endonuclease viii  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Endonuclease VIII
    Endonuclease VIII 5 000 units
    Catalog Number:
    5 000 units
    Other Endonucleases
    Buy from Supplier

    Structured Review

    New England Biolabs endonuclease viii
    Endonuclease VIII
    Endonuclease VIII 5 000 units
    https://www.bioz.com/result/endonuclease viii/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    endonuclease viii - by Bioz Stars, 2019-11
    95/100 stars


    Related Articles

    Clone Assay:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).


    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).


    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Targets were initially amplified by PCR containing 1 μg human genomic DNA, 50 nM each of 94 forward PCR primers, 50 nM each of 94 reverse PCR primers, 5 U of AmpliTaq Polyermase Stoffel Fragment (Applied Biosystems), 200 μM each dNTP, 2 mM MgCl2 , 20 mM Tris-HCl (pH 8.4), and 50 mM KCl in a total volume of 10 μL. .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. 2.5 U/μL of Circligase II (Biozym 131406) was used and the ligation reaction carried out overnight.

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: SAP and Antarctic Phosphatase catalyze the release of 5'-phosphates, yielding non-phosphorylated DNA ends, which cannot be amplified by LM-PCR. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Positive Control:

    Article Title:
    Article Snippet: For the 5-hydroxycytosine (5OHC) positive control substrate, the damage-containing strand was 5′ end-labeled prior to annealing to the cold complementary 34G strand. .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).


    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    SYBR Green Assay:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. A quantitative PCR (qPCR) experiment was carried out using 0.2% of the unamplified library to estimate relative library complexities (Additional file : Table S1), and to determine the optimal number of cycles for subsequent indexing PCR, representing the inflection point of the respective library amplification curves, corrected for reaction volume and template amount. qPCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) with 3 replicates for each library, involving an initial 10 min denaturation at 95 °C, followed by 40 cycles of: 15 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C.


    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).


    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB). .. Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).


    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: We interpret this result as indication that no obvious negative influence on extraction efficiency is caused by using this reduced input bone powder amount. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    DNA Sequencing:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Clones were blue-white screened and validated by DNA sequencing. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Polymerase Chain Reaction:

    Article Title: Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Article Snippet: Paragraph title: Nested Patch PCR ... Primers were cleaved from the amplicons by the addition of 1 U of heat labile uracil-DNA glycosylase (USB), 10 U of endonuclease VIII (NEB), and 10 U of exonulcease I (USB).

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Plasmids containing the 5′ half of the DENV-2 genome (bases 1–5428) or 3′ half (5429–10723) were used as PCR template in the presence of dUTP prior to random fragmentation with endonuclease-V to ∼100 bp according to Dyson's protocol ( ). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. The fragmented DNA pool was excised from 1.5% agarose gel and then blunted with 2 units of T4 DNA polymerase (New England Biolabs) at 12 °C for 30 min, followed by heat inactivation at 75 °C for 20 min. Ligation of fragments directly into a SmaI-digested and dephosphorylated pIIIA MS2 vector (9.1 kb) was found to be very inefficient.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).


    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: SAP and Antarctic Phosphatase catalyze the release of 5'-phosphates, yielding non-phosphorylated DNA ends, which cannot be amplified by LM-PCR. .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.). .. Endo VIII possesses both N-glycosylase and APE activities, thereby cleaving 3′ and 5′ to the abasic site generated by Ung or by itself and leaving a 5′-phosphate and a 3′-phosphate.

    Molecular Weight:

    Article Title:
    Article Snippet: The fractions containing the interstrand crosslinked DNA were pooled and desalted by dialysis in water in a 2,000 molecular weight cutoff cassette (Thermo Scientific, Rockford, IL) at 4 °C overnight and concentrated in a Speed-vac concentrator. .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    DNA Extraction:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: DNA extraction was performed according to Dabney et al. [ ] with reduced bone powder input mass, and reduced centrifugation speed of the binding apparatus at approximately 450×g . .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Molecular Cloning:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Paragraph title: Molecular Cloning ... In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.


    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: Viral RNA was isolated from DENV-2 strain 16681 and used to generate full-length cDNA according to the SuperScript III procedure (Life Technologies, Inc.). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Electrophoretic Mobility Shift Assay:

    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).


    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: The linearized DNA substrate (100 fmol) was incubated with 50 ng of purified recombinant GST-mouse AID fusion protein, a gift from Dr. Michael R. Lieber (University of Southern California, Los Angeles, CA), under conditions similar to those used by this investigator , followed by treatment with Shrimp Alkaline Phosphatase (SAP) and Antarctic Phosphatase (New England Biolabs Inc.). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).


    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: We interpret this result as indication that no obvious negative influence on extraction efficiency is caused by using this reduced input bone powder amount. .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. The Klenow Fragment of DNA polymerase I (Thermo Fisher Scientific EP0051) was used for the fill-in reaction [ ].

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Putatively positive Y. pestis samples were evaluated by comparing the amount of reads mapping to Y. pestis CO92 (NC_003143.1) to the reads assigned by MALT on the Y. pestis and Y. pseudotuberculosis complex nodes (Supplementary Table ). .. Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. Double-indexing and subsequent library amplification steps were carried out as mentioned in the previous section “Illumina library preparation and sequencing”.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    RNA Expression:

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C. .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.


    Article Title:
    Article Snippet: To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs). .. To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Plasmid Preparation:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Article Title: Analysis of 3800-year-old Yersinia pestis genomes suggests Bronze Age origin for bubonic plague
    Article Snippet: Rich double-stranded DNA libraries were prepared for in-solution capture and deep-shotgun sequencing of putatively positive Y. pestis samples, using 50 μl of extract (or 2 × 25 μl of extract), according to a previously described protocol , with an initial partial-UDG treatment step , where UDG in combination with endonuclease VIII (USER enzyme, New England Biolabs) were used to remove all deaminated cytosines (uracils) with the exception of terminal uracil nucleotides that lack 5′ phosphate. .. At this stage, the sample RT5 was diluted to 10 nM for deep-shotgun sequencing on a HiSeq 4000 platform using a 1 × 76+8+8 cycles chemistry kit.

    Article Title: Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication
    Article Snippet: The 5′ and 3′ halves of the DENV genome were amplified using TaKaRa Ex Taq polymerase and inserted into the pSC-A vector between SacI and XbaI sites with the StrataClone PCR cloning kit (Stratagene). .. In brief, no more than 5 μg of PCR products were treated in 2× fragmentation buffer (20 m m HEPES-KOH, pH 7.4, 100 m m NaCl, 1 m m MnCl2 ) and 6 units of endonuclease-V (New England Biolabs) for 15 h at 37 °C.

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID
    Article Snippet: A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate was generated by PCR amplification of the pCR-Blunt II-TOPO® vector containing the 59 bp fragment DNA, using Phusion™ high-fidelity DNA polymerase (New England Biolabs Inc., Ipswich, MA), the forward 5'-phosphorylated primer A 5'-AGCTGGCAGGCTAGCAAGTTG-3' or the forward 5'-phosphorylated primer A1 5'-AG U TGGCAGGCTAGCAAGTTG-3' (same as primer A, except for the replacement of dC at position 3 with dU), specific for the 5' region of the 59 bp DNA fragment, and the reverse primer B 5'-GTTTTCCCAGTCACGAC-3, specific for the vector sequence 449–468, 116 bp downstream of the inserted 59 bp DNA fragment ( ). .. The thoroughly dephosphorylated DNA was treated with recombinant E. coli Ung (New England Biolabs Inc.) and then Endonuclease (Endo) VIII (New England Biolabs Inc.).

    Real-time Polymerase Chain Reaction:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Binding Assay:

    Article Title: Reduction of the contaminant fraction of DNA obtained from an ancient giant panda bone
    Article Snippet: Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299). .. Sequencing libraries were generated from each DNA extract following a single-stranded library preparation protocol [ ], which included treatment with uracil-DNA glycosylase (New England Biolabs M0279) and endonuclease VIII (New England Biolabs M0299).

    Article Title:
    Article Snippet: Paragraph title: Incision and Binding Assays ... To monitor NEIL1 glycosylase and AP lyase activities, human NEIL1 protein (New England Biolabs, Ipswich, MA) was added to a reaction mixture at the indicated amounts with 1 pmol of the appropriate oligonucleotide substrate in 10 μl of 1× endonuclease VIII buffer (New England Biolabs).

    Gel Extraction:

    Article Title: Identification of soluble protein fragments by gene fragmentation and genetic selection
    Article Snippet: Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK). .. Restriction enzymes and Endonuclease V were from New England Biolabs (Hitchin, UK).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs endonuclease viii
    Endonuclease Viii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease viii/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    endonuclease viii - by Bioz Stars, 2019-11
    95/100 stars
      Buy from Supplier

    Image Search Results