dsdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    M13mp18 RF I DNA
    Description:
    M13mp18 RF I DNA 10 ug
    Catalog Number:
    N4018S
    Price:
    87
    Category:
    Genomic DNA
    Size:
    10 ug
    Buy from Supplier


    Structured Review

    New England Biolabs dsdna
    M13mp18 RF I DNA
    M13mp18 RF I DNA 10 ug
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2021-05
    95/100 stars

    Images

    1) Product Images from "RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants"

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18122546

    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Figure Legend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Techniques Used: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    2) Product Images from "Dna2 Exhibits a Unique Strand End-dependent Helicase Function"

    Article Title: Dna2 Exhibits a Unique Strand End-dependent Helicase Function

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.165191

    Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely
    Figure Legend Snippet: Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely

    Techniques Used: Activity Assay

    3) Product Images from "Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection"

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection

    Journal: Nature Communications

    doi: 10.1038/s41467-020-18615-1

    Effect of reporter sequences on trans-cleavage activity, the proposed mechanism of crRNA end processing, enzyme kinetics, and binding affinity of LbCas12a with modified crGFP. a Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. b Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5′-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3′overhang. c Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. d Enzyme kinetic data of LbCas12a with crGFP vs. crGFP + 3′DNA7. e Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP + 3′DNA7. For this assay, 100 nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. Error bars represent mean ± SD, where n = 3 technical replicates. f Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every 5 min and quenched with 6× SDS-containing loading dye. g Dissociation constants of crGFP vs. crGFP + 3′DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R2 > 0.9. Error bars represent ± SD, where n = 5 independent dilutions. Source data are available in the Source Data file.
    Figure Legend Snippet: Effect of reporter sequences on trans-cleavage activity, the proposed mechanism of crRNA end processing, enzyme kinetics, and binding affinity of LbCas12a with modified crGFP. a Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. b Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5′-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3′overhang. c Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. d Enzyme kinetic data of LbCas12a with crGFP vs. crGFP + 3′DNA7. e Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP + 3′DNA7. For this assay, 100 nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. Error bars represent mean ± SD, where n = 3 technical replicates. f Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every 5 min and quenched with 6× SDS-containing loading dye. g Dissociation constants of crGFP vs. crGFP + 3′DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R2 > 0.9. Error bars represent ± SD, where n = 5 independent dilutions. Source data are available in the Source Data file.

    Techniques Used: Activity Assay, Binding Assay, Modification, Labeling, Polyacrylamide Gel Electrophoresis, Kinetic Assay

    4) Product Images from "Characterization of the Endonuclease and ATP-dependent Flap Endo/Exonuclease of Dna2 *"

    Article Title: Characterization of the Endonuclease and ATP-dependent Flap Endo/Exonuclease of Dna2 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.243071

    Dna2 has endonuclease activity. A , nuclease assays were performed as described under “Experimental Procedures.” Briefly, 50 fmol of yeast Dna2 was incubated with 500 ng of M13mp18 phage ssDNA and MgCl 2 , MnCl 2 , and ATP as indicated for
    Figure Legend Snippet: Dna2 has endonuclease activity. A , nuclease assays were performed as described under “Experimental Procedures.” Briefly, 50 fmol of yeast Dna2 was incubated with 500 ng of M13mp18 phage ssDNA and MgCl 2 , MnCl 2 , and ATP as indicated for

    Techniques Used: Activity Assay, Incubation

    Replication protein A inhibits Dna2 endonuclease. A , endonuclease reactions were performed as described under “Experimental Procedures.” Briefly, RPA, 0, 0.75 μg, or 1.5 μg, was incubated with 100 ng of M13mp18 ssDNA in
    Figure Legend Snippet: Replication protein A inhibits Dna2 endonuclease. A , endonuclease reactions were performed as described under “Experimental Procedures.” Briefly, RPA, 0, 0.75 μg, or 1.5 μg, was incubated with 100 ng of M13mp18 ssDNA in

    Techniques Used: Recombinase Polymerase Amplification, Incubation

    5) Product Images from "Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection"

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection

    Journal: bioRxiv

    doi: 10.1101/2020.04.13.036079

    Mechanism and kinetics of LbCas12a trans-cleavage with modified crGFP. (a) Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5’-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3’overhang. (b) Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. (c) schematic diagram of different cleavage sites in the presence and absence of activator GFP. (c) Enzyme kinetic data of LbCas12a with crGFP vs. crGFP+3’DNA7. (d) Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP+3’DNA7. For this assay, 100nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. (e) Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every five minutes and quenched with 6X SDS-containing loading dye. (f) Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. (g) Comparison of trans-cleavage activity between precursor crRNA (pre-crRNA) and mature crRNA (tru-crRNA, where the first Uracil on the 5’-end of the crRNA is cleaved by LbCas12a in the absence of the activator). (h) Comparison of trans-cleavage activity between AT-rich extensions and GC-rich extensions of the crRNA. (i) Dissociation constants of crGFP vs. crGFP+3’DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R 2 > 0.9. (j) Trans-cleavage activity of different variants of Cas12a. The prefix Lb, As, and Fn stand for Lachnospiraceae bacterium, Acidaminococcus, and Francisella novicida, respectively. (k) Single-point mutations (m1-m20) on the target strand of a dsDNA GFP activator. The heat map displays relative fluorescence intensity normalized to wild-type (WT) activator after 3 hours. Error bars represent ± SEM, where n = 6 replicates. The experiments were repeated at least twice with n = 3 per experiment.
    Figure Legend Snippet: Mechanism and kinetics of LbCas12a trans-cleavage with modified crGFP. (a) Interactions of fluorescently labeled crRNAs with LbCas12a and dsDNA activator, characterized by PAGE analysis. In the absence of the activator, the modified crRNA (pre-crRNA) is trimmed by LbCas12a on its 5’-end (the first Uracil is cleaved, so-called truncated-crRNA or tru-crRNA). In the presence of the activator, the crRNA extensions are further trimmed, possibly leaving a 3’overhang. (b) Schematic diagram of putative processing of crRNA cleavage sites in the presence and absence of activator GFP. (c) schematic diagram of different cleavage sites in the presence and absence of activator GFP. (c) Enzyme kinetic data of LbCas12a with crGFP vs. crGFP+3’DNA7. (d) Michaelis-Menten kinetic study of the wild-type crGFP vs. crGFP+3’DNA7. For this assay, 100nM of LbCas12a, 100 nM of crRNA, and 7.4 nM of GFP fragment were used. (e) Time-dependent cis-cleavage of LbCas12a on GFP in the presence of nonspecific ssDNA M13mp18. The reaction mixture was taken out every five minutes and quenched with 6X SDS-containing loading dye. (f) Effect of different types of fluorophore-quencher systems on trans-cleavage activity with various modifications of crRNA. (g) Comparison of trans-cleavage activity between precursor crRNA (pre-crRNA) and mature crRNA (tru-crRNA, where the first Uracil on the 5’-end of the crRNA is cleaved by LbCas12a in the absence of the activator). (h) Comparison of trans-cleavage activity between AT-rich extensions and GC-rich extensions of the crRNA. (i) Dissociation constants of crGFP vs. crGFP+3’DNA7. The Kd was determined by the biolayer interferometry binding kinetic assay with R 2 > 0.9. (j) Trans-cleavage activity of different variants of Cas12a. The prefix Lb, As, and Fn stand for Lachnospiraceae bacterium, Acidaminococcus, and Francisella novicida, respectively. (k) Single-point mutations (m1-m20) on the target strand of a dsDNA GFP activator. The heat map displays relative fluorescence intensity normalized to wild-type (WT) activator after 3 hours. Error bars represent ± SEM, where n = 6 replicates. The experiments were repeated at least twice with n = 3 per experiment.

    Techniques Used: Modification, Labeling, Polyacrylamide Gel Electrophoresis, Activity Assay, Binding Assay, Kinetic Assay, Fluorescence

    6) Product Images from "96-Well Polycarbonate-Based Microfluidic Titer Plate for High-Throughput Purification of DNA and RNA"

    Article Title: 96-Well Polycarbonate-Based Microfluidic Titer Plate for High-Throughput Purification of DNA and RNA

    Journal:

    doi: 10.1021/ac8002352

    (A) Fluorescence image of an ethidium-stained 3% agarose gel showing the presence of amplicons with sizes of 159, 204, 600, 500 bp for the B. subtilis, S. aureus, E. coli , λ-DNA, respectively, and 381 and 272 bp for M13mp18. The PCR products were
    Figure Legend Snippet: (A) Fluorescence image of an ethidium-stained 3% agarose gel showing the presence of amplicons with sizes of 159, 204, 600, 500 bp for the B. subtilis, S. aureus, E. coli , λ-DNA, respectively, and 381 and 272 bp for M13mp18. The PCR products were

    Techniques Used: Fluorescence, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    7) Product Images from "Dna2 Exhibits a Unique Strand End-dependent Helicase Function"

    Article Title: Dna2 Exhibits a Unique Strand End-dependent Helicase Function

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.165191

    Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely
    Figure Legend Snippet: Dna2 cannot track on a primed circular long single strand without a free 5′-end. Helicase activity was assayed as described under “Experimental Procedures.” Reactions containing 15 fmol of either ( A ) M13mp18 containing a completely

    Techniques Used: Activity Assay

    Related Articles

    Generated:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: Ink was supplied to the tip by a hypodermic needle of Popper & Sons, Inc. (N.Y. 11040 USA). .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Plasmid Preparation:

    Article Title: DNA-nanostructure-assembly by sequential spotting
    Article Snippet: Ink was supplied to the tip by a hypodermic needle of Popper & Sons, Inc. (N.Y. 11040 USA). .. DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.). .. Parallel to this, hybridization of the adapter segments in Tris-Cl buffer (100 mM Tris-Cl; 600 mM NaCl; pH 7.4) took place by heating the oligonucleotides up to 90°C for 5 minutes (see figure ) and cooling down slowly (1 K/min.).

    Labeling:

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity
    Article Snippet: For each extension assay, 2 pmol of the M13 −47 primer (New England Biolabs) was 5′-end labeled with [γ-32 P]ATP with T4 polynucleotide kinase. .. After incubating at 37°C for 1 h, unincorporated nucleotide was removed by passing the primer through a MicroSpin S-200 HR column and the labeled primer was annealed to 0.25 μg of M13mp18 DNA (New England Biolabs) by heating to 96°C and slowly cooling to room temperature; 0.5 μg of reverse transcriptase was added to the labeled template-primer complex in 25 mM Tris-HCl (pH 8.0)-75 mM KCl-8 mM MgCl2 -2 mM dithiothreitol-100 μg of bovine serum albumin per ml-10 mM CHAPS. ..

    Electrophoretic Mobility Shift Assay:

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader
    Article Snippet: .. The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs). .. The pUC19 plasmid was linearized using BamHI-HF (catalog number R3136S; New England Biolabs) or nicked with Nt.BspQI (catalog number R0644S; New England Biolabs) as previously described ( ).

    Recombinant:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Incubation:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Binding Assay:

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants
    Article Snippet: Nucleic Acid-Binding Analysis Gel-shift assays with dsDNA, ssDNA, and luc mRNA substrates were performed as described previously [ ]. .. Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min. .. The samples were then separated using 0.8% agarose gels, and stained with ethidium bromide to visualize migration shifts.

    Amplification:

    Article Title: Molecular Threading: Mechanical Extraction, Stretching and Placement of DNA Molecules from a Liquid-Air Interface
    Article Snippet: .. Preparation of long ssDNA using rolling circle amplification 10 µL of 10× reaction buffer (10× phi29 DNA Polymerase Buffer (B7020, Enzymatics, 500 mMTris-HCl, 100 mM (NH4)2SO4, 40 mM DTT, 100 mM MgCl2, pH 7.5), 1 µL of 1 nM M13mp18 template (NEB), 2.5 µL of 100 nM primer ( TCCAACGTCAAAGGGCGAAAAACC , IDT) and 1.6 µL of dNTP mix (Enzymatics N2050L) was brought to a volume of 48 µL in water. .. The mixture was put on ice, and 2 µL of phi29 DNA polymerase (10 U/µL, Enzymatics P7020-LC-L) was added.

    Cleavage Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Activity Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Concentration Assay:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Agarose Gel Electrophoresis:

    Article Title: Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection
    Article Snippet: The sample was then analyzed in either 1% agarose gel (for GFP fragments amplified from the pEGFP-C1 plasmid) pre-stained with either SYBER Gold (Invitrogen), GelRed (Biotium Inc.), or premade 15% NovexTM TBE-Urea Gel (Invitrogen). .. M13mp18 nonspecific cleavage assay Nonspecific cleavage activity of Cpf1 was activated by incubating Cpf1, crRNA, and DNA activator with a concentration of 100 nM:100 nM: 2 nM in 1× NEBuffer 2.1 buffer at 37 °C for 30 min. M13mp18 was then added to the 30 μl reaction mixture and incubated for an additional 45 min. A fraction of the reaction was taken out every 5 min, quenched in 6× purple gel loading dye (New England Biolabs Inc.), and subsequently analyzed in 1% agarose gel (Fisher Scientific) . .. Trans-cleavage reporter assay The fluorophore-quencher reporter assay was carried out following a standard clinical detection protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs dsdna
    Nucleic acid-binding activity of <t>AtUSP</t> in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 <t>dsDNA,</t> or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.
    Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsdna - by Bioz Stars, 2021-05
    95/100 stars
      Buy from Supplier

    Image Search Results


    Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Journal: International Journal of Molecular Sciences

    Article Title: RNA Chaperone Function of a Universal Stress Protein in Arabidopsis Confers Enhanced Cold Stress Tolerance in Plants

    doi: 10.3390/ijms18122546

    Figure Lengend Snippet: Nucleic acid-binding activity of AtUSP in vitro. Indicated amounts of purified recombinant AtUSP protein were incubated with either ( A ) M13mp8 ssDNA, ( B ) M13mp8 dsDNA, or ( C ) in vitro transcribed luciferase ( luc ) mRNA. To analyze the effect of AtUSP in RNA mobility and the AtUSP-RNA complexes, 0.8% agarose gels were used for gel-shift assays. Bovine serum albumin (BSA) protein (100 μg/μL) was used as a negative control. SM presents size marker from Thermo Scientific Company.

    Article Snippet: Recombinant AtUSP or BSA was incubated with ssDNA (M13mp18, NEB), dsDNA (M13mp18 RF I DNA, NEB), and luc mRNA (TriLink Biotechnologies Co., San Diego, CA, USA) in 15 μL binding buffer (10 mM Tris-HCl, pH 7.5) on ice for 30 min.

    Techniques: Binding Assay, Activity Assay, In Vitro, Purification, Recombinant, Incubation, Luciferase, Electrophoretic Mobility Shift Assay, Negative Control, Marker

    DNA-construct assembly pathway . The vector M13mp18 (7250 bp) is used to produce a DNA building unit of approximately 5 μm length with an elongated single stranded sticky end at both sides. 1 - 4: Formation of single stranded adapter oligonucleotides. 6, 7: Ligation of adapter elements to form two DNA-constructs that are capable to bind site specific. 8: Hybridization will occur spontaneously and will result in the long DNA-construct.

    Journal: Journal of Nanobiotechnology

    Article Title: DNA-nanostructure-assembly by sequential spotting

    doi: 10.1186/1477-3155-9-54

    Figure Lengend Snippet: DNA-construct assembly pathway . The vector M13mp18 (7250 bp) is used to produce a DNA building unit of approximately 5 μm length with an elongated single stranded sticky end at both sides. 1 - 4: Formation of single stranded adapter oligonucleotides. 6, 7: Ligation of adapter elements to form two DNA-constructs that are capable to bind site specific. 8: Hybridization will occur spontaneously and will result in the long DNA-construct.

    Article Snippet: DNA preparation The DNA-construct was generated by digesting 10 μg M13mp18 RF I DNA plasmid (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) simultaneously with the restriction enzymes PstI, Acc65I and BamHI (New England - BioLabs GmbH, 65926 Frankfurt a. M., Germany) in NEBuffer-3 at 37°C for 2 h. Then the enzymes were inactivated by heating the batch to 80°C for 20 minutes and finally cooling down slowly (1 K/min.).

    Techniques: Construct, Plasmid Preparation, Ligation, Hybridization

    ATPγS does not inhibit the processivity of HIV-1 reverse transcriptase. With the low deoxynucleoside triphosphate extension assay, HIV-1 reverse transcriptase's ability to extend a radiolabeled primer on single-stranded M13mp18 DNA was assessed

    Journal:

    Article Title: ATP?S Disrupts Human Immunodeficiency Virus Type 1 Virion Core Integrity

    doi: 10.1128/JVI.79.9.5557-5567.2005

    Figure Lengend Snippet: ATPγS does not inhibit the processivity of HIV-1 reverse transcriptase. With the low deoxynucleoside triphosphate extension assay, HIV-1 reverse transcriptase's ability to extend a radiolabeled primer on single-stranded M13mp18 DNA was assessed

    Article Snippet: After incubating at 37°C for 1 h, unincorporated nucleotide was removed by passing the primer through a MicroSpin S-200 HR column and the labeled primer was annealed to 0.25 μg of M13mp18 DNA (New England Biolabs) by heating to 96°C and slowly cooling to room temperature; 0.5 μg of reverse transcriptase was added to the labeled template-primer complex in 25 mM Tris-HCl (pH 8.0)-75 mM KCl-8 mM MgCl2 -2 mM dithiothreitol-100 μg of bovine serum albumin per ml-10 mM CHAPS.

    Techniques:

    The C-terminal tail of BsDnaB is critical for DNA binding. (A) Schematic of BsDnaB truncation variants used in the experiments. (B to E) EMSAs with the indicated BsDnaB variants are shown with supercoiled pUC19 (B), linear pUC19 (C), PhiX174 ssDNA (D), or M13mp18 ssDNA (E). FL denotes the full-length DnaB protein.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: The C-terminal tail of BsDnaB is critical for DNA binding. (A) Schematic of BsDnaB truncation variants used in the experiments. (B to E) EMSAs with the indicated BsDnaB variants are shown with supercoiled pUC19 (B), linear pUC19 (C), PhiX174 ssDNA (D), or M13mp18 ssDNA (E). FL denotes the full-length DnaB protein.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Binding Assay

    DNA binding by the BsDnaB 374 YXXXIXXXW 382 motif variants. (A) Schematic of BsDnaB indicating the YXXXIXXXW motif, as well as the priA S371P null suppressor mutation, in dnaB . (B) EMSA comparing wild-type BsDnaB and the YXXXIXXXW variants in binding to either PhiX174 dsDNA or ssDNA. (C) EMSA comparing wild-type BsDnaB and the YXXXIXXXW variants in binding to either M13mp18 dsDNA or ssDNA. Note that in all the EMSA reaction mixtures, a final concentration of 4 μM for each protein was used with 100 ng of ssDNA or an equal molar amount of dsDNA as described in Materials and Methods. WT, wild type; M, molecular ladder; −, negative control lacking protein.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: DNA binding by the BsDnaB 374 YXXXIXXXW 382 motif variants. (A) Schematic of BsDnaB indicating the YXXXIXXXW motif, as well as the priA S371P null suppressor mutation, in dnaB . (B) EMSA comparing wild-type BsDnaB and the YXXXIXXXW variants in binding to either PhiX174 dsDNA or ssDNA. (C) EMSA comparing wild-type BsDnaB and the YXXXIXXXW variants in binding to either M13mp18 dsDNA or ssDNA. Note that in all the EMSA reaction mixtures, a final concentration of 4 μM for each protein was used with 100 ng of ssDNA or an equal molar amount of dsDNA as described in Materials and Methods. WT, wild type; M, molecular ladder; −, negative control lacking protein.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Binding Assay, Mutagenesis, Concentration Assay, Negative Control

    DNA binding and high-order oligomerization of SaDnaB. (A) EMSA with SaDnaB and pUC19 plasmid that was either supercoiled (SC), nicked (N), or linear (L). M, molecular ladder. (B) EMSA with SaDnaB and M13mp18 in either its dsDNA or ssDNA form. (C) EMSA with SaDnaB and PhiX174 in either its dsDNA or ssDNA form. (D) SDS-polyacrylamide gel stained with Coomassie blue showing SaDnaB with (+) or without (−) glutaraldehyde (Glu.). The DNA substrates used in the reactions are indicated at the top of the gel. (E) Size exclusion chromatograph of SaDnaB without DNA, with M13mp18 ssDNA, or with PhiX174 ssDNA. The elution volume of a 158-kDa protein standard and the void volume are indicated.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: DNA binding and high-order oligomerization of SaDnaB. (A) EMSA with SaDnaB and pUC19 plasmid that was either supercoiled (SC), nicked (N), or linear (L). M, molecular ladder. (B) EMSA with SaDnaB and M13mp18 in either its dsDNA or ssDNA form. (C) EMSA with SaDnaB and PhiX174 in either its dsDNA or ssDNA form. (D) SDS-polyacrylamide gel stained with Coomassie blue showing SaDnaB with (+) or without (−) glutaraldehyde (Glu.). The DNA substrates used in the reactions are indicated at the top of the gel. (E) Size exclusion chromatograph of SaDnaB without DNA, with M13mp18 ssDNA, or with PhiX174 ssDNA. The elution volume of a 158-kDa protein standard and the void volume are indicated.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Binding Assay, Plasmid Preparation, Staining

    BsDnaB forms more-stable complexes with dsDNA than with ssDNA. (A) SDS-polyacrylamide gel showing purified BsDnaB. M, molecular ladder. (B) EMSA with BsDnaB incubated with supercoiled (SC), nicked (N), or linear (L) pUC19 plasmid. (C) EMSA comparing BsDnaB binding to M13mp18 DNA in either its double-stranded (dsDNA) or single-stranded (ssDNA) form. (D) EMSA comparing BsDnaB binding to PhiX174 DNA in either its double-stranded or single-stranded form.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: BsDnaB forms more-stable complexes with dsDNA than with ssDNA. (A) SDS-polyacrylamide gel showing purified BsDnaB. M, molecular ladder. (B) EMSA with BsDnaB incubated with supercoiled (SC), nicked (N), or linear (L) pUC19 plasmid. (C) EMSA comparing BsDnaB binding to M13mp18 DNA in either its double-stranded (dsDNA) or single-stranded (ssDNA) form. (D) EMSA comparing BsDnaB binding to PhiX174 DNA in either its double-stranded or single-stranded form.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Purification, Incubation, Plasmid Preparation, Binding Assay

    DnaB is inactivated for DNA binding after incubation with M13mp18 ssDNA. (A) Overview of experiment showing that the first incubation with M13mp18 ssDNA leads to a suspected change in the protein (DnaB*). The second incubation with PhiX174 ssDNA is then resolved on an agarose gel to test for an interaction. (B to G) The experiment was conducted with wild-type BsDnaB (B), BsDnaB 1–428 (C), BsDnaB Y374A (D), BsDnaB I378A (E), BsDnaB W382A (F), or SaDnaB (G). Free PhiX174 ssDNA and M13mp18 ssDNA are marked on the side of each gel. ss, ssDNA. The red boxes also denote the migration of PhiX174 unbound ssDNA.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: DnaB is inactivated for DNA binding after incubation with M13mp18 ssDNA. (A) Overview of experiment showing that the first incubation with M13mp18 ssDNA leads to a suspected change in the protein (DnaB*). The second incubation with PhiX174 ssDNA is then resolved on an agarose gel to test for an interaction. (B to G) The experiment was conducted with wild-type BsDnaB (B), BsDnaB 1–428 (C), BsDnaB Y374A (D), BsDnaB I378A (E), BsDnaB W382A (F), or SaDnaB (G). Free PhiX174 ssDNA and M13mp18 ssDNA are marked on the side of each gel. ss, ssDNA. The red boxes also denote the migration of PhiX174 unbound ssDNA.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Binding Assay, Incubation, Agarose Gel Electrophoresis, Migration

    Determining the oligomeric state of BsDnaB within the EMSAs. (A) Schematic of the cross-linking assay. DnaB X , high-order DnaB. (B) SDS-polyacrylamide gel stained with Coomassie blue showing BsDnaB with (+) or without (−) glutaraldehyde (Glu.). The DNA substrates used in the reactions are indicated at the top of the gel. M, molecular ladder; SC, supercoiled; N, nicked; L, linear; ss, single stranded; ds, double stranded. (C) Schematic of the SEC experiment. (D) Size exclusion chromatograph of BsDnaB without DNA, with M13mp18 ssDNA, or with PhiX174 ssDNA. The elution volume of a 158-kDa protein standard and the void volume are indicated.

    Journal: Journal of Bacteriology

    Article Title: Regulation of DNA Binding and High-Order Oligomerization of the DnaB Helicase Loader

    doi: 10.1128/JB.00286-20

    Figure Lengend Snippet: Determining the oligomeric state of BsDnaB within the EMSAs. (A) Schematic of the cross-linking assay. DnaB X , high-order DnaB. (B) SDS-polyacrylamide gel stained with Coomassie blue showing BsDnaB with (+) or without (−) glutaraldehyde (Glu.). The DNA substrates used in the reactions are indicated at the top of the gel. M, molecular ladder; SC, supercoiled; N, nicked; L, linear; ss, single stranded; ds, double stranded. (C) Schematic of the SEC experiment. (D) Size exclusion chromatograph of BsDnaB without DNA, with M13mp18 ssDNA, or with PhiX174 ssDNA. The elution volume of a 158-kDa protein standard and the void volume are indicated.

    Article Snippet: The DNA substrates used for the electrophoretic mobility shift assays (EMSAs) were commercially purchased as follows: pUC19 (catalog number SD0061; Thermo Fisher), M13mp18 ssDNA (catalog number N4040S; New England Biolabs), M13mp18 RF I (catalog number N4018S; New England Biolabs), PhiX174 ssDNA (catalog number N3023S; New England Biolabs), and PhiX174 RF I (catalog number N3021S; New England Biolabs).

    Techniques: Staining