yeast inorganic pyrophosphatase yipp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Pyrophosphatase inorganic yeast
    Description:
    Pyrophosphatase inorganic yeast 50 units
    Catalog Number:
    M2403L
    Price:
    268
    Size:
    50 units
    Category:
    Other Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs yeast inorganic pyrophosphatase yipp
    Pyrophosphatase inorganic yeast
    Pyrophosphatase inorganic yeast 50 units
    https://www.bioz.com/result/yeast inorganic pyrophosphatase yipp/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    yeast inorganic pyrophosphatase yipp - by Bioz Stars, 2019-08
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs
    Article Snippet: General manipulations of H. marismortui , H. volcanii , and E. coli were performed according to standard procedures ( ; ). .. RNase T1, RNase A, RNase U2, nuclease P1, and snake venom phosphodiesterase I were from Sigma; T4 polynucleotide kinase (T4-PNK), antarctic phosphatase, calf intestinal phosphatase, and inorganic pyrophosphatase were from New England Biolabs; DNA and RNA oligonucleotides were from IDT; and oligonucleotides used for cloning, detection, and purification of tRNAs are listed in Supplemental Table S1. .. The gene for H. marismortui tRNA2 Ile was first cloned into the vector pUCsptProM ( ).

    Centrifugation:

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Luciferase:

    Article Title: NTP-mediated nucleotide excision activity of hepatitis C virus RNA-dependent RNA polymerase
    Article Snippet: The synthesis of radioactive Ap4 C, Gp4 C, Up4 C, and Cp4 C containing an [α-32 P]CMP was conducted according to the methods previously described ( , ). .. In a 50-μL reaction, 20 μCi [α-32 P]CTP and one of the NTPs (ATP, GTP, UTP, or CTP) at 2 mM were incubated for 24 h at 30 °C with 25 μg of firefly luciferase (Sigma–Aldrich) in a reaction buffer containing 50 mM Hepes (pH 7.4), 5 mM MgCl2 , 1 mg/mL BSA, 0.05 units of yeast inorganic pyrophosphatase (PPase; New England Biolabs), and 0.1 mM D-Luciferin (Sigma–Aldrich). .. In a typical assay, purified NS5B–10/20-mer elongation complex was incubated at 30 °C with one NTP or PPi for time intervals as indicated.

    Whole Genome Amplification:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Polyacrylamide Gel Electrophoresis:

    Article Title: T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures
    Article Snippet: Non-modified DNA was ordered PAGE purified. .. T7 RNAP was purchased from Cellscript (200 U/μl, Catalog # C-T7300K), SP6 RNAP from ThermoFisher Scientific (100 U/μl, Catalog # EP0133), yeast inorganic pyrophosphatase from New England Biolabs (NEB) (0.1 U/μl, Catalog # M2403S) and DNase I from NEB (2 U/μl, Catalog # M0303S).

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C. .. Transcriptions were clarified by centrifugation at 10 000g for 45 min and concentrated to 4 mL using Amicon Ultra Ultracel centrifugal concentrators according to the manufacturer’s instructions.

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB). .. For preparing 32 P-labeled RNA, in vitro transcription was performed in a 20-μL volume as above except that UTP was added to only 50 nM, and 2.5 μCi [α-32 P]UTP was added.

    Synthesized:

    Article Title: RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication
    Article Snippet: The physiological RNA primer with the sequence 5′-ppp-rGrCrCrGrA-3′ with a 5′-triphosphate moiety was synthesized using a standard run-off transcription protocol with the T7 RNA polymerase ( ). .. The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT).

    Ubiquitin Assay:

    Article Title: Intrinsic ubiquitin E3 ligase activity of histone acetyltransferase Hbo1 for estrogen receptor α
    Article Snippet: In vivo ubiquitination assay was performed as previously. ) .. For in vitro ubiquitination assay, reactions were carried out using a ubiquitinylation kit purchased from Enzo Life Sciences (Farmingdale, NY, USA) containing 2.5 µM biotinylated or non-tagged ubiquitin, 100 nM His-tagged E1, approximately 1–2.5 µM His-tagged E2, and 5 mM Mg-ATP, and 20 U/mL yeast inorganic pyrophosphatase (New England Biolabs, Ipswich, Massachusetts, USA). .. Detection was made by immunoblotting with Cy5-conjugated streptavidin (Cell Signaling Technology) or anti-ubiquitin antibody.

    Modification:

    Article Title: T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures
    Article Snippet: Modified DNA was ordered HPLC purified. .. T7 RNAP was purchased from Cellscript (200 U/μl, Catalog # C-T7300K), SP6 RNAP from ThermoFisher Scientific (100 U/μl, Catalog # EP0133), yeast inorganic pyrophosphatase from New England Biolabs (NEB) (0.1 U/μl, Catalog # M2403S) and DNase I from NEB (2 U/μl, Catalog # M0303S).

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Modified cells were subjected to FACS four to seven days after nucleofection. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Incubation:

    Article Title: NTP-mediated nucleotide excision activity of hepatitis C virus RNA-dependent RNA polymerase
    Article Snippet: The synthesis of radioactive Ap4 C, Gp4 C, Up4 C, and Cp4 C containing an [α-32 P]CMP was conducted according to the methods previously described ( , ). .. In a 50-μL reaction, 20 μCi [α-32 P]CTP and one of the NTPs (ATP, GTP, UTP, or CTP) at 2 mM were incubated for 24 h at 30 °C with 25 μg of firefly luciferase (Sigma–Aldrich) in a reaction buffer containing 50 mM Hepes (pH 7.4), 5 mM MgCl2 , 1 mg/mL BSA, 0.05 units of yeast inorganic pyrophosphatase (PPase; New England Biolabs), and 0.1 mM D-Luciferin (Sigma–Aldrich). .. In a typical assay, purified NS5B–10/20-mer elongation complex was incubated at 30 °C with one NTP or PPi for time intervals as indicated.

    Article Title:
    Article Snippet: Briefly, the indicated conditions were pipetted into BSA-precoated tubes containing an estimated 30 nM SYNAC and 0.05 U inorganic pyrophosphatase (from Escherichia coli; New England Biolabs, Ipswich, MA). .. Either 500 μ M or 1 mM ATP was added to initiate the reaction.

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: DNA was degraded with 4 U DNase (turboDNase, Ambion) for 20 min at 37°C, and the size and integrity of RNA transcripts was verified by electrophoresis on 1% agarose gels before purification on filter cartridges (MegaClear, Ambion) and elution in H2 O. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C. .. DNA was digested with 15 U/ml DNase (RQ1 RNase free DNase, Promega) for 2 h at 37°C.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Plasmid DNA was amplified by adding 1 μL of 10 μM Exo-Resistant Random Primer (Thermo Scientific), 2 μL phi29 DNA Polymerase Reaction Buffer (New England Biolabs) and 8.2 μL of MilliQ water to 5 μL of the purified treated DNA. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Transformants were plated on LB agar plates with one of the following antibiotics: ampicillin (32 mg/L), tetracycline (16 mg/L), kanamycin (25 mg/L), cefotaxime (16 mg/L), colistin (16 mg/L), ciprofloxacin (16 mg/L).

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB). .. For preparing 32 P-labeled RNA, in vitro transcription was performed in a 20-μL volume as above except that UTP was added to only 50 nM, and 2.5 μCi [α-32 P]UTP was added.

    Amplification:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Plasmid DNA was amplified by adding 1 μL of 10 μM Exo-Resistant Random Primer (Thermo Scientific), 2 μL phi29 DNA Polymerase Reaction Buffer (New England Biolabs) and 8.2 μL of MilliQ water to 5 μL of the purified treated DNA. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Transformants were plated on LB agar plates with one of the following antibiotics: ampicillin (32 mg/L), tetracycline (16 mg/L), kanamycin (25 mg/L), cefotaxime (16 mg/L), colistin (16 mg/L), ciprofloxacin (16 mg/L).

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Linear DNA templates for run-off transcription of RNA-IN (nucleotides 1–160) or RNA-OUT (nucleotides 1–69) were amplified from pDH602 ( ) by PCR with primers JR1/JR2-2 or JR3/JR4, respectively; note that, for each primer pair, the forward primer includes the T7 core promoter. .. Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB).

    Activity Assay:

    Article Title:
    Article Snippet: Paragraph title: Cyclase Activity. ... Briefly, the indicated conditions were pipetted into BSA-precoated tubes containing an estimated 30 nM SYNAC and 0.05 U inorganic pyrophosphatase (from Escherichia coli; New England Biolabs, Ipswich, MA).

    Knock-In:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Paragraph title: Detection of knock-in blunt ligation and homologous recombination ... Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Activated Clotting Time Assay:

    Article Title: RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication
    Article Snippet: The double-stranded DNA template containing the region from –17 to –1 of the class III T7 RNA polymerase promoter followed by the complement of the desired RNA sequence was prepared from synthetic DNA oligonucleotides (IDT; promoter, 5′-GAA ATT AAT ACG ACT CAC TAT A-3′; template, 5′-TCG GCT ATA GTG AGT CGT ATT AAT TTC-3′) annealed by heating at > 80 °C for 3 min and cooling gradually in the presence of 0.1 M NaCl. .. The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT).

    Article Title: RNAs synthesized using photocleavable biotinylated nucleotides have dramatically improved catalytic efficiency
    Article Snippet: The T7 RNAP promoter sequence was 5′-CTA ATA CGA CTC ACT ATA G-3′. .. The transcription conditions for each RNA were optimized by varying the [A/C/UTPs] and ratio of [GTP]/[biotin-PC GMP] in transcription buffer B [40 mM Tris–HCl (pH 8.1), 1 mM spermidine, 10 mM dithiothreitol (DTT), 0.01% Triton X-100, 80 mg/ml PEG 8000, 0.2 U of RNase inhibitor (New England Biolabs), 0.2 U of inorganic pyrophosphatase (New England Biolabs)] containing 15 mM Mg2+ , 300 nM of each DNA strand and 1 μl of 4 mg/ml T7 RNAP per 20 μl of transcription volume.

    High Performance Liquid Chromatography:

    Article Title: T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures
    Article Snippet: Modified DNA was ordered HPLC purified. .. T7 RNAP was purchased from Cellscript (200 U/μl, Catalog # C-T7300K), SP6 RNAP from ThermoFisher Scientific (100 U/μl, Catalog # EP0133), yeast inorganic pyrophosphatase from New England Biolabs (NEB) (0.1 U/μl, Catalog # M2403S) and DNase I from NEB (2 U/μl, Catalog # M0303S).

    Ligation:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Paragraph title: Detection of knock-in blunt ligation and homologous recombination ... Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Protease Inhibitor:

    Article Title: CTD-dependent and -independent mechanisms govern co-transcriptional capping of Pol II transcripts
    Article Snippet: Bovine serum albumin (20 mg/ml, cat. no. B9000S), 2x RNA loading dye (cat. no. B0363S), and yeast inorganic pyrophosphatase (100 units/ml, cat. no. NEBM2403S) were from New England Biolabs. .. Bovine serum albumin (20 mg/ml, cat. no. B9000S), 2x RNA loading dye (cat. no. B0363S), and yeast inorganic pyrophosphatase (100 units/ml, cat. no. NEBM2403S) were from New England Biolabs.

    Generated:

    Article Title: Functional screen reveals SARS coronavirus nonstructural protein nsp14 as a novel cap N7 methyltransferase
    Article Snippet: RNA substrates representing the 5′-terminal 259 nucleotides of the SARS-CoV genome were in vitro transcribed from PCR products generated using the primers 5′- CAG TAATACGACTCACTATTA GATTAGGTTTTTACCTACCCAG-3′ and 5′-CTTTCGGTCACACCCGGAC. .. RNAs containing 32 P-labeled cap structures (m7G*pppA or m7G*pppG and G*pppA or G*pppG) were prepared using a vaccinia virus capping enzyme following the manufacturer's protocol (Epicentre), except that the methyl donor SAM was absent for preparing the G*pppA/G*pppG-RNA, and inorganic pyrophosphatase (0.05 units) (New England Biolabs) was added to enhance the yield of 32 P-labeled G*pppA/G*pppG-RNA ( ) because the capping reaction is reversible in the absence of the methyl donor SAM.

    Polymerase Chain Reaction:

    Article Title: Structure probing of tmRNA in distinct stages of trans-translation
    Article Snippet: The forward PCR amplification primer, 5′-GGTACCGAAATTAATACGACTCACTATAGGGGCTGATTCTGGATTCGACGG, introduced a T7 promoter into the PCR product, and the 5′-TGGTGGAGCTGGCGGGAGTTGAACC oligo was used as a reverse primer. .. The transcription reaction was carried out according to in 4 mL of 200 mM HEPES (pH 7.5), 30 mM MgCl2 , 30 mM DTE, 2 mM spermidine, 7 mM ATP, UTP, CTP, and GTP, 1 nmol PCR DNA, 0.3 U/μL RNA-guard, 2 U/mL inorganic pyrophosphatase, and 0.01 mg/mL T7 RNA polymerase. .. After a 4 h incubation, the reaction was extracted twice with phenol/chloroform and ethanol precipitated.

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Article Title: Functional screen reveals SARS coronavirus nonstructural protein nsp14 as a novel cap N7 methyltransferase
    Article Snippet: RNA substrates representing the 5′-terminal 259 nucleotides of the SARS-CoV genome were in vitro transcribed from PCR products generated using the primers 5′- CAG TAATACGACTCACTATTA GATTAGGTTTTTACCTACCCAG-3′ and 5′-CTTTCGGTCACACCCGGAC. .. RNAs containing 32 P-labeled cap structures (m7G*pppA or m7G*pppG and G*pppA or G*pppG) were prepared using a vaccinia virus capping enzyme following the manufacturer's protocol (Epicentre), except that the methyl donor SAM was absent for preparing the G*pppA/G*pppG-RNA, and inorganic pyrophosphatase (0.05 units) (New England Biolabs) was added to enhance the yield of 32 P-labeled G*pppA/G*pppG-RNA ( ) because the capping reaction is reversible in the absence of the methyl donor SAM.

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: PCR products were purified from 1% agarose gels using Qiagen Gel Extraction kits, according to the manufacturer’s protocol. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: A 50 μL reaction composed of 20 μL DNA, 24 μL MilliQ water, 1 μL ATP, 2.5 μL reaction buffer, and 2.5 μL plasmid-safe DNase was incubated at 37°C overnight and deactivated at 70°C for 30 min. Amplification of the 16S rRNA genes by PCR as previously described was performed to ensure the ratio of plasmid:chromosomal DNA is was reversed in the sample, i.e., high plasmid to low chromosomal DNA ratio. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells.

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Linear DNA templates for run-off transcription of RNA-IN (nucleotides 1–160) or RNA-OUT (nucleotides 1–69) were amplified from pDH602 ( ) by PCR with primers JR1/JR2-2 or JR3/JR4, respectively; note that, for each primer pair, the forward primer includes the T7 core promoter. .. Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB).

    Binding Assay:

    Article Title: Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs
    Article Snippet: Background (obtained from reactions run without tRNA) was subtracted from all values unless otherwise noted. .. Quantitative aminoacylation of purified H. marismortui isoleucine tRNAs for ribosome binding assays were carried out with purified E. coli IleRS; for this, reactions were allowed to proceed for 2 h, and inorganic pyrophosphatase was added at a final concentration of 0.04 units/μL. .. After aminoacylation, tRNAs were extracted with acid phenol and precipitated with ethanol.

    Staining:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Article Title: RNAs synthesized using photocleavable biotinylated nucleotides have dramatically improved catalytic efficiency
    Article Snippet: The transcription conditions for each RNA were optimized by varying the [A/C/UTPs] and ratio of [GTP]/[biotin-PC GMP] in transcription buffer B [40 mM Tris–HCl (pH 8.1), 1 mM spermidine, 10 mM dithiothreitol (DTT), 0.01% Triton X-100, 80 mg/ml PEG 8000, 0.2 U of RNase inhibitor (New England Biolabs), 0.2 U of inorganic pyrophosphatase (New England Biolabs)] containing 15 mM Mg2+ , 300 nM of each DNA strand and 1 μl of 4 mg/ml T7 RNAP per 20 μl of transcription volume. .. After 4 h, 0.2 U of Turbo DNase (Ambion) were added and the samples were incubated for another 15 min.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells.

    In Vivo:

    Article Title: Intrinsic ubiquitin E3 ligase activity of histone acetyltransferase Hbo1 for estrogen receptor α
    Article Snippet: In vivo ubiquitination assay was performed as previously. ) .. For in vitro ubiquitination assay, reactions were carried out using a ubiquitinylation kit purchased from Enzo Life Sciences (Farmingdale, NY, USA) containing 2.5 µM biotinylated or non-tagged ubiquitin, 100 nM His-tagged E1, approximately 1–2.5 µM His-tagged E2, and 5 mM Mg-ATP, and 20 U/mL yeast inorganic pyrophosphatase (New England Biolabs, Ipswich, Massachusetts, USA).

    Radioactivity:

    Article Title: Structural Divergence of the Group I Intron Binding Surface in Fungal Mitochondrial Tyrosyl-tRNA Synthetases That Function in RNA Splicing
    Article Snippet: Tyrosyl adenylation reactions were done with 100 n m protein in 50 μl of reaction medium containing 5 m m ATP, 100 m m KCl, 10 m m MgCl2 , 144 m m Tris-HCl, pH 7.5, 2 m m DTT, 0.1 mg/ml BSA (New England BioLabs), 0.1 unit of yeast inorganic phosphatase (New England BioLabs), and 5 μCi of l -[3,5-3 H]tyrosine (53 Ci mmol−1 ; Amersham Biosciences). .. Tyrosyl adenylation reactions were done with 100 n m protein in 50 μl of reaction medium containing 5 m m ATP, 100 m m KCl, 10 m m MgCl2 , 144 m m Tris-HCl, pH 7.5, 2 m m DTT, 0.1 mg/ml BSA (New England BioLabs), 0.1 unit of yeast inorganic phosphatase (New England BioLabs), and 5 μCi of l -[3,5-3 H]tyrosine (53 Ci mmol−1 ; Amersham Biosciences).

    Magnetic Beads:

    Article Title: CTD-dependent and -independent mechanisms govern co-transcriptional capping of Pol II transcripts
    Article Snippet: Bovine serum albumin (20 mg/ml, cat. no. B9000S), 2x RNA loading dye (cat. no. B0363S), and yeast inorganic pyrophosphatase (100 units/ml, cat. no. NEBM2403S) were from New England Biolabs. .. Bovine serum albumin (20 mg/ml, cat. no. B9000S), 2x RNA loading dye (cat. no. B0363S), and yeast inorganic pyrophosphatase (100 units/ml, cat. no. NEBM2403S) were from New England Biolabs.

    Multiple Displacement Amplification:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Paragraph title: Multiple displacement amplification ... Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells.

    Isolation:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Purification:

    Article Title: T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures
    Article Snippet: Non-modified DNA was ordered PAGE purified. .. T7 RNAP was purchased from Cellscript (200 U/μl, Catalog # C-T7300K), SP6 RNAP from ThermoFisher Scientific (100 U/μl, Catalog # EP0133), yeast inorganic pyrophosphatase from New England Biolabs (NEB) (0.1 U/μl, Catalog # M2403S) and DNase I from NEB (2 U/μl, Catalog # M0303S).

    Article Title: Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs
    Article Snippet: Background (obtained from reactions run without tRNA) was subtracted from all values unless otherwise noted. .. Quantitative aminoacylation of purified H. marismortui isoleucine tRNAs for ribosome binding assays were carried out with purified E. coli IleRS; for this, reactions were allowed to proceed for 2 h, and inorganic pyrophosphatase was added at a final concentration of 0.04 units/μL. .. After aminoacylation, tRNAs were extracted with acid phenol and precipitated with ethanol.

    Article Title: Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs
    Article Snippet: General manipulations of H. marismortui , H. volcanii , and E. coli were performed according to standard procedures ( ; ). .. RNase T1, RNase A, RNase U2, nuclease P1, and snake venom phosphodiesterase I were from Sigma; T4 polynucleotide kinase (T4-PNK), antarctic phosphatase, calf intestinal phosphatase, and inorganic pyrophosphatase were from New England Biolabs; DNA and RNA oligonucleotides were from IDT; and oligonucleotides used for cloning, detection, and purification of tRNAs are listed in Supplemental Table S1. .. The gene for H. marismortui tRNA2 Ile was first cloned into the vector pUCsptProM ( ).

    Article Title: Global proteomic analysis of prenylated proteins in Plasmodium falciparum using an alkyne-modified isoprenoid analogue
    Article Snippet: Following purification, release of pyrophosphate during GGPP/C20AlkOPP synthesis from FPP/C15AlkOPP by Pf FPPS was monitored using the EnzChek phosphate assay kit (Life Technologies), as previously described . .. Reactions were performed in a 50 μL volume, with final reagent concentrations as follows: 250 mM NaCl, 50 mM Tris pH 7.5, 1 mM MgCl2 , 1 U/mL purine nucleoside phosphorylase (PNP), 0.2 mM 2-Amino-6-mercapto-7-methylpurine riboside (MESG), 0.1 U/mL yeast inorganic pyrophosphatase (New England Biolabs), and 2 μM purified Pf FPPS, and, where indicated, 100 μM IPP, FPP (Echelon Biosciences) and/or C15AlkOPP. .. All reagents save Pf FPPS were pre-warmed to 37 °C.

    Article Title: Plasmodium IspD (2-C-Methyl-D-erythritol 4-Phosphate Cytidyltransferase), an Essential and Druggable Antimalarial Target
    Article Snippet: Final concentrations of reagents were as follows: 100 mM NaCl, 25 mM Tris pH 7.0, 7.5 mM MgCl2 , 1 mM DTT, 1 U/mL PNP, and 0.1 U/mL yeast inorganic pyrophosphatase (New England Biolabs). .. Final concentrations of reagents were as follows: 100 mM NaCl, 25 mM Tris pH 7.0, 7.5 mM MgCl2 , 1 mM DTT, 1 U/mL PNP, and 0.1 U/mL yeast inorganic pyrophosphatase (New England Biolabs).

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: DNA was degraded with 4 U DNase (turboDNase, Ambion) for 20 min at 37°C, and the size and integrity of RNA transcripts was verified by electrophoresis on 1% agarose gels before purification on filter cartridges (MegaClear, Ambion) and elution in H2 O. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Plasmid DNA was amplified by adding 1 μL of 10 μM Exo-Resistant Random Primer (Thermo Scientific), 2 μL phi29 DNA Polymerase Reaction Buffer (New England Biolabs) and 8.2 μL of MilliQ water to 5 μL of the purified treated DNA. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells.

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Paragraph title: In vitro transcription and RNA purification ... Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB).

    Sequencing:

    Article Title: RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication
    Article Snippet: The double-stranded DNA template containing the region from –17 to –1 of the class III T7 RNA polymerase promoter followed by the complement of the desired RNA sequence was prepared from synthetic DNA oligonucleotides (IDT; promoter, 5′-GAA ATT AAT ACG ACT CAC TAT A-3′; template, 5′-TCG GCT ATA GTG AGT CGT ATT AAT TTC-3′) annealed by heating at > 80 °C for 3 min and cooling gradually in the presence of 0.1 M NaCl. .. The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT).

    Article Title: RNAs synthesized using photocleavable biotinylated nucleotides have dramatically improved catalytic efficiency
    Article Snippet: The T7 RNAP promoter sequence was 5′-CTA ATA CGA CTC ACT ATA G-3′. .. The transcription conditions for each RNA were optimized by varying the [A/C/UTPs] and ratio of [GTP]/[biotin-PC GMP] in transcription buffer B [40 mM Tris–HCl (pH 8.1), 1 mM spermidine, 10 mM dithiothreitol (DTT), 0.01% Triton X-100, 80 mg/ml PEG 8000, 0.2 U of RNase inhibitor (New England Biolabs), 0.2 U of inorganic pyrophosphatase (New England Biolabs)] containing 15 mM Mg2+ , 300 nM of each DNA strand and 1 μl of 4 mg/ml T7 RNAP per 20 μl of transcription volume.

    Spectroscopy:

    Article Title: RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication
    Article Snippet: The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT). .. The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT).

    FACS:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Modified cells were subjected to FACS four to seven days after nucleofection. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: RNAs synthesized using photocleavable biotinylated nucleotides have dramatically improved catalytic efficiency
    Article Snippet: The template strand of ribosomal A-site ( ) was 5′-GmGmC GAC TTC ACC CGA AGG TGT GAC GCC TAT AGT GAG TCG TAT TAG-3′ and the template strand of the D5 RNA ( , ) was 5′-g AAC CGT ACG TGC GAC TTT CAT CGC ATA CGG CTC c TAT AGT GAG TCG TAT TAG-3′. .. The transcription conditions for each RNA were optimized by varying the [A/C/UTPs] and ratio of [GTP]/[biotin-PC GMP] in transcription buffer B [40 mM Tris–HCl (pH 8.1), 1 mM spermidine, 10 mM dithiothreitol (DTT), 0.01% Triton X-100, 80 mg/ml PEG 8000, 0.2 U of RNase inhibitor (New England Biolabs), 0.2 U of inorganic pyrophosphatase (New England Biolabs)] containing 15 mM Mg2+ , 300 nM of each DNA strand and 1 μl of 4 mg/ml T7 RNAP per 20 μl of transcription volume.

    Plasmid Preparation:

    Article Title: Functional screen reveals SARS coronavirus nonstructural protein nsp14 as a novel cap N7 methyltransferase
    Article Snippet: A nonviral RNA substrate comprising 52 nucleotides (with G as the first nucleotide) was in vitro transcribed from linear pGEM-T vector (Promega) using T7 RNA polymerase. .. RNAs containing 32 P-labeled cap structures (m7G*pppA or m7G*pppG and G*pppA or G*pppG) were prepared using a vaccinia virus capping enzyme following the manufacturer's protocol (Epicentre), except that the methyl donor SAM was absent for preparing the G*pppA/G*pppG-RNA, and inorganic pyrophosphatase (0.05 units) (New England Biolabs) was added to enhance the yield of 32 P-labeled G*pppA/G*pppG-RNA ( ) because the capping reaction is reversible in the absence of the methyl donor SAM.

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Plasmid DNA was amplified by adding 1 μL of 10 μM Exo-Resistant Random Primer (Thermo Scientific), 2 μL phi29 DNA Polymerase Reaction Buffer (New England Biolabs) and 8.2 μL of MilliQ water to 5 μL of the purified treated DNA. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Transformants were plated on LB agar plates with one of the following antibiotics: ampicillin (32 mg/L), tetracycline (16 mg/L), kanamycin (25 mg/L), cefotaxime (16 mg/L), colistin (16 mg/L), ciprofloxacin (16 mg/L).

    Electrophoresis:

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: DNA was degraded with 4 U DNase (turboDNase, Ambion) for 20 min at 37°C, and the size and integrity of RNA transcripts was verified by electrophoresis on 1% agarose gels before purification on filter cartridges (MegaClear, Ambion) and elution in H2 O. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Recombinant:

    Article Title: RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication
    Article Snippet: The double-stranded DNA template containing the region from –17 to –1 of the class III T7 RNA polymerase promoter followed by the complement of the desired RNA sequence was prepared from synthetic DNA oligonucleotides (IDT; promoter, 5′-GAA ATT AAT ACG ACT CAC TAT A-3′; template, 5′-TCG GCT ATA GTG AGT CGT ATT AAT TTC-3′) annealed by heating at > 80 °C for 3 min and cooling gradually in the presence of 0.1 M NaCl. .. The T7 RNA transcription was performed overnight at 37 °C in a reaction mixture containing 3.3 μM dsDNA template, 7.5 mM of each rNTP, 34 mM MgCl2 , 1 U/μL Recombinant RNasin Ribonuclease Inhibitor (Promega), 10 mM DTT, 0.1 U/μL inorganic pyrophosphatase, and 10 U/μL T7 RNA polymerase (New England Biolabs) in 1× RNAPol Reaction Buffer (40 mM Tris⋅HCl, pH 7.9, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT). .. The resulting RNA product was size fractionated on a 7.5 M urea–20% polyacrylamide (19:1) gel in 1× TBE and visualized under brief UV shadowing.

    Agarose Gel Electrophoresis:

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells.

    In Vitro:

    Article Title: Intrinsic ubiquitin E3 ligase activity of histone acetyltransferase Hbo1 for estrogen receptor α
    Article Snippet: In vivo ubiquitination assay was performed as previously. ) .. For in vitro ubiquitination assay, reactions were carried out using a ubiquitinylation kit purchased from Enzo Life Sciences (Farmingdale, NY, USA) containing 2.5 µM biotinylated or non-tagged ubiquitin, 100 nM His-tagged E1, approximately 1–2.5 µM His-tagged E2, and 5 mM Mg-ATP, and 20 U/mL yeast inorganic pyrophosphatase (New England Biolabs, Ipswich, Massachusetts, USA). .. Detection was made by immunoblotting with Cy5-conjugated streptavidin (Cell Signaling Technology) or anti-ubiquitin antibody.

    Article Title: Functional screen reveals SARS coronavirus nonstructural protein nsp14 as a novel cap N7 methyltransferase
    Article Snippet: A nonviral RNA substrate comprising 52 nucleotides (with G as the first nucleotide) was in vitro transcribed from linear pGEM-T vector (Promega) using T7 RNA polymerase. .. RNAs containing 32 P-labeled cap structures (m7G*pppA or m7G*pppG and G*pppA or G*pppG) were prepared using a vaccinia virus capping enzyme following the manufacturer's protocol (Epicentre), except that the methyl donor SAM was absent for preparing the G*pppA/G*pppG-RNA, and inorganic pyrophosphatase (0.05 units) (New England Biolabs) was added to enhance the yield of 32 P-labeled G*pppA/G*pppG-RNA ( ) because the capping reaction is reversible in the absence of the methyl donor SAM.

    Article Title: Native purification and labeling of RNA for single molecule fluorescence studies
    Article Snippet: Paragraph title: 2.1. In vitro Transcription Using T7 RNA Polymerase ... Inorganic pyrophosphatase (100 U/mL, New England Biolabs), stored at −20 °C.

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: Paragraph title: Preparation of in vitro transcribed RNAs ... Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: The same approach was used to make templates for in vitro transcription of DsrA (primers JR21/JR22). .. Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB). .. For preparing 32 P-labeled RNA, in vitro transcription was performed in a 20-μL volume as above except that UTP was added to only 50 nM, and 2.5 μCi [α-32 P]UTP was added.

    Ethanol Precipitation:

    Article Title: Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
    Article Snippet: Our standard in vitro transcription reaction for generating unlabeled RNA was performed in a 30-μL volume with 200 ng DNA template, 2.5 mM rNTPs, 10 mM DTT, 1× T7 RNA polymerase reaction buffer (NEB), 100 units RNasin (Promega), 2.5 units yeast inorganic pyrophosphatase (NEB), and 100 units T7 RNA polymerase (NEB). .. For preparing 32 P-labeled RNA, in vitro transcription was performed in a 20-μL volume as above except that UTP was added to only 50 nM, and 2.5 μCi [α-32 P]UTP was added.

    Concentration Assay:

    Article Title: Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs
    Article Snippet: Background (obtained from reactions run without tRNA) was subtracted from all values unless otherwise noted. .. Quantitative aminoacylation of purified H. marismortui isoleucine tRNAs for ribosome binding assays were carried out with purified E. coli IleRS; for this, reactions were allowed to proceed for 2 h, and inorganic pyrophosphatase was added at a final concentration of 0.04 units/μL. .. After aminoacylation, tRNAs were extracted with acid phenol and precipitated with ethanol.

    Article Title: Global proteomic analysis of prenylated proteins in Plasmodium falciparum using an alkyne-modified isoprenoid analogue
    Article Snippet: Reactions were performed in a 50 μL volume, with final reagent concentrations as follows: 250 mM NaCl, 50 mM Tris pH 7.5, 1 mM MgCl2 , 1 U/mL purine nucleoside phosphorylase (PNP), 0.2 mM 2-Amino-6-mercapto-7-methylpurine riboside (MESG), 0.1 U/mL yeast inorganic pyrophosphatase (New England Biolabs), and 2 μM purified Pf FPPS, and, where indicated, 100 μM IPP, FPP (Echelon Biosciences) and/or C15AlkOPP. .. Reactions were performed in a 50 μL volume, with final reagent concentrations as follows: 250 mM NaCl, 50 mM Tris pH 7.5, 1 mM MgCl2 , 1 U/mL purine nucleoside phosphorylase (PNP), 0.2 mM 2-Amino-6-mercapto-7-methylpurine riboside (MESG), 0.1 U/mL yeast inorganic pyrophosphatase (New England Biolabs), and 2 μM purified Pf FPPS, and, where indicated, 100 μM IPP, FPP (Echelon Biosciences) and/or C15AlkOPP.

    Diffusion-based Assay:

    Article Title: A Comparison of Methods for the Extraction of Plasmids Capable of Conferring Antibiotic Resistance in a Human Pathogen From Complex Broiler Cecal Samples
    Article Snippet: Samples were incubated at 95°C for 5 min and immediately chilled on ice for 5 min. 1.6 μL phi29 DNA polymerase (New England Biolabs), 0.02 μL of inorganic pyrophosphatase (from yeast) (New England Biolabs) and 2 μL of dNTPs (10 mM) (Thermo Scientific) were added and incubated at 30°C for 16 h. Amplified plasmid DNA (5 μL) was electroporated at 1.8 kV into 15 μL of E. coli DH5α cells. .. Plasmids were visualized on a 1% agarose gel stained with GelRed run at 70 V for 60 mins.

    Gel Extraction:

    Article Title: SHAPE analysis of the FIV Leader RNA reveals a structural switch potentially controlling viral packaging and genome dimerization
    Article Snippet: PCR products were purified from 1% agarose gels using Qiagen Gel Extraction kits, according to the manufacturer’s protocol. .. Large-scale transcription reactions contained 6 mM of each rNTP (Promega), 40 mM DTT, 0.5 U/ml yeast inorganic pyrophosphatase (NEB), 60 U/ml RNase inhibitor (RNAsin Plus, Promega), 4.23 μg/ml T7 RNA polymerase (courtesy of J. Miller, National Cancer Institute, USA), 126 nM DNA template, 80 mM HEPES-KOH pH 7.6, 12 mM MgCl2 , 2 mM spermidine, 0.01% Triton X-100 in a volume of 15–30 ml and were incubated at 37°C for 16 h. A further 4.23 μg/ml T7 RNA polymerase, 0.5 U/ml yeast inorganic pyrophosphatase and 10 mM MgCl2 were added and incubated for 3 h at 37°C.

    Variant Assay:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Harvested cells were resuspended in DPBS (Life Technologies) with 2% AlbuMAX I (Life Technologies), 2 mM EDTA (Life Technologies), NucBlue Fixed Cell Stain ReadyProbes reagent, and 10 μM ROCK inhibitor Y-27632, and subsequently filtered to remove clumps and debris. .. Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB). .. PCR-amplified products were purified with the MinElute PCR Purification kit (Qiagen), diluted to 100 μl with Buffer EB (Qiagen), and used for further genome-cassette junction PCR amplifications.

    Homologous Recombination:

    Article Title: In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining
    Article Snippet: Paragraph title: Detection of knock-in blunt ligation and homologous recombination ... Genomic DNA was isolated from sorted cells using the ZymoBead Genomic DNA kit, (Zymo Research, Irvine, CA). gDNA was then subjected to targeted amplification of the H11 locus via PCR amplification with Q5 high-fidelity polymerase or multiple displacement amplification (MDA; a variant of whole genome amplification) following , with the addition of inorganic (yeast) pyrophosphatase (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs yeast inorganic pyrophosphatase yipp
    Yeast Inorganic Pyrophosphatase Yipp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yeast inorganic pyrophosphatase yipp/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    yeast inorganic pyrophosphatase yipp - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results