dna ladder bands  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    1 kb DNA Ladder - 1,000 gel lanes
    Description:

    Catalog Number:
    N3232L
    Price:
    None
    Buy from Supplier


    Structured Review

    New England Biolabs dna ladder bands

    https://www.bioz.com/result/dna ladder bands/product/New England Biolabs
    Average 90 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    dna ladder bands - by Bioz Stars, 2019-09
    90/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: PCR1 to PCR5 indicate the diagnostic PCRs (shown in panel B). (B) Diagnostic PCRs validating the replacement of the pgm2 locus with the DHFR cassette in both the RHΔku80 and Δprp1 background. .. M represents 1-kb DNA ladder (NEB).

    Amplification:

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Primers used for amplification of dystrophin and human glyceraldehyde-3-phosphate dehydrogenase mRNAs are demonstrated in . .. As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Article Title: An IPTG Inducible Conditional Expression System for Mycobacteria
    Article Snippet: Restriction enzymes, 1kb DNA ladder were obtained from New England Biolabs, Hygromycin B was obtained from Roche, IPTG was purchased from SIGMA, Hybond membrane and chemiluminescence Western blot kits were from GE Healthcare, 0.1 mm Zirconia beads and Mini bead beater were from Biospec products. .. Ltd. or Abexome Biosciences.

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: Genomic DNA samples (2 ng) were amplified by PCR using HotStarTaq DNA Polymerase kit (Qiagen) with a recipe of: 2.5 μL 10x PCR buffer (final MgCl2 of 1.5 mM); 0.5 μL 10 mM dNTPs; 0.125 μL DNA polymerase; 0.5 μL 10 μM primer stock, and nuclease free water (Ambion, TX, USA) to a 25 μL final volume. .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs).

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: Before the labeling reaction, the 16S rRNA gene PCR products (amplified as described above) were treated with 3 U exonuclease I (New England BioLabs, Ipswich, MA) and 8 U shrimp alkaline phosphatase (USB, Cleveland, OH) at 37°C for 2 h and inactivated at 80°C for 15 min. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    Lambda DNA Preparation:

    Article Title: Ability of Polyphosphate and Nucleic Acids to Trigger Blood Clotting: Some Observations and Caveats
    Article Snippet: Phospholipid vesicles were made by sonication using phospholipids from Avanti Polar Lipids (85% 1-palmitoyl-2-oleoyl-sn -glycero-3-phosphocholine/15% 1-palmitoyl-2-oleoyl-sn -glycero-3-L-serine). .. Calf intestinal alkaline phosphatase (CIAP) was from Promega and bacteriophage lambda DNA, and DNA ladder were from New England Biolabs. .. SYBR Green I was from FMC BioProducts.

    Construct:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Either the wild-type strain N2 or the unc-119 mutant strain EG4322 animals were injected with 2–50 ng/μl of each construct in combination with one of the following injection markers: 5ng/μl pCFJ90 (Pmyo-2>mCherry ), or 5ng/μl pPD118.33 (Pmyo-2 >gfp ). .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Article Title: In vitro systems for coupling RNAP II transcription to splicing and polyadenylation
    Article Snippet: Paragraph title: 2.1. Materials for preparation of CMV-DNA constructs ... 1 kb DNA Ladder (NEB, Cat#: N3232S).

    Concentration Assay:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: HCT116–19 cells were electroporated at a concentration of 5×105 cells/100 ul in 4 mm gap cuvette (BioExpress, Kaysville, UT) with TALEN pairs −35, −28, −1/+1 and +7/8 at 2 ug and 10 ug. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis.

    Article Title: The Myb/SANT domain of the telomere-binding protein TRF2 alters chromatin structure
    Article Snippet: 5′-32 P-labeled d(TTAGGG)7 oligonucleotide (T7) was added to a final concentration of 25 nM and the reaction was incubated for an additional 30 min. .. The DNA control lane and 1-kb base pair ladder (New England Biolabs) were stained with SYBR Green, while the rest of the gel was dried and then exposed to a phosphorimage screen to detect the presence of the radioactive oligonucleotide.

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Either the wild-type strain N2 or the unc-119 mutant strain EG4322 animals were injected with 2–50 ng/μl of each construct in combination with one of the following injection markers: 5ng/μl pCFJ90 (Pmyo-2>mCherry ), or 5ng/μl pPD118.33 (Pmyo-2 >gfp ). .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)). .. The fosmid WRM0630bE03 was injected into frpr-4 (ok2376 ) animals at a concentration of 2 ng/μl.

    SYBR Green Assay:

    Article Title: The Myb/SANT domain of the telomere-binding protein TRF2 alters chromatin structure
    Article Snippet: The reaction was stopped with 1% SDS (final) and 6 μg of proteinase K. Bromophenol blue-loading dye was added and the samples were run on a 1.3% agarose gel in TBE (90 mM Tris–borate, pH 8.3, 2 mM EDTA). .. The DNA control lane and 1-kb base pair ladder (New England Biolabs) were stained with SYBR Green, while the rest of the gel was dried and then exposed to a phosphorimage screen to detect the presence of the radioactive oligonucleotide. .. In order to analyze the effect of the TRF2 DBDon nucleosomal chromatin fibers, we reconstituted DNA containing 5′-TTAGGG-3′ repeats into nucleosomal arrays.

    Two Tailed Test:

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Where appropriate, a two-tailed Student's t -test was used to determine the statistical significance of the skipping. .. As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Expressing:

    Article Title: Expression, purification and characterization of an endoglucanase from Serratia proteamaculans CDBB-1961, isolated from the gut of Dendroctonus adjunctus (Coleoptera: Scolytinae)
    Article Snippet: Kits for expression, DNA isolation and purification, as well as polymerase enzyme and Ni–NTA resin were obtained from Qiagen (Valencia, CA, USA). .. Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany).

    Western Blot:

    Article Title: An IPTG Inducible Conditional Expression System for Mycobacteria
    Article Snippet: 7H9 broth supplemented with 0.2% glycerol (v/v), 0.05% tween 80 (w/v) and 7H11 were used for the growth of mycobacteria with the addition of appropriate antibiotics and IPTG as required. .. Restriction enzymes, 1kb DNA ladder were obtained from New England Biolabs, Hygromycin B was obtained from Roche, IPTG was purchased from SIGMA, Hybond membrane and chemiluminescence Western blot kits were from GE Healthcare, 0.1 mm Zirconia beads and Mini bead beater were from Biospec products. .. Bradford reagent was obtained from Pierce Biotechnology Inc., and protease inhibitor cocktail was from Roche.

    Transformation Assay:

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Hybridization:

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Article Title: Interplay of a non-conjugative integrative element and a conjugative plasmid in the spread of antibiotic resistance via suicidal plasmid transfer from an aquaculture Vibrio isolate
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis (PFGE) and Southern hybridization ... The fragment size was inferred based on the position of the 2-Log DNA Ladder and lambda DNA-Hin dIII Digest (New England Biolabs) in the ethidium bromide-stained gel.

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation. .. The position of the ethidium bromide stained size standards was marked on the membrane with a pencil and used as reference points.

    Gas Chromatography:

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: Then we mixed 9 μ L PCR SuperMix High Fidelity, 6.25 pmoles VF2 primer (5'-TGC CAC CTG ACG TCT AAG AA-3'), 6.25 pmoles VR primer (5'-ATT ACC GCC TTT GAG TGA GC-3'), and 1 μ L colony suspension. .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Ligation:

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product. .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Northern Blot:

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: Paragraph title: Northern blotting. ... The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation.

    Generated:

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation. .. The membrane was incubated in a rotating oven at 65°C in 15 ml hybridization buffer [10 mg/ml BSA, 7% SDS, 1 mM EDTA pH 8, 30% phosphate buffer [0.684 M Na2 HPO4 , 0.316 M NaH2 PO4 )] for 30 min prior to addition of radioactive probe.

    other:

    Article Title: Inhibition of DNA Glycosylases via Small Molecule Purine Analogs
    Article Snippet: DNA ladder was purchased from New England BioLabs (Ipswich, MA).

    Article Title: Modification of gel architecture and TBE/TAE buffer composition to minimize heating during agarose gel electrophoresis
    Article Snippet: The 2-Log DNA ladder, 1 Kb DNA ladder, dsRNA ladder and siRNA ladder standards were purchased from New England Biolabs.

    Overlap Extension Polymerase Chain Reaction:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: We constructed DNA constructs using overlap-extension polymerase chain reaction (PCR), as previously described [ ]. .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Imaging:

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: The exonuclease I-shrimp alkaline phosphatase (ExoSAP)-treated PCR products were then quantified using Kodak molecular imaging software (version 4.0) based on pictures from gel electrophoresis. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    Polymerase Chain Reaction:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with the indicated restriction enzymes following the manufactures protocol. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis.

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: We diluted the reactions four-fold with water and then performed an agarose gel electrophoresis of 20 μ L of each diluted reaction using a 0.8% E-Gel® . .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product. .. The gel was imaged with 302 nm transilluminating ultraviolet light using an ethidium bromide emission filter and an exposure time of 614 milliseconds.

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: PCR products were analysed on 2% agarose gels in Tris–borate/EDTA buffer. .. As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Article Title: An IPTG Inducible Conditional Expression System for Mycobacteria
    Article Snippet: Restriction enzymes, 1kb DNA ladder were obtained from New England Biolabs, Hygromycin B was obtained from Roche, IPTG was purchased from SIGMA, Hybond membrane and chemiluminescence Western blot kits were from GE Healthcare, 0.1 mm Zirconia beads and Mini bead beater were from Biospec products. .. Ltd. or Abexome Biosciences.

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: We constructed DNA constructs using overlap-extension polymerase chain reaction (PCR), as previously described [ ]. .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: Genomic DNA samples (2 ng) were amplified by PCR using HotStarTaq DNA Polymerase kit (Qiagen) with a recipe of: 2.5 μL 10x PCR buffer (final MgCl2 of 1.5 mM); 0.5 μL 10 mM dNTPs; 0.125 μL DNA polymerase; 0.5 μL 10 μM primer stock, and nuclease free water (Ambion, TX, USA) to a 25 μL final volume. .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs).

    Article Title: Interplay of a non-conjugative integrative element and a conjugative plasmid in the spread of antibiotic resistance via suicidal plasmid transfer from an aquaculture Vibrio isolate
    Article Snippet: The position of Tn6238 DNA was determined by Southern hybridization using intA as a probe, which was obtained using PCR DIG Synthesis Kit (Roche, Basel, Switzerland) with the primer set LN005-LN006 ( ). .. The fragment size was inferred based on the position of the 2-Log DNA Ladder and lambda DNA-Hin dIII Digest (New England Biolabs) in the ethidium bromide-stained gel.

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation. .. Single-stranded probes were generated by incorporation of radioactive dATP into DNA using a unidirectional thermocycling reaction.

    Article Title: Production of Myxoma Virus Gateway Entry and Expression Libraries and Validation of Viral Protein Expression
    Article Snippet: 14 Add 4 μl of 6× gel loading buffer to each PCR sample and run 10 μl on a 1% agarose-TAE gel containing SYBR Safe DNA gel stain at a 1:6,000 to 1:10,000 dilution. .. Run 2 μl of a 1-kb DNA ladder in one lane to determine the size of the PCR products. .. 15 Once a PCR product of the correct size is identified, pick the corresponding colony from the replica plate once it has grown (6 to 8 hr is usually enough, or overnight) and inoculate 5 ml LB containing 50 μg/ml kanamycin.

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: The exonuclease I-shrimp alkaline phosphatase (ExoSAP)-treated PCR products were then quantified using Kodak molecular imaging software (version 4.0) based on pictures from gel electrophoresis. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    Sonication:

    Article Title: Ability of Polyphosphate and Nucleic Acids to Trigger Blood Clotting: Some Observations and Caveats
    Article Snippet: Calf intestinal alkaline phosphatase (CIAP) was from Promega and bacteriophage lambda DNA, and DNA ladder were from New England Biolabs. .. Calf intestinal alkaline phosphatase (CIAP) was from Promega and bacteriophage lambda DNA, and DNA ladder were from New England Biolabs.

    Injection:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Either the wild-type strain N2 or the unc-119 mutant strain EG4322 animals were injected with 2–50 ng/μl of each construct in combination with one of the following injection markers: 5ng/μl pCFJ90 (Pmyo-2>mCherry ), or 5ng/μl pPD118.33 (Pmyo-2 >gfp ). .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs). .. At experimentation all mice weighed 25–35 g and were housed under barrier conditions with 12 h light-dark cycles at 21°C and 45–60% humidity, and with access to food and water ad Libitum .

    Binding Assay:

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: To demonstrate the correct assembly of BioBrick parts using the new BioBrick vectors, we performed a colony PCR using primers that anneal to the verification primer binding sites. .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Pulsed-Field Gel:

    Article Title: Interplay of a non-conjugative integrative element and a conjugative plasmid in the spread of antibiotic resistance via suicidal plasmid transfer from an aquaculture Vibrio isolate
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis (PFGE) and Southern hybridization ... The fragment size was inferred based on the position of the 2-Log DNA Ladder and lambda DNA-Hin dIII Digest (New England Biolabs) in the ethidium bromide-stained gel.

    DNA Extraction:

    Article Title: Expression, purification and characterization of an endoglucanase from Serratia proteamaculans CDBB-1961, isolated from the gut of Dendroctonus adjunctus (Coleoptera: Scolytinae)
    Article Snippet: Kits for expression, DNA isolation and purification, as well as polymerase enzyme and Ni–NTA resin were obtained from Qiagen (Valencia, CA, USA). .. Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany).

    Nucleic Acid Electrophoresis:

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: The reaction was maintained at 95°C for 15 min followed by thermal cycling (35 cycles: 94°C for 1 min, 55 or 60°C for 1 min, 72°C for 1 min with a final extension of 72°C for 10 min). .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs). .. Primer sequences for the amplification of Mdr1a were provided by Taconic, primer sequences for the amplification of Mdr1b were designed in-house against the murine Mdr1b sequence (GenBank ID 18669) and the sequence of the disruptive neomycin cassette inserted to the Mdr1b gene sequence (Supplementary Table ).

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: The exonuclease I-shrimp alkaline phosphatase (ExoSAP)-treated PCR products were then quantified using Kodak molecular imaging software (version 4.0) based on pictures from gel electrophoresis. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    Mutagenesis:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Either the wild-type strain N2 or the unc-119 mutant strain EG4322 animals were injected with 2–50 ng/μl of each construct in combination with one of the following injection markers: 5ng/μl pCFJ90 (Pmyo-2>mCherry ), or 5ng/μl pPD118.33 (Pmyo-2 >gfp ). .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Isolation:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: DNA was isolated using the Blood and Tissue DNeasy kit (Qiagen, Hilden, Germany). .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis.

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Paragraph title: Isolation of RNA and RT–PCR ... As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs). .. At experimentation all mice weighed 25–35 g and were housed under barrier conditions with 12 h light-dark cycles at 21°C and 45–60% humidity, and with access to food and water ad Libitum .

    Article Title: Edwardsiellosis Caused by Edwardsiella ictaluri in Laboratory Populations of Zebrafish Danio rerio
    Article Snippet: Plasmids were isolated from cultures using the Spin Miniprep kit (Qiagen,, Valencia, California). .. Plasmids were digested with either EcoRI or BstZ17I and were separated by 0.6% agarose gel electrophoresis with 1-kb ladder (New England Biolabs) as the size standard.

    Negative Control:

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file. .. The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Microscopy:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Transgenic animals were created by microinjection [ ] using a Leica DMIRB inverted DIC microscope equipped with an Eppendorf Femtojet microinjection system. .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Purification:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with the indicated restriction enzymes following the manufactures protocol. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis.

    Article Title: Expression, purification and characterization of an endoglucanase from Serratia proteamaculans CDBB-1961, isolated from the gut of Dendroctonus adjunctus (Coleoptera: Scolytinae)
    Article Snippet: Kits for expression, DNA isolation and purification, as well as polymerase enzyme and Ni–NTA resin were obtained from Qiagen (Valencia, CA, USA). .. Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Paragraph title: Isolation of RNA and RT–PCR ... As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Selection:

    Article Title: Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing
    Article Snippet: The DNAs for selection (Supplementary Table S1) and sensing were purchased from Integrated DNA Technologies (Coralville, IA, USA). .. T4-DNA ligase, dNTP mix, Taq DNA polymerase and DNA ladder were from New England Biolabs.

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: Genotyping of F2-F5 generations allowed the selection of homozygous breeding pairs of FVB/B6 Mdr1a (−/−)/Mdr1b (−/−) mice and establishment of the FVB/B6 knockout colony. .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs).

    Labeling:

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: Before the labeling reaction, the 16S rRNA gene PCR products (amplified as described above) were treated with 3 U exonuclease I (New England BioLabs, Ipswich, MA) and 8 U shrimp alkaline phosphatase (USB, Cleveland, OH) at 37°C for 2 h and inactivated at 80°C for 15 min. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    IA:

    Article Title: Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing
    Article Snippet: The DNAs for selection (Supplementary Table S1) and sensing were purchased from Integrated DNA Technologies (Coralville, IA, USA). .. T4-DNA ligase, dNTP mix, Taq DNA polymerase and DNA ladder were from New England Biolabs.

    Activated Clotting Time Assay:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: Thus, our data suggest that PRP1 and PGM2 act similarly in the microneme secretion pathway, thereby eliminating any putatively compensatory function between the two proteins. .. M represents 1-kb DNA ladder (NEB).

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs). .. Isolated organ experiments conformed to schedule 1 with animals euthanised by high dose i.p. injection of sodium pentobarbital (Euthatal®) prior to surgery.

    Mouse Assay:

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: Genotyping of F2-F5 generations allowed the selection of homozygous breeding pairs of FVB/B6 Mdr1a (−/−)/Mdr1b (−/−) mice and establishment of the FVB/B6 knockout colony. .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs).

    Plasmid Preparation:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Either the wild-type strain N2 or the unc-119 mutant strain EG4322 animals were injected with 2–50 ng/μl of each construct in combination with one of the following injection markers: 5ng/μl pCFJ90 (Pmyo-2>mCherry ), or 5ng/μl pPD118.33 (Pmyo-2 >gfp ). .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)). .. The fosmid WRM0630bE03 was injected into frpr-4 (ok2376 ) animals at a concentration of 2 ng/μl.

    Article Title: Expression, purification and characterization of an endoglucanase from Serratia proteamaculans CDBB-1961, isolated from the gut of Dendroctonus adjunctus (Coleoptera: Scolytinae)
    Article Snippet: Kits for expression, DNA isolation and purification, as well as polymerase enzyme and Ni–NTA resin were obtained from Qiagen (Valencia, CA, USA). .. Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany). .. The chemicals, including the protein molecular weight markers used in the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and agarose gels analysis and the Econo gradient pump system were purchased from BioRad (Hercules, CA, USA).

    Article Title: Novel Centromeric Loci of the Wine and Beer Yeast Dekkera bruxellensis CEN1 and CEN2
    Article Snippet: Paragraph title: Supporting Information Analysis of CEN1 and CEN2 plasmids isolated from yeast transfromants through shuttling to E . coli . Amplification of CEN1 , CEN2 and CEN2 parts from the genome of different D . bruxellensis strains by PCR. The overlay for the qualitative assay of β-galactosidase (with X-Gal) on D . bruxellensis strains Y879 and Y997 grown on YP+lactose or YP+glucose. The linear presentation of plasmids P935, P1160 and P1211. Southern hybridization that illustrates the copy number of the plasmid P935 integrated into the genome of ura3 mutant Y997. Relative URA3 gene copy number in D . bruxellensis transformants carrying circular CEN1 and CEN2 plasmids. Quantitative β-galactosidase assay in D. bruxellensis transfromants. Colony morphology of Y997 on the minimal media with and without guanidine hydrochloride. Colony morphology of transformants of Y997 with replicative plasmids with CEN1 and CEN2 on the minimal media with and without guanidine hydrochloride. Plasmids and molecular-biology techniques. Oligonucleotides used in this study. The frequency of appearance of CEN loci in the D . bruxellensis CBS 2499 (Y879) genome ( http://genome.jgi.doe.gov/Dekbr2/Dekbr2.home.html ). Motifs found in D . bruxellensis CEN1 and CEN2 . Transformation efficiency of S . cerevisiae Y601 with plasmids carrying D . bruxellensis CEN1 and CEN2 . Inverted and direct repeats found in CEN1 and CEN2 . Estimation of relative URA3 gene copy number in the D . bruxellensis Y997 transformants by RT-PCR. ... The genomic DNA of the transformants was digested with Pst I (P) and hybridized with [γ-32 P] dCTP-labeled LAC4 gene. b) 1—P935; 2 - 1kb DNA ladder (NEB); 3—genomic DNA of Y997 digested with Pst I; 4—genomic DNA of Y1377 digested with Pst I; 5—genomic DNA of Y1378 digested with Pst I. (TIF) Click here for additional data file.

    Article Title: Edwardsiellosis Caused by Edwardsiella ictaluri in Laboratory Populations of Zebrafish Danio rerio
    Article Snippet: Paragraph title: Plasmid analysis ... Plasmids were digested with either EcoRI or BstZ17I and were separated by 0.6% agarose gel electrophoresis with 1-kb ladder (New England Biolabs) as the size standard.

    Software:

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Skipping efficiencies were determined from gel images by comparing the shortened dystrophin mRNAs to the intact transcript of full length in a densitometric analysis with Image J software (for patient samples) or by quantifying the skipped products with a DNA 1000 LabChip Kit on an Agilent 2100 bioanalyzer (Agilent Technologies; for hDMD mouse samples). .. As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis.

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: The exonuclease I-shrimp alkaline phosphatase (ExoSAP)-treated PCR products were then quantified using Kodak molecular imaging software (version 4.0) based on pictures from gel electrophoresis. .. A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels.

    Irradiation:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)). .. For behavioral experiments using transgenic animals carrying extrachromosomal arrays, at least two lines were analyzed.

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: Thirty to forty micograms of total RNA was separated by electrophoresis on 1.5% agarose-formaldehyde-MOPS gels. .. The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation. .. The position of the ethidium bromide stained size standards was marked on the membrane with a pencil and used as reference points.

    Co-Immunoprecipitation Assay:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: M represents 1-kb DNA ladder (NEB). .. M represents 1-kb DNA ladder (NEB).

    Recombinant:

    Article Title: An IPTG Inducible Conditional Expression System for Mycobacteria
    Article Snippet: Restriction enzymes, 1kb DNA ladder were obtained from New England Biolabs, Hygromycin B was obtained from Roche, IPTG was purchased from SIGMA, Hybond membrane and chemiluminescence Western blot kits were from GE Healthcare, 0.1 mm Zirconia beads and Mini bead beater were from Biospec products. .. Ltd. or Abexome Biosciences.

    Agarose Gel Electrophoresis:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: PCR samples were cleaned up using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and treated with the indicated restriction enzymes following the manufactures protocol. .. Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis. .. T7 Endonuclease assay was performed on amplicons of 605 bp with forward primer 5′CTGGACGGCGACGTAAACGGC and reverse primer, 5′ACCATGTGATCGCGCTTCTCG.

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: We diluted the reactions four-fold with water and then performed an agarose gel electrophoresis of 20 μ L of each diluted reaction using a 0.8% E-Gel® . .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Article Title: The Myb/SANT domain of the telomere-binding protein TRF2 alters chromatin structure
    Article Snippet: The reaction was stopped with 1% SDS (final) and 6 μg of proteinase K. Bromophenol blue-loading dye was added and the samples were run on a 1.3% agarose gel in TBE (90 mM Tris–borate, pH 8.3, 2 mM EDTA). .. The DNA control lane and 1-kb base pair ladder (New England Biolabs) were stained with SYBR Green, while the rest of the gel was dried and then exposed to a phosphorimage screen to detect the presence of the radioactive oligonucleotide.

    Article Title: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene
    Article Snippet: Where appropriate, a two-tailed Student's t -test was used to determine the statistical significance of the skipping. .. As DNA size markers, φX174-Hae III digest (TAKARA) or 2-Log DNA ladder (New England Biolab) was used for agarose gel electrophoresis. .. Real-time RT–PCR amplification was performed using a 7500 fast real-time PCR system (Applied Biosystems Inc.).

    Article Title: Edwardsiellosis Caused by Edwardsiella ictaluri in Laboratory Populations of Zebrafish Danio rerio
    Article Snippet: Supercoiled plasmids were separated by 0.6% agarose gel electrophoresis with supercoiled ladder (New England Biolabs., Ipswich, Massachusetts) as the size standard. .. Plasmids were digested with either EcoRI or BstZ17I and were separated by 0.6% agarose gel electrophoresis with 1-kb ladder (New England Biolabs) as the size standard. .. Bacterial cultures were grown to late log phase and were pelleted by centrifugation, followed by two washes with PBS at pH 7.4.

    Electrophoresis:

    Article Title: The Position of DNA Cleavage by TALENs and Cell Synchronization Influences the Frequency of Gene Editing Directed by Single-Stranded Oligonucleotides
    Article Snippet: Digested samples were loaded along with NEB 2-log DNA ladder (NEB, Ipswich, MA) into a 2% TBE agarose gel for analysis. .. Following PCR cleanup, each TALEN treated sample was placed in a thermocycler for heteroduplex formation.

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: We diluted the reactions four-fold with water and then performed an agarose gel electrophoresis of 20 μ L of each diluted reaction using a 0.8% E-Gel® . .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: Thirty to forty micograms of total RNA was separated by electrophoresis on 1.5% agarose-formaldehyde-MOPS gels. .. The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation.

    Transgenic Assay:

    Article Title: FRPR-4 Is a G-Protein Coupled Neuropeptide Receptor That Regulates Behavioral Quiescence and Posture in Caenorhabditis elegans
    Article Snippet: Transgenic animals were created by microinjection [ ] using a Leica DMIRB inverted DIC microscope equipped with an Eppendorf Femtojet microinjection system. .. The DNA mix was adjusted to a final concentration of 150 ng/μl by adding 1 kb DNA ladder (New England Biolabs) or the plasmid pCFJ151 (unc-119 (+)).

    Incubation:

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product. .. Reagents for all restriction digest, dephophorylation, and ligation reactions were purchased from New England Biolabs, Inc., Ipswich, MA.

    Article Title: The Myb/SANT domain of the telomere-binding protein TRF2 alters chromatin structure
    Article Snippet: 5′-32 P-labeled d(TTAGGG)7 oligonucleotide (T7) was added to a final concentration of 25 nM and the reaction was incubated for an additional 30 min. .. The DNA control lane and 1-kb base pair ladder (New England Biolabs) were stained with SYBR Green, while the rest of the gel was dried and then exposed to a phosphorimage screen to detect the presence of the radioactive oligonucleotide.

    Article Title: Distinct RNA degradation pathways and 3? extensions of yeast non-coding RNA species
    Article Snippet: The RNA was transferred to a nylon transfer membrane (Nytran SPC, Whatman) via capillary blotting in 10X SSC for 36 h. RNA was cross-linked to the nylon membrane by UV irradiation and baking at 80°C for 2 h. Fifteen micrograms of DNA size standard (100 bp ladder, NEB) was loaded to be used for transcript size estimation. .. The position of the ethidium bromide stained size standards was marked on the membrane with a pencil and used as reference points.

    Knock-Out:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: 10.1128/mSphere.00521-17.4 FIG S4 Generation of pgm2 knockout parasite lines. (A) Schematic representation of generating pgm2 knockouts by double homologous recombination into the RHΔku80 or Δprp1 parasite as the parent line. .. M represents 1-kb DNA ladder (NEB).

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: Genotyping of F2-F5 generations allowed the selection of homozygous breeding pairs of FVB/B6 Mdr1a (−/−)/Mdr1b (−/−) mice and establishment of the FVB/B6 knockout colony. .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs).

    Activation Assay:

    Article Title: Temporal Development of the Infant Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Children Determined by the GA-Map Infant Array
    Article Snippet: A 1-kb DNA ladder (N3232; New England BioLabs) with specified concentrations was included on all gels. .. Based on the quantification from the gel images, the PCR products were diluted to equal concentrations of 50 ng/μl/sample, and approximately 100 ng template was used in the following labeling reaction mixture: in a total reaction volume of 10 μl, 2.5 U Hot TermiPol (Solis Biodyne), 1× buffer C (Solis Biodyne), 4 mM MgCl2 (Solis Biodyne), 0.4 μM ddCTP-TAMRA (6-carboxytetramethylrhodamine) (Jena Bioscience, Jena, Germany) and 2.9 μM probe set 3 ( ).

    Thin Layer Chromatography:

    Article Title: Expression, purification and characterization of an endoglucanase from Serratia proteamaculans CDBB-1961, isolated from the gut of Dendroctonus adjunctus (Coleoptera: Scolytinae)
    Article Snippet: Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany). .. Restriction enzymes and DNA ladder were purchased from New England Biolabs (Beverly, MA, USA). pJET1.2/blunt vector was purchased from Fermentas (St Leon-Rot, Germany).

    CTG Assay:

    Article Title: Engineering BioBrick vectors from BioBrick parts
    Article Snippet: Then we mixed 9 μ L PCR SuperMix High Fidelity, 6.25 pmoles VF2 primer (5'-TGC CAC CTG ACG TCT AAG AA-3'), 6.25 pmoles VR primer (5'-ATT ACC GCC TTT GAG TGA GC-3'), and 1 μ L colony suspension. .. We also electrophoresed 1 μ g of 2-log DNA ladder (New England Biolabs, Inc., Ipswich, MA) to verify the length of each PCR product.

    Staining:

    Article Title: The Myb/SANT domain of the telomere-binding protein TRF2 alters chromatin structure
    Article Snippet: The reaction was stopped with 1% SDS (final) and 6 μg of proteinase K. Bromophenol blue-loading dye was added and the samples were run on a 1.3% agarose gel in TBE (90 mM Tris–borate, pH 8.3, 2 mM EDTA). .. The DNA control lane and 1-kb base pair ladder (New England Biolabs) were stained with SYBR Green, while the rest of the gel was dried and then exposed to a phosphorimage screen to detect the presence of the radioactive oligonucleotide. .. In order to analyze the effect of the TRF2 DBDon nucleosomal chromatin fibers, we reconstituted DNA containing 5′-TTAGGG-3′ repeats into nucleosomal arrays.

    Article Title: The Differential Absorption of a Series of P-Glycoprotein Substrates in Isolated Perfused Lungs from Mdr1a/1b Genetic Knockout Mice can be Attributed to Distinct Physico-Chemical Properties: an Insight into Predicting Transporter-Mediated, Pulmonary Specific Disposition
    Article Snippet: The reaction was maintained at 95°C for 15 min followed by thermal cycling (35 cycles: 94°C for 1 min, 55 or 60°C for 1 min, 72°C for 1 min with a final extension of 72°C for 10 min). .. DNA fragments were separated by gel electrophoresis (1.25% agarose, 80 V (6.5 V/cm) for 45 min) and visualised under UV light using EtBr staining with a 1 kb + DNA ladder (New England Biolabs). .. Primer sequences for the amplification of Mdr1a were provided by Taconic, primer sequences for the amplification of Mdr1b were designed in-house against the murine Mdr1b sequence (GenBank ID 18669) and the sequence of the disruptive neomycin cassette inserted to the Mdr1b gene sequence (Supplementary Table ).

    Article Title: Interplay of a non-conjugative integrative element and a conjugative plasmid in the spread of antibiotic resistance via suicidal plasmid transfer from an aquaculture Vibrio isolate
    Article Snippet: The fragment size was inferred based on the position of ProMega-Markers Lambda Ladders (Promega, Madison, Wisconsin) in the ethidium bromide stained gel. .. The fragment size was inferred based on the position of the 2-Log DNA Ladder and lambda DNA-Hin dIII Digest (New England Biolabs) in the ethidium bromide-stained gel.

    Homologous Recombination:

    Article Title: Two Phosphoglucomutase Paralogs Facilitate Ionophore-Triggered Secretion of the Toxoplasma Micronemes
    Article Snippet: 10.1128/mSphere.00521-17.4 FIG S4 Generation of pgm2 knockout parasite lines. (A) Schematic representation of generating pgm2 knockouts by double homologous recombination into the RHΔku80 or Δprp1 parasite as the parent line. .. M represents 1-kb DNA ladder (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    2 Log DNA Ladder 500 1000 gel lanes
      Buy from Supplier

    99
    New England Biolabs dna ladder
    Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna ladder/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    dna ladder - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    90
    New England Biolabs dna ladder bands
    Dna Ladder Bands, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna ladder bands/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna ladder bands - by Bioz Stars, 2019-09
    90/100 stars
      Buy from Supplier

    82
    New England Biolabs dna size marker
    Dna Size Marker, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna size marker/product/New England Biolabs
    Average 82 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dna size marker - by Bioz Stars, 2019-09
    82/100 stars
      Buy from Supplier

    Image Search Results