 37°C [ ]. .. Standard polymerase chain reaction (PCR) was performed in 25 µl, containing 200 ng genomic DNA, 10 pmol of each primer, and FideliTaq™ PCR Master Mix (2x) (GE Healthcare UK Limited™, UK), as per the manufacturer's protocol.

    Article Title: Variation in the RAD51 gene and familial breast cancer
    Article Snippet: PCR amplification conditions were 5 minutes initial denaturation at 94°C, 30 cycles of 20 seconds at 94°C/20 s at 55°C/20 s at 72°C, and 10 minutes final extension at 72°C. .. Msp I (NEB, Ipswich, MA, USA) digestion (as specified by the manufacturer) of the 205 bp PCR product yielded fragments of 89 bp and 116 bp for the wildtype G allele, with a single fragment of 205 bp for the A allele. .. Digested PCR products were separated on a 4% Nusieve agarose gel.

    Article Title: R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family
    Article Snippet: Once the candidate mutation was identified, restriction enzyme MspI (5′…C^CGG…3′) recognizing the potential mutation site was used for all 28 family members with genomic DNA available. .. The PCR amplified products were digested with MspI at 37 °C for 5 h, according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA). .. Samples were then electrophoresed on a 2% (W/V) agarose gel with 0.5 μg/ml ethidium bromide.

    Article Title: Association study in siblings and case-controls of serotonin- and oxytocin-related genes with high functioning autism
    Article Snippet: PCR conditions were similar to those for rs53576, but only 30 cycles were carried out at 95°C for 45 s, 66.5°C for 45 s, and 72°C at 1 min. Fifteen microliters of PCR product were run on a 3% agarose gel to distinguish the L allele (463 bp) and S allele (419 bp). .. The remaining PCR product was digested similarly as described above but with 20 U MspI (New England Biolabs, Ipswich, MA, USA). .. Visualization on 3% agarose gel allowed distinction of the G allele (bands of 61, 66, 162, 174, and 292 bp) from the A allele (61, 66, 292, and 336 bp) of rs25531.

    Article Title: Genome-scale DNA methylome and transcriptome profiling of human neutrophils
    Article Snippet: Briefly, genomic DNA was digested overnight with MspI (New England Biolabs, Ipswich, MA), followed by end-repair and addition of 3′-A overhangs. .. Briefly, genomic DNA was digested overnight with MspI (New England Biolabs, Ipswich, MA), followed by end-repair and addition of 3′-A overhangs.

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: For all samples, we amplified the 16S rRNA gene using the primers GM3 (5’-AGA GTT TGA TCM TGG C-3’) and GM4 (5’-TAC CTT GTT ACG ACT T-3’) and the following PCR program: initial denaturation at 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 90 s, followed by a final extension step at 72 °C for 10 min and a final holding temperature of 4 °C. .. We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom). .. We used GeneMapper version 5 (Life Technologies, Grand Island, NY, USA) to examine T-RFLP profiles and included peaks over 50 bp for further analysis.

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Forward primer: CTCCTCTGACTGTAACCACG, reverse primer: AGGCTTCTGGACTACCTATGC, template: CTCCTCTGACTGTAACCACGCCGGTACGTTACGATACGATTACGTAATACGATTTCGAACCGGCATAGGTAGTCCAGAAGCCT. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Subsequently, DNA was in vitro methylated with M.SssI (NEB), phenol/chloroform-purified and incubated with purified NgTet1 for 30 min as described previously .

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB). .. For the “C” or “C + mC + hmC” libraries, the aliquots of DNA without glucosylation were directly digested with HpaII or MspI (NEB), respectively.

    Picogreen Assay:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: DNA samples were further quantified through the Quant-iTTM PicoGreen® dsDNA assay kit (Invitrogen, Carisbad, CA, USA) and diluted to 60 ng/μL with 1× TE buffer prior to sequencing analysis. .. In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada).

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Paragraph title: Terminal Restriction Fragment Length Polymorphism (TRFLP) analysis of fungal rRNA ... Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: Paragraph title: Isolation of DNA and T-RFLP ... We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Electrophoresis:

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13). .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family
    Article Snippet: The amplified products were resolved by electrophoresis in 2% (w/v) agarose gels with 0.5 μg/ml ethidium bromide and visualized under ultraviolet light. .. The PCR amplified products were digested with MspI at 37 °C for 5 h, according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA).

    Incubation:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Fungal rRNA was amplified using a cDNA incubation step at 50°C followed by 40 cycles of PCR with an annealing temperature of 53°C. .. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13). .. Methylation polymorphisms at 5′-CCGG-3′ tetranucleotide sites generate differences between the Eco RI-Hpa II (H lanes) and Eco RI-Msp I (M lanes) profiles [ , ].

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. After ligation to methylated Illumina TruSeq LT v2 adaptors using Quick Ligase (New England Biolabs, M2200L), the libraries were size selected by performing a 0.75× cleanup with AMPure XP beads (Beckman Coulter, A63881).

    In Silico:

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom). .. We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Mass Spectrometry:

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Individual nucleosides were separated on an Agilent 1290 Infinity Binary LC system (Agilent technologies) using a ReproSil 100 C18 column (Jasco).

    Modification:

    Article Title: Novel genome and genome-wide SNPs reveal early fragmentation effects in an edge-tolerant songbird population across an urbanized tropical metropolis
    Article Snippet: Extracted DNA samples were eluted into molecular-grade water and stored at −20 °C. .. We prepared double digest RAD-Seq libraries for each sample based on a modified FASSST protocol developed by Tay et al . and Tin et al ., using combinatorial barcodes derived from Peterson et al . and the restriction enzymes EcoRI (NEB) and MspI (NEB). .. We conducted triplicate PCR reactions per sample to reduce the likelihood of PCR bias highlighted by Tin et al . and to maximise the yield of adapter-ligated fragments.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: The AFLP protocol used to profile the genomic DNA and cDNA was a minor modification of the one described by Vos et al. [ ]. .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    DNA Methylation Assay:

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13). .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
    Article Snippet: Global DNA methylation status was evaluated using a cytosine extension assay . .. Briefly, 1 µg of genomic DNA was digested overnight with a 10-fold excess of MspI ( C ↓ CGG; New England Biolabs, Beverly, MA), leaving an overhang at non-methylated sites.

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. After ligation to methylated Illumina TruSeq LT v2 adaptors using Quick Ligase (New England Biolabs, M2200L), the libraries were size selected by performing a 0.75× cleanup with AMPure XP beads (Beckman Coulter, A63881).

    Article Title: Genome-scale DNA methylome and transcriptome profiling of human neutrophils
    Article Snippet: Briefly, genomic DNA was digested overnight with MspI (New England Biolabs, Ipswich, MA), followed by end-repair and addition of 3′-A overhangs. .. For reduced representation of the genome, 40 to 220 bp (pre-adaptor-ligation size) were excised from 3% Nusieve agarose gels (Lonza, Basel, Switzerland) after PCR.

    Derivative Assay:

    Article Title: Novel genome and genome-wide SNPs reveal early fragmentation effects in an edge-tolerant songbird population across an urbanized tropical metropolis
    Article Snippet: Extracted DNA samples were eluted into molecular-grade water and stored at −20 °C. .. We prepared double digest RAD-Seq libraries for each sample based on a modified FASSST protocol developed by Tay et al . and Tin et al ., using combinatorial barcodes derived from Peterson et al . and the restriction enzymes EcoRI (NEB) and MspI (NEB). .. We conducted triplicate PCR reactions per sample to reduce the likelihood of PCR bias highlighted by Tin et al . and to maximise the yield of adapter-ligated fragments.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13). .. Methylation polymorphisms at 5′-CCGG-3′ tetranucleotide sites generate differences between the Eco RI-Hpa II (H lanes) and Eco RI-Msp I (M lanes) profiles [ , ].

    High Performance Liquid Chromatography:

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Individual nucleosides were separated on an Agilent 1290 Infinity Binary LC system (Agilent technologies) using a ReproSil 100 C18 column (Jasco).

    Produced:

    Article Title: Novel genome and genome-wide SNPs reveal early fragmentation effects in an edge-tolerant songbird population across an urbanized tropical metropolis
    Article Snippet: We prepared double digest RAD-Seq libraries for each sample based on a modified FASSST protocol developed by Tay et al . and Tin et al ., using combinatorial barcodes derived from Peterson et al . and the restriction enzymes EcoRI (NEB) and MspI (NEB). .. We conducted triplicate PCR reactions per sample to reduce the likelihood of PCR bias highlighted by Tin et al . and to maximise the yield of adapter-ligated fragments.

    Ligation:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada). .. Ligation of customized adapters onto the 5′ and 3′ ends of the restriction fragments by T4 ligase was subsequently carried out.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: The first PCR amplification performed with the AFLP ligation and pre-selective amplification module from PE Biosystems. .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2.

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB). .. Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB).

    Generated:

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Genomic data were generated using double-digest RAD sequencing [ ] following an in-house protocol [ ] with minor modifications. .. Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB).

    Sequencing:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: DNA samples were further quantified through the Quant-iTTM PicoGreen® dsDNA assay kit (Invitrogen, Carisbad, CA, USA) and diluted to 60 ng/μL with 1× TE buffer prior to sequencing analysis. .. In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada).

    Article Title: Methyl coenzyme M reductase (mcrA) gene abundance correlates with activity measurements of methanogenic H2/CO2-enriched anaerobic biomass
    Article Snippet: Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA). .. Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA).

    Article Title: A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication
    Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ].

    Article Title: Variation in the RAD51 gene and familial breast cancer
    Article Snippet: Forward primer AAGATGTCATGAGGAGCTTGG and reverse primer GCCATAGTCTCTCTTATCTAAACCAG spanned the Msp I site present in the wildtype sequence (and lost in the A allele). .. Msp I (NEB, Ipswich, MA, USA) digestion (as specified by the manufacturer) of the 205 bp PCR product yielded fragments of 89 bp and 116 bp for the wildtype G allele, with a single fragment of 205 bp for the A allele.

    Article Title: R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family
    Article Snippet: A comparison to a previously published wild-type reference sequence was made. .. The PCR amplified products were digested with MspI at 37 °C for 5 h, according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA).

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Paragraph title: Sampling and ddRAD sequencing ... Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB).

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: Paragraph title: Data analysis by hydroxymethylation and methylation sensitive tag sequencing (HMST-Seq) ... After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB).

    Molecular Weight:

    Article Title: Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples
    Article Snippet: Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs). .. Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs).

    Multiplexing:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada). .. Then, the ligation fragments were purified by an AMPure XP kit (Beckman Coulter, Brea, CA, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB). .. Fragments in a range of 320–500 bp were selected using Pippin Prep technology (Sage Science, Beverly, MA) and amplified in replicates of ten PCRs per pool, running for ten cycles, using a Phusion high-fidelity polymerase (NEB).

    Methylation:

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: Each PCR was replicated once, and two aliquots of each reaction were electrophoresed independently through denaturing polyacrylamide gels (5% (v/v) Long Ranger; 36 cm in length) for 2 h at 65 W. Only reproducible fragments in the size range 100–500 bp of two replications were recorded as present (1) or absent (0). .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13). .. Methylation polymorphisms at 5′-CCGG-3′ tetranucleotide sites generate differences between the Eco RI-Hpa II (H lanes) and Eco RI-Msp I (M lanes) profiles [ , ].

    Article Title: Genome-scale DNA methylation mapping of clinical samples at single-nucleotide resolution
    Article Snippet: 30 ng to 1 μg of human or mouse genomic DNA was digested with 5 to 20 units of MspI (NEB) in a 20 μl reaction for 16 to 20 hours at 37 °C. .. Digested DNA was phenol:chloroform:isoamyl alcohol purified as described above and DNA pellets were resolved in 10 μl EB buffer for end-repair.

    Article Title: Suppression of Methylation-Mediated Transcriptional Gene Silencing by ?C1-SAHH Protein Interaction during Geminivirus-Betasatellite Infection
    Article Snippet: Paragraph title: Methylation sensitive extension assay ... Briefly, 1 µg of genomic DNA was digested overnight with a 10-fold excess of MspI ( C ↓ CGG; New England Biolabs, Beverly, MA), leaving an overhang at non-methylated sites.

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2.

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: Paragraph title: Data analysis by hydroxymethylation and methylation sensitive tag sequencing (HMST-Seq) ... After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB).

    Mutagenesis:

    Article Title: R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family
    Article Snippet: Paragraph title: Mutation screening ... The PCR amplified products were digested with MspI at 37 °C for 5 h, according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA).

    Isolation:

    Article Title: Association of temporomandibular dysfunction with the 102T-C polymorphism in the serotonin receptor gene in Brazilian patients
    Article Snippet: Genomic DNA was isolated from peripheral blood leukocytes using the Illustra Blood Genomic Prep Mini Spin Kit (GE Healthcare UK Limited™, UK) as per the manufacturer's protocol. .. To detect the 102T-C (GenBank NM_000621.3; rs#6313) polymorphism, nuclear DNA fragments that encompassed the polymorphic site in the HTR2A gene (MIM ID *182135) were amplified by PCR and digested with 10 U MspI (New England Biolab® ) for 2.5 h at 37°C [ ].

    Article Title: A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication
    Article Snippet: Genomic DNA of 198–457 days post-hatch juveniles (glass eels) was isolated from muscle tissues using the QuickGene-800 extraction platform (Fujifilm, Tokyo, Japan) with a QuickGene DNA tissue kit S (DT-S). .. Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ].

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing
    Article Snippet: Figure shows a molecular level illustration of library preparation after the adaptor ligation stage. .. After DNA purification using the QIAamp genomic DNA micro isolation kit from human brain, 2-5 μg of genomic DNA was used to carry out the MspI (New England Biolabs) digestion at 37°C for 7 hours using 20 units of enzyme per μg of DNA. .. Digested DNA was purified by phenol/chloroform (p/c) extraction (49:49:2; phenol:chloroform:isoamyl alcohol).

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: Paragraph title: Isolation of DNA and T-RFLP ... We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Marker:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C. .. These restriction enzymes were chosen because they have been shown to provide statistically significant TRFLP data for interpreting fungal community structure across different samples .

    Labeling:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: The forward primer, EF3, was labeled with the phosphoramidite dye 6-Carboxyfluorescein (6-FAM) at the 5′-end (Integrated DNA Technologies, Coralville, Iowa). .. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Article Title: Rapid genomic and transcriptomic alterations induced by wide hybridization: Chrysanthemum nankingense x Tanacetum vulgare and C. crassum x Crossostephium chinense (Asteraceae)
    Article Snippet: The selective amplification reactions were based on the nine primer combinations Eco RI_2/Mse I_5 (abbreviated as ‘E2 + M5’), E2 + M6, E3 + M2, E4 + M3, E4 + M8, E6 + M7, E7 + M3, E8 + M3 and E8 + M7; each primer included three selective bases (sequences of adaptors and primers given in Table ), and the Eco RI primers were labeled with 5-FAM. .. Differential methylation of the genomic DNA was analyzed by the AFLP-based MSAP technique, based on the isoschizomeric pair Hpa II (New England Biolabs, China, EC 3.1.23.24) and Msp I (NEB, EC 3.1.23.24), in combination with Eco RI (NEB, EC 3.1.23.13).

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Stable isotope labeling of DNA modifications was performed by a series of enzymatic -reactions. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel.

    Purification:

    Article Title: Genotyping-by-Sequencing Enhances Genetic Diversity Analysis of Crested Wheatgrass [Agropyron cristatum (L.) Gaertn.]
    Article Snippet: A genetic diversity-focused GBS (gd-GBS) protocol by Peterson et al. [ ] was used for the preparation of multiplexed GBS libraries. .. In brief, for each library, 200 ng purified genomic DNA was first digested with the restriction enzyme combination Pst I and Msp I (New England Biolabs, Whitby, ON, Canada). .. Ligation of customized adapters onto the 5′ and 3′ ends of the restriction fragments by T4 ligase was subsequently carried out.

    Article Title: Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples
    Article Snippet: Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs). .. Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs).

    Article Title: A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication
    Article Snippet: Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ]. .. Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ].

    Article Title: Genome-scale DNA methylation mapping of clinical samples at single-nucleotide resolution
    Article Snippet: 30 ng to 1 μg of human or mouse genomic DNA was digested with 5 to 20 units of MspI (NEB) in a 20 μl reaction for 16 to 20 hours at 37 °C. .. 30 ng to 1 μg of human or mouse genomic DNA was digested with 5 to 20 units of MspI (NEB) in a 20 μl reaction for 16 to 20 hours at 37 °C.

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Forward primer: CTCCTCTGACTGTAACCACG, reverse primer: AGGCTTCTGGACTACCTATGC, template: CTCCTCTGACTGTAACCACGCCGGTACGTTACGATACGATTACGTAATACGATTTCGAACCGGCATAGGTAGTCCAGAAGCCT. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Subsequently, DNA was in vitro methylated with M.SssI (NEB), phenol/chloroform-purified and incubated with purified NgTet1 for 30 min as described previously .

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB). .. After digestion, the digested aliquots of DNA from all three libraries were ligated with biotinylated linker, fragmented by NlaIII, captured by streptavidin-conjugated beads, digested with MmeI to generate short sequence tags (16–17 bp), and ligated with sequencing linkers and amplified by PCR.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Three RT-PCR reactions were performed for each sample, gel extracted, and pooled using the same protocol as above. .. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C.

    Construct:

    Article Title: A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication
    Article Snippet: Our ddRAD libraries were constructed using a method of combining a normal ddRAD-seq protocol [ ] with an amplicon tagging protocol for Access Array technology (Fluidigm, South San Francisco, CA, USA) (also see Additional file : Figure S1). .. Briefly, 500 ng of DNA template from each individual was double-digested with BamHI-HF (10 units per reaction, New England Biolabs Inc., Beverly, MA, USA) and MspI (10 units per reaction, New England Biolabs Inc.) at 37°C for 1 h. We found approximately 100,000 cut sites of BamHI-HF (G|GATCC) and ~1,500,000 of MspI (C|CGG) in the current genome assembly of the Japanese eel [ ].

    Article Title: Filtrating colorectal cancer associated genes by integrated analyses of global DNA methylation and hydroxymethylation in cancer and normal tissue
    Article Snippet: Three independent libraries with initially different enzyme digestion were constructed for each sample, which were termed “C” library (c), “C + mC” library (a) and “C + mC + hmC” (b), respectively. .. After glucosylation, the aliquot of glucosylated DNA was then digested with MspI (NEB).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Forward primer: CTCCTCTGACTGTAACCACG, reverse primer: AGGCTTCTGGACTACCTATGC, template: CTCCTCTGACTGTAACCACGCCGGTACGTTACGATACGATTACGTAATACGATTTCGAACCGGCATAGGTAGTCCAGAAGCCT. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Subsequently, DNA was in vitro methylated with M.SssI (NEB), phenol/chloroform-purified and incubated with purified NgTet1 for 30 min as described previously .

    Activated Clotting Time Assay:

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: For all samples, we amplified the 16S rRNA gene using the primers GM3 (5’-AGA GTT TGA TCM TGG C-3’) and GM4 (5’-TAC CTT GTT ACG ACT T-3’) and the following PCR program: initial denaturation at 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 90 s, followed by a final extension step at 72 °C for 10 min and a final holding temperature of 4 °C. .. We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Liquid Chromatography:

    Article Title: Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation
    Article Snippet: Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel. .. Purified PCR product was MspI (NEB) digested to remove unlabeled primer sequences and PAGE purified on a non-denaturing 20% polyacrylamide gel.

    Plasmid Preparation:

    Article Title: Methyl coenzyme M reductase (mcrA) gene abundance correlates with activity measurements of methanogenic H2/CO2-enriched anaerobic biomass
    Article Snippet: Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA). .. Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA).

    Software:

    Article Title: Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces
    Article Snippet: Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37°C. .. Digests were mixed with the Applied Biosystems size marker GS600LIZ and HiDi Formamide in the ratio 1:1:9 and run on an Applied Biosystems 3730 DNA analyzer (Applied Biosystems, Carlsbad, CA).

    Article Title: Methyl coenzyme M reductase (mcrA) gene abundance correlates with activity measurements of methanogenic H2/CO2-enriched anaerobic biomass
    Article Snippet: Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA). .. Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA).

    Article Title: Variation in the RAD51 gene and familial breast cancer
    Article Snippet: Msp I (NEB, Ipswich, MA, USA) digestion (as specified by the manufacturer) of the 205 bp PCR product yielded fragments of 89 bp and 116 bp for the wildtype G allele, with a single fragment of 205 bp for the A allele. .. Digested PCR products were separated on a 4% Nusieve agarose gel.

    Real-time Polymerase Chain Reaction:

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2.

    Selection:

    Article Title: Genome-scale DNA methylation mapping of clinical samples at single-nucleotide resolution
    Article Snippet: 30 ng to 1 μg of human or mouse genomic DNA was digested with 5 to 20 units of MspI (NEB) in a 20 μl reaction for 16 to 20 hours at 37 °C. .. 30 ng to 1 μg of human or mouse genomic DNA was digested with 5 to 20 units of MspI (NEB) in a 20 μl reaction for 16 to 20 hours at 37 °C.

    Agarose Gel Electrophoresis:

    Article Title: Association study in siblings and case-controls of serotonin- and oxytocin-related genes with high functioning autism
    Article Snippet: PCR conditions were similar to those for rs53576, but only 30 cycles were carried out at 95°C for 45 s, 66.5°C for 45 s, and 72°C at 1 min. Fifteen microliters of PCR product were run on a 3% agarose gel to distinguish the L allele (463 bp) and S allele (419 bp). .. The remaining PCR product was digested similarly as described above but with 20 U MspI (New England Biolabs, Ipswich, MA, USA).

    Sampling:

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Paragraph title: Sampling and ddRAD sequencing ... Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB).

    DNA Extraction:

    Article Title: Novel genome and genome-wide SNPs reveal early fragmentation effects in an edge-tolerant songbird population across an urbanized tropical metropolis
    Article Snippet: We extracted DNA using the Exgene Clinic SV kit (GeneAll Biotechnology) per the manufacturer’s protocol for blood and body fluid DNA extraction, with minor modifications for samples stored in 100% ethanol. .. We prepared double digest RAD-Seq libraries for each sample based on a modified FASSST protocol developed by Tay et al . and Tin et al ., using combinatorial barcodes derived from Peterson et al . and the restriction enzymes EcoRI (NEB) and MspI (NEB).

    Article Title: Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples
    Article Snippet: Paragraph title: DNA isolation and restriction enzyme digestion ... Each DNA sample was subjected to sequential restriction enzyme digestion with MspI and Taqα I (New England Biolabs).

    Article Title: Methyl coenzyme M reductase (mcrA) gene abundance correlates with activity measurements of methanogenic H2/CO2-enriched anaerobic biomass
    Article Snippet: The 50 μl final volume PCR reaction component concentrations were as described above and conditions for the PUC primers were: denaturing at 94°C (1 min), annealing at 55°C (1 min) and extension at 72°C (1 min), and a final extension at 72°C (10 min). .. Clones from the first DNA extraction (DNA I library) were subjected to restriction fragment length polymorphism (RFLP) analysis with MspI , RsaI and Taqα I (New England Biolabs, Ipswich, MA, USA). .. Clones with unique RFLP patterns and all clones from DNA II and the cDNA library were purified using Qiaquick PCR Purification Kit (Qiagen), normalized to a concentration of 50 ng μl−1 and sequenced at the University of Chicago Cancer Research Center DNA Sequencing Facility.

    Article Title: Differential plant invasiveness is not always driven by host promiscuity with bacterial symbionts
    Article Snippet: Nodules were crushed using liquid nitrogen, and DNA was extracted using Mo Bio PowerPlant® DNA Isolation kits following the protocol of the manufacturer (Mo Bio Laboratories, Inc., Carlsbad, CA, USA). .. We digested the PCR product using the restriction enzyme MspI (New England BioLabs) in 30 μl reaction mixtures, and analysed the fragment sizes using a 3130×l genetic analyzer (Applied Biosystems, Warrington, United Kingdom).

    Concentration Assay:

    Article Title: Differential DNA Methylation Analysis without a Reference Genome
    Article Snippet: For RRBS, 100 ng of genomic DNA was digested for 12 hr at 37°C with 20 units of MspI (New England Biolabs, R0106L) in 30 μl of 1× NEB buffer 2. .. After ligation to methylated Illumina TruSeq LT v2 adaptors using Quick Ligase (New England Biolabs, M2200L), the libraries were size selected by performing a 0.75× cleanup with AMPure XP beads (Beckman Coulter, A63881).

    DNA Purification:

    Article Title: BisQC: an operational pipeline for multiplexed bisulfite sequencing
    Article Snippet: Figure shows a molecular level illustration of library preparation after the adaptor ligation stage. .. After DNA purification using the QIAamp genomic DNA micro isolation kit from human brain, 2-5 μg of genomic DNA was used to carry out the MspI (New England Biolabs) digestion at 37°C for 7 hours using 20 units of enzyme per μg of DNA. .. Digested DNA was purified by phenol/chloroform (p/c) extraction (49:49:2; phenol:chloroform:isoamyl alcohol).

    CTG Assay:

    Article Title: Association study in siblings and case-controls of serotonin- and oxytocin-related genes with high functioning autism
    Article Snippet: For HTTLPR, the primer sequences were 5′-TGC CGC TCT GAA TGC CAG CAC-3′ and 5′-GGG ATT CTG GTG CCA CCT AGA CG-3′. .. The remaining PCR product was digested similarly as described above but with 20 U MspI (New England Biolabs, Ipswich, MA, USA).

    Variant Assay:

    Article Title: Variation in the RAD51 gene and familial breast cancer
    Article Snippet: The RAD51 c.449G > A (p.Arg150Gln) variant was screened using PCR and restriction fragment length polymorphism analysis. .. Msp I (NEB, Ipswich, MA, USA) digestion (as specified by the manufacturer) of the 205 bp PCR product yielded fragments of 89 bp and 116 bp for the wildtype G allele, with a single fragment of 205 bp for the A allele.

    Fluorescence In Situ Hybridization:

    Article Title: Multispecies Outcomes of Sympatric Speciation after Admixture with the Source Population in Two Radiations of Nicaraguan Crater Lake Cichlids
    Article Snippet: Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB). .. Briefly, for each individual 600 ng DNA template were digested with the restriction enzymes PstI-HF (NEB) and MspI (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs mspi
    AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by <t>EcoRI.</t> The HpaII-methylation adapter has a HpaII-compatible sticky end, and the <t>MspI-methylation</t> adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.
    Mspi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mspi/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mspi - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.

    Journal: Scientific Reports

    Article Title: AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping

    doi: 10.1038/srep07300

    Figure Lengend Snippet: AFSM adapters and primers. (a, c) Sequences of three different types of double-stranded AFSM adapters. The barcode adapter terminates with a 5-bp barcode at the 3′ end of its top stand and a 5-bp overhang at the 5′ end of its bottom strand that is complementary to the sticky end generated by EcoRI. The HpaII-methylation adapter has a HpaII-compatible sticky end, and the MspI-methylation adapter has a MspI-compatible sticky end. (b) PCR primer sequences for EcoRI-HpaII. (d) PCR primer sequences for EcoRI-MspI.

    Article Snippet: In the first reaction, genomic DNA (200 ng) was digested in a 20 μl reaction volume of NEB Buffer 4 with 10 U of EcoRI (New England BioLabs Inc., Ipswich, MA, R0101) and 10 U of MspI (New England BioLabs Inc., Ipswich, MA, R0106).

    Techniques: Generated, Methylation, Polymerase Chain Reaction

    Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.

    Journal: Scientific Reports

    Article Title: AFSM sequencing approach: a simple and rapid method for genome-wide SNP and methylation site discovery and genetic mapping

    doi: 10.1038/srep07300

    Figure Lengend Snippet: Preparation and sequencing of AFSM tags. Sample preparation for AFSM genotyping is accomplished by combining two restriction enzyme pairs (EcoRI-MspI and EcoRI-HpaII) to digest genomic DNA and incorporating barcodes for multiplex sequencing. EcoRI is used as a rare cutter, and the methylation-retraction enzymes HpaII and MspI are employed as frequent cutters. HpaII and MspI have different sensitivities to methylation of the inner or outer cytosines and can produce different products, reflecting the different methylation states of the cytosines.

    Article Snippet: In the first reaction, genomic DNA (200 ng) was digested in a 20 μl reaction volume of NEB Buffer 4 with 10 U of EcoRI (New England BioLabs Inc., Ipswich, MA, R0101) and 10 U of MspI (New England BioLabs Inc., Ipswich, MA, R0106).

    Techniques: Sequencing, Sample Prep, Multiplex Assay, Methylation