phix174 rf ii dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 rf ii dna
    Phix174 Rf Ii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    phix174 rf ii dna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 rf ii dna
    Phix174 Rf Ii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    nt φx 174 rf1 dna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs nt φx 174 rf1 dna
    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear <t>φX</t> <t>174</t> dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.
    Nt φx 174 Rf1 Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nt φx 174 rf1 dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nt φx 174 rf1 dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    1) Product Images from "RadD is a RecA-dependent accessory protein that accelerates DNA strand exchange"

    Article Title: RadD is a RecA-dependent accessory protein that accelerates DNA strand exchange

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkac041

    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear φX 174 dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.
    Figure Legend Snippet: RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear φX 174 dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.

    Techniques Used: Concentration Assay, Binding Assay

    ssdna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs ssdna
    Ssdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ssdna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ssdna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    phix174 rf ii dna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 rf ii dna
    Phix174 Rf Ii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    phi x 174 haeiii dna ladder  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phi x 174 haeiii dna ladder
    Phi X 174 Haeiii Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phi x 174 haeiii dna ladder/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phi x 174 haeiii dna ladder - by Bioz Stars, 2024-05
    92/100 stars

    Images

    phix174 rfii dna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 rfii dna
    Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use <t>PhiX174)</t> are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.
    Phix174 Rfii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rfii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rfii dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    1) Product Images from "SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing"

    Article Title: SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-110

    Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use PhiX174) are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.
    Figure Legend Snippet: Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use PhiX174) are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.

    Techniques Used: Sequencing, Generated

    phix174 rfii dna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 rfii dna
    Phix174 Rfii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rfii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rfii dna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    phix174 form ii dna dsdna  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs phix174 form ii dna dsdna
    Phix174 Form Ii Dna Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 form ii dna dsdna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 form ii dna dsdna - by Bioz Stars, 2024-05
    92/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    New England Biolabs phix174 rf ii dna
    Phix174 Rf Ii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rf ii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rf ii dna - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs nt φx 174 rf1 dna
    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear <t>φX</t> <t>174</t> dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.
    Nt φx 174 Rf1 Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nt φx 174 rf1 dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nt φx 174 rf1 dna - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs ssdna
    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear <t>φX</t> <t>174</t> dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.
    Ssdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ssdna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ssdna - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs phi x 174 haeiii dna ladder
    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear <t>φX</t> <t>174</t> dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.
    Phi X 174 Haeiii Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phi x 174 haeiii dna ladder/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phi x 174 haeiii dna ladder - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs phix174 rfii dna
    Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use <t>PhiX174)</t> are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.
    Phix174 Rfii Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 rfii dna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 rfii dna - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    92
    New England Biolabs phix174 form ii dna dsdna
    Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use <t>PhiX174)</t> are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.
    Phix174 Form Ii Dna Dsdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phix174 form ii dna dsdna/product/New England Biolabs
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    phix174 form ii dna dsdna - by Bioz Stars, 2024-05
    92/100 stars
      Buy from Supplier

    Image Search Results


    RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear φX 174 dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.

    Journal: Nucleic Acids Research

    Article Title: RadD is a RecA-dependent accessory protein that accelerates DNA strand exchange

    doi: 10.1093/nar/gkac041

    Figure Lengend Snippet: RadD stimulates RecA mediated strand exchange. ( A ) Reaction scheme. ( B ) Strand exchange reaction time courses in reactions lacking RadD or with RadD or RadD K37R added immediately after the dsDNA. Reactions contained 20 μM circular φX174 ssDNA (3.7 nM in molecules), 20 μM linear φX 174 dsDNA (1.86 nM in molecules), 3 μM RecA protein, 2.1 μM SSB, and 3.7 nM RadD protein (a 2:1 ratio of RadD molecules to linear dsDNA (ldsDNA) molecules). ( C ) Quantifications of nicked circular (nc) DNA from three independent strand exchange reactions shown in A with the average values plotted and standard deviations represented with error bars. ( D ) Strand exchange reactions carried out at the optimal 1 RecA per 3 nt cssDNA ratio in the absence or presence of RadD or RadD K37R, added immediately after the linear dsDNA. All components are at concentrations listed for panel B except that the RecA concentration is increased to 6.7 μM, a concentration sufficient to saturate the available ssDNA binding sites. ( E ) Quantifications of nc DNA from three independent strand exchange reactions shown in panel D with average values plotted and strand deviations represented.

    Article Snippet: Unless otherwise indicated, 3.3 μM RecA was incubated for 10 min. 2.1 μM SSB and 3 mM ATP were added, and the reaction was incubated for another 10 min. Each reaction was initiated by the addition of 20 μM nt φX 174 RF1 DNA (NEB # N3022L) previously digested by PstI.

    Techniques: Concentration Assay, Binding Assay

    Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use PhiX174) are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.

    Journal: BMC Genomics

    Article Title: SASI-Seq: sample assurance Spike-Ins, and highly differentiating 384 barcoding for Illumina sequencing

    doi: 10.1186/1471-2164-15-110

    Figure Lengend Snippet: Diagrammatic representation of the SASI-Seq process. Amplicons of a reference sequence (here we use PhiX174) are generated with unique barcodes at their 5’ end. Sets of amplicons with different barcodes are added to each sample that is destined for sequencing. The SASI fragments stay with the sample through library prep and can be detected after sequencing. SASI-Seq thus verifies which sample the sequence data originated from. FA, FB and FC represent the forward primers for the 214, 397 and 568 bp SASI fragments respectively, with SASI barcodes at the 5’ end shown here in red. R is the reverse SASI fragment primer also having a SASI barcode at the 5’ end, here coloured in red. Primer sequences are detailed in Methods.

    Article Snippet: The three SASI amplicons were prepared by PCR using the following primers (obtained from IDT): Forward A 214 bp fragment primers {optional barcode sequence}GGCGCTCGTCTTTGGTATGTA Forward B 397 bp fragment primers {optional barcode sequence}TGAATTGTTCGCGTTTACCTT Forward C 568 bp fragment primers {optional barcode sequence}GTACGCTGGACTTTGTAGGAT Reverse primer {reverse complement of barcode sequence}GGCGTCCATCTCGAAG Each amplification reaction comprised 1 ng of PhiX174 RFII DNA (NEB #N3022L), 200pM of appropriate forward primer, 200pM reverse primer and 1× Kapa HiFi mastermix (KK2602).

    Techniques: Sequencing, Generated