amv reverse transcriptase  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    AMV Reverse Transcriptase
    AMV Reverse Transcriptase 1 000 units
    Catalog Number:
    1 000 units
    Reverse Transcriptases
    Buy from Supplier

    Structured Review

    New England Biolabs amv reverse transcriptase
    AMV Reverse Transcriptase
    AMV Reverse Transcriptase 1 000 units reverse transcriptase/product/New England Biolabs
    Average 99 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    amv reverse transcriptase - by Bioz Stars, 2019-12
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Total RNA from two to three animals of ∼10–20 mm in length was isolated using Trizol (Invitrogen) following the manufacturer's recommendations. .. Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs). .. PCR amplification was carried out with essentially the same primers that were used to make the RNAi vectors, and the number of cycles was optimized using primers for actin, in addition to non-targeted Smed-ift88, Smed-ic2 , and Smed-lc1 , as internal controls.

    Article Title: Safe and Efficient Silencing with a Pol II, but Not a Pol lII, Promoter Expressing an Artificial miRNA Targeting Human Huntingtin
    Article Snippet: Paragraph title: Small RNA Library Cloning and Analysis ... Reverse transcription was performed using AMV Reverse transcriptase mix (NEB) and PCR-amplified using AccuPrime Pfx DNA Polymerase (Invitrogen) with one universal primer (5′-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3′) and one barcoded primer (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3′).

    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The procedures used for isolation, purification, and labeling of this duplex DNA fragment have been described previously ( ).


    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The amplified products were separated on 1% agarose gel, stained by ethidium bromide and purified from the gel using the PCR purification kit (Qiagen, West Sussex, UK). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Cycling Probe Technology:

    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The plasmids used in luciferase expression assays were obtained from the pGL3Promoter (pGL3Pr) vector from Promega by cloning a 54-bp insert into the 5′ transcribed but untranslated region of the firefly ( Photinus pyralis ) luciferase gene (HindIII-NcoI region) under the control of the simian virus 40 (SV40) promoter.

    RT Activity Assay:

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: Paragraph title: RT activity assay ... AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.

    Quantitative RT-PCR:

    Article Title: LOTUS domain protein MARF1 binds CCR4-NOT deadenylase complex to post-transcriptionally regulate gene expression in oocytes
    Article Snippet: Paragraph title: qRT-PCR ... RNAs extracted from oocytes and RNAs coimmunoprecipitated with proteins were treated with Turbo DNase (Thermo Fisher Scientific), and then were reverse-transcribed into cDNA using a random hexamer primer and AMV Reverse Transcriptase (NEB). qPCR was performed using iTaq Universal SYBR Green Supermix or SsoAdvanced Universal SYBR Green Supermix on CFX96 (Biorad).

    Article Title:
    Article Snippet: Paragraph title: qRT-PCR ... One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions.

    SYBR Green Assay:

    Article Title: LOTUS domain protein MARF1 binds CCR4-NOT deadenylase complex to post-transcriptionally regulate gene expression in oocytes
    Article Snippet: RNA from oocytes was prepared using miRVana (Thermo Fisher Scientific). .. RNAs extracted from oocytes and RNAs coimmunoprecipitated with proteins were treated with Turbo DNase (Thermo Fisher Scientific), and then were reverse-transcribed into cDNA using a random hexamer primer and AMV Reverse Transcriptase (NEB). qPCR was performed using iTaq Universal SYBR Green Supermix or SsoAdvanced Universal SYBR Green Supermix on CFX96 (Biorad). .. 6xHis-MBP-HRV3Csite-HA-Cyclin A protein was expressed using a modified pET plasmid vector in E. coli .

    Article Title:
    Article Snippet: HEK293T cells were treated with either 5 m m dithiothreitol, 0.5 μ m thapsigargin, 5 μg/ml tunicamycin, or starved for Cys and Met for 8 h prior to RNA isolation with the RNeasy mini kit (Qiagen). .. One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions. .. Changes in mRNA levels were calculated using the change in cycle threshold value method with β-actin as the reference gene ( ).

    Random Hexamer Labeling:

    Article Title: LOTUS domain protein MARF1 binds CCR4-NOT deadenylase complex to post-transcriptionally regulate gene expression in oocytes
    Article Snippet: RNA from oocytes was prepared using miRVana (Thermo Fisher Scientific). .. RNAs extracted from oocytes and RNAs coimmunoprecipitated with proteins were treated with Turbo DNase (Thermo Fisher Scientific), and then were reverse-transcribed into cDNA using a random hexamer primer and AMV Reverse Transcriptase (NEB). qPCR was performed using iTaq Universal SYBR Green Supermix or SsoAdvanced Universal SYBR Green Supermix on CFX96 (Biorad). .. 6xHis-MBP-HRV3Csite-HA-Cyclin A protein was expressed using a modified pET plasmid vector in E. coli .


    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The procedures used for isolation, purification, and labeling of this duplex DNA fragment have been described previously ( ).

    Activity Assay:

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: To measure RT activity, we used a real-time qPCR-based RT assay , . .. AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.


    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The procedures used for isolation, purification, and labeling of this duplex DNA fragment have been described previously ( ).


    Article Title: Dual nature of pseudouridylation in U2 snRNA: Pus1p-dependent and Pus1p-independent activities in yeasts and higher eukaryotes
    Article Snippet: Paragraph title: RNA modification analysis ... Primer extension was performed using either AMV-RT (New England Biolabs) or EpiScript RT (Epicentre) at 0.5 mM dNTP concentration.


    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The two 54-bp duplexes contained either the intact wild-type (WT) target with the triplex (underlined) and CPT site (5′AGCTTTACCGAGCTCAGATCTTCTC TTTTTTTCTCTCTCTC TATCACTGATAGC3′/5′CATGGC TATCAGTGATA GAGAGAGAGAAAAAAA GAGAAGATCTGAGCTCGGTAA3′, plasmid pWT) or the triplex site without cleavages sites b and c (in bold) at its 3′ end (B2) (5′AGCTTTACCGAGCTCAGA AAAA CTC TTTTTTTCTCTCTCTC TATCACTGATAGC3′/5′CATGGCTATCAGTGATA GAGAGAGAGA AAAAAA GAG TTTT TCTGAGCTCGGTAA3′, plasmid called pB2).

    Northern Blot:

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Paragraph title: Semi-quantitative RT-PCR and Northern Blotting ... Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs).

    Cell Culture:

    Article Title: The chemokine CX3CL1 promotes trafficking of dendritic cells through inflamed lymphatics
    Article Snippet: Total cellular RNA was isolated (RNeasy, Qiagen) from HDLECs cultured for 24 hours in EGM-2 MV medium, either alone or supplemented with 2 ng/ml TNF-α. .. First-strand cDNA synthesis was carried out by Oligo dT priming (Invitrogen) using AMV reverse transcriptase (New England Biolabs), following the manufacturer's instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The chemokine CX3CL1 promotes trafficking of dendritic cells through inflamed lymphatics
    Article Snippet: Paragraph title: RT-PCR ... First-strand cDNA synthesis was carried out by Oligo dT priming (Invitrogen) using AMV reverse transcriptase (New England Biolabs), following the manufacturer's instructions.

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Paragraph title: Semi-quantitative RT-PCR and Northern Blotting ... Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs).

    Article Title: Intrinsic Characteristics of Neighboring DNA Modulate Transposable Element Activity in Drosophila melanogaster
    Article Snippet: Separate 35-μl first-strand cDNA reaction mixtures were prepared for analyzing transcript abundance of the control gene, Ribosomal protein 49 ( RP49 ), and the target gene, white , using 25 ng of total RNA as template, nuclease-free water, and 1.0 μl of 2 μ m reverse primers ( ). .. The template-primer mixtures were heated to 65° for 10 min in a thermal cycler and cooled on ice for 5 min. A 16-μl aliquot of Promega's Access RT–PCR reagents in a master-mix cocktail—consisting of 1× avian myeloblastosis virus (AMV) buffer, 0.2 m m of each dNTP, 1 m m MgSO4 , 0.1 unit AMV reverse transcriptase, and 1.6 units RNase Inhibitor (New England Biolabs)—was added to each template-primer mixture to make a 50-μl reaction volume. .. The first-strand cDNA synthesis reaction was performed at 45° for 45 min, and reverse transcriptase was inactivated by heating the reaction to 94° for 2 min.

    Article Title: Identification of hub genes and pathways associated with hepatocellular carcinoma based on network strategy
    Article Snippet: Paragraph title: Validation of hub genes using RT-PCR analysis ... For the first, cDNA synthesis, RNA was mixed with oligo (dT)18 primers adjusted to 10 µl and incubated at 70°C for 5 min. Next, RNA/primer mix was used in 20-µl reactions containing 2 µl RNasin (40 U/µl), 8.0 µl 5X reverse transcriptase buffer, 8.0 µl dNTPs and 2 µl AMV reverse transcriptase (5 U/µl) (all reagents from New England Biolabs, Inc., Ipswich, MA, USA).

    Article Title: DIP1 modulates stem cell homeostasis in Drosophila through regulation of sisR-1
    Article Snippet: RT-PCR was performed as previously described . .. For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1 h using AMV-RT (New England Biolabs), M-MLV RT (Promega) or Superscript III (Invitrogen). .. Strand-specific RT-PCR was performed using SuperScript III RT (Invitrogen) or M-MLV RT (Promega).


    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA). .. Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA).


    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs). .. PCR products were resolved in agarose gels and stained with ethidium bromide.

    Polymerase Chain Reaction:

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs). .. PCR amplification was carried out with essentially the same primers that were used to make the RNAi vectors, and the number of cycles was optimized using primers for actin, in addition to non-targeted Smed-ift88, Smed-ic2 , and Smed-lc1 , as internal controls.

    Article Title: RNA modification enzyme TruB is a tRNA chaperone
    Article Snippet: Paragraph title: Reverse Transcription Followed by PCR. ... RNA from total extracts was reverse transcribed using AMV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol, using a TruB specific antisense primer that anneals to the 3′ end of the gene ( ).

    Article Title: Identification of hub genes and pathways associated with hepatocellular carcinoma based on network strategy
    Article Snippet: For the first, cDNA synthesis, RNA was mixed with oligo (dT)18 primers adjusted to 10 µl and incubated at 70°C for 5 min. Next, RNA/primer mix was used in 20-µl reactions containing 2 µl RNasin (40 U/µl), 8.0 µl 5X reverse transcriptase buffer, 8.0 µl dNTPs and 2 µl AMV reverse transcriptase (5 U/µl) (all reagents from New England Biolabs, Inc., Ipswich, MA, USA). .. Reactions were performed using the following program: 2 min at 94°C for predenaturation, followed by 35 cycles of 20 sec at 94°C, 15 sec at 60°C and 1 min at 68°C, and a final 7 min extension at 72°C.

    Article Title: Safe and Efficient Silencing with a Pol II, but Not a Pol lII, Promoter Expressing an Artificial miRNA Targeting Human Huntingtin
    Article Snippet: The ligated products were annealed to the RT primer (5′-CCTTGGCACCCGAGAATTCCA-3′) and ligated to a 5′-adaptor (RNA: 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′). .. Reverse transcription was performed using AMV Reverse transcriptase mix (NEB) and PCR-amplified using AccuPrime Pfx DNA Polymerase (Invitrogen) with one universal primer (5′-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3′) and one barcoded primer (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3′). .. Libraries were sequenced on the Illumina HiSeq at the University of Massachusetts Deep Sequencing Core.

    Article Title: DIP1 modulates stem cell homeostasis in Drosophila through regulation of sisR-1
    Article Snippet: For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1 h using AMV-RT (New England Biolabs), M-MLV RT (Promega) or Superscript III (Invitrogen). .. Strand-specific RT-PCR was performed using SuperScript III RT (Invitrogen) or M-MLV RT (Promega).

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve. .. AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The nucleotide sequences of both strands of purified PCR fragments were determined by cycle sequencing on an automated ABI 310 sequencer using the Big Dye Terminator kit according to the manufacturer’s instructions (PE Applied Biosystems). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA). .. EIII inserts were amplified from cDNA generated from viral genomic RNA or a synthetic plasmid using the Roche High Fidelity PCR master mix (Roche, Indianapolis, IN).


    Article Title: Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin
    Article Snippet: Methylation reactions (125 μl) contained 100 pmol of 30S ribosomal subunits, 200 pmol of purified recombinant methyltransferase ( Cac Kam, Tcu Kam, Unc Kam or Car Kam), 1 mM SAM, 10 mM HEPES-KOH pH 7.5, 10 mM MgCl2 , 50 mM NH4 Cl, and 5 mM β-mercaptoethanol. .. Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB).


    Article Title: Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin
    Article Snippet: Paragraph title: 2.3. 30S ribosome subunit methylation assays ... Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB).


    Article Title: The chemokine CX3CL1 promotes trafficking of dendritic cells through inflamed lymphatics
    Article Snippet: Total cellular RNA was isolated (RNeasy, Qiagen) from HDLECs cultured for 24 hours in EGM-2 MV medium, either alone or supplemented with 2 ng/ml TNF-α. .. First-strand cDNA synthesis was carried out by Oligo dT priming (Invitrogen) using AMV reverse transcriptase (New England Biolabs), following the manufacturer's instructions.

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Total RNA from two to three animals of ∼10–20 mm in length was isolated using Trizol (Invitrogen) following the manufacturer's recommendations. .. Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs).

    Article Title: Safe and Efficient Silencing with a Pol II, but Not a Pol lII, Promoter Expressing an Artificial miRNA Targeting Human Huntingtin
    Article Snippet: Total RNA was extracted using the MirVana RNA isolation kit, according to the manufacturer’s protocol. .. Reverse transcription was performed using AMV Reverse transcriptase mix (NEB) and PCR-amplified using AccuPrime Pfx DNA Polymerase (Invitrogen) with one universal primer (5′-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3′) and one barcoded primer (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3′).

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: For RT real-time PCR experiments, total RNA was isolated from exponential, early stationary and stationary phases of B. clausii growing cultures, using the RNeasy midi-kit (Qiagen). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title:
    Article Snippet: HEK293T cells were treated with either 5 m m dithiothreitol, 0.5 μ m thapsigargin, 5 μg/ml tunicamycin, or starved for Cys and Met for 8 h prior to RNA isolation with the RNeasy mini kit (Qiagen). .. One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions.

    Size-exclusion Chromatography:

    Article Title: Identification of hub genes and pathways associated with hepatocellular carcinoma based on network strategy
    Article Snippet: For the first, cDNA synthesis, RNA was mixed with oligo (dT)18 primers adjusted to 10 µl and incubated at 70°C for 5 min. Next, RNA/primer mix was used in 20-µl reactions containing 2 µl RNasin (40 U/µl), 8.0 µl 5X reverse transcriptase buffer, 8.0 µl dNTPs and 2 µl AMV reverse transcriptase (5 U/µl) (all reagents from New England Biolabs, Inc., Ipswich, MA, USA). .. For the second-strand synthesis, PCRs were conducted using specific primers , 0.2 mM dNTPs, 1 unit Taq DNA polymerase, 10X PCR buffer and 2 µl first-strand cDNA.

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve. .. 10 µl cDNA was mixed with 40 µl PCR-mix (final concentration: 0.8x Platinum Taq PCR buffer [Invitrogen], 2.5 mM MgCl2 , 1x Rox Reference Dye [Invitrogen], 0.16 mM dNTPs, 0.51 µM 5 primer B [AACATGCTCGAGGGCCTTA], 0.51 µM 3 primer A, 0.15 µM MS2-probe [5 FAM-CCCGTGGGATGCTCCTACATGTCA-3 TAMRA], 1.25 U PlatinumTaq [Invitrogen]).


    Article Title: Two Tandem RNase III Cleavage Sites Determine betT mRNA Stability in Response to Osmotic Stress in Escherichia coli
    Article Snippet: The following 5′-32 P-labeled primers were used: betT-120R ( 5′-GGCCGAGAAGTCGCGAAACA ) and betT-273R ( 5′-TGAATTCCGGTTTGGATTGT ). .. RNA with labeled primers were annealed at 65°C for 15 min, slowly cooled down to room temperature for 2.5 h, and extended at 42°C for 1 h using AMV reverse transcriptase (New England Biolabs). .. The extended fragments were denatured at 95°C for 10 min and separated on 10% polyacrylamide gels containing 8 M urea.

    Article Title: Dual nature of pseudouridylation in U2 snRNA: Pus1p-dependent and Pus1p-independent activities in yeasts and higher eukaryotes
    Article Snippet: Fluorescently labeled oligonucleotides specific for vertebrate and S. cerevisiae U2 snRNA and for U87-based artificial substrate RNA were previously described ( ; ). .. Primer extension was performed using either AMV-RT (New England Biolabs) or EpiScript RT (Epicentre) at 0.5 mM dNTP concentration.

    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Plasmid pBSK(+/−) was bought from Promega, and the four 77-bp target duplexes were inserted between its BamHI and EcoRI sites (Fig. contains the sequences). .. Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The procedures used for isolation, purification, and labeling of this duplex DNA fragment have been described previously ( ).


    Article Title: Two Tandem RNase III Cleavage Sites Determine betT mRNA Stability in Response to Osmotic Stress in Escherichia coli
    Article Snippet: Primer extension analysis was performed using total RNA purified via heated phenol extraction and ethanol precipitation. .. RNA with labeled primers were annealed at 65°C for 15 min, slowly cooled down to room temperature for 2.5 h, and extended at 42°C for 1 h using AMV reverse transcriptase (New England Biolabs).

    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Total RNA from two to three animals of ∼10–20 mm in length was isolated using Trizol (Invitrogen) following the manufacturer's recommendations. .. Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs). .. PCR amplification was carried out with essentially the same primers that were used to make the RNAi vectors, and the number of cycles was optimized using primers for actin, in addition to non-targeted Smed-ift88, Smed-ic2 , and Smed-lc1 , as internal controls.

    Article Title: Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin
    Article Snippet: Methylation reactions (125 μl) contained 100 pmol of 30S ribosomal subunits, 200 pmol of purified recombinant methyltransferase ( Cac Kam, Tcu Kam, Unc Kam or Car Kam), 1 mM SAM, 10 mM HEPES-KOH pH 7.5, 10 mM MgCl2 , 50 mM NH4 Cl, and 5 mM β-mercaptoethanol. .. Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB).

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The nucleotide sequences of both strands of purified PCR fragments were determined by cycle sequencing on an automated ABI 310 sequencer using the Big Dye Terminator kit according to the manufacturer’s instructions (PE Applied Biosystems). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Viral RNA was extracted from culture supernatant samples of each donor virus using the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA), with RNA purification being performed using a Zymo Direct-Zol RNA purification kit (Zymo Research Corp., Irvine, CA). .. Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA).

    Article Title:
    Article Snippet: HEK293T cells were treated with either 5 m m dithiothreitol, 0.5 μ m thapsigargin, 5 μg/ml tunicamycin, or starved for Cys and Met for 8 h prior to RNA isolation with the RNeasy mini kit (Qiagen). .. One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions. .. Changes in mRNA levels were calculated using the change in cycle threshold value method with β-actin as the reference gene ( ).


    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The nucleotide sequences of both strands of purified PCR fragments were determined by cycle sequencing on an automated ABI 310 sequencer using the Big Dye Terminator kit according to the manufacturer’s instructions (PE Applied Biosystems). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title: Growth Phase-dependent Variation of RNase BN/Z Affects Small RNAs
    Article Snippet: T4 polynucleotide kinase and avian myeloblastosis virus reverse transcriptase were products of New England Biolabs. .. RQ1 RNase-free DNase and the Riboprobe® In Vitro Transcription System were obtained from Promega.


    Article Title: Safe and Efficient Silencing with a Pol II, but Not a Pol lII, Promoter Expressing an Artificial miRNA Targeting Human Huntingtin
    Article Snippet: Following size selection, the small RNAs were ethanol precipitated and ligated to a pre-adenylated 3′-adaptor (5′-rAppTGGAATTCTCGGGTGCCAAGG/ddC/-3′). .. Reverse transcription was performed using AMV Reverse transcriptase mix (NEB) and PCR-amplified using AccuPrime Pfx DNA Polymerase (Invitrogen) with one universal primer (5′-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3′) and one barcoded primer (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3′).


    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA). .. Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA).


    Article Title: An Outer Arm Dynein Conformational Switch Is Required for Metachronal Synchrony of Motile Cilia in Planaria
    Article Snippet: Two micrograms of purified RNA was used to set up a 10-μl first-strand cDNA synthesis reaction with cloned AMV reverse transcriptase (New England Biolabs). .. PCR amplification was carried out with essentially the same primers that were used to make the RNAi vectors, and the number of cycles was optimized using primers for actin, in addition to non-targeted Smed-ift88, Smed-ic2 , and Smed-lc1 , as internal controls.

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The amplified products were separated on 1% agarose gel, stained by ethidium bromide and purified from the gel using the PCR purification kit (Qiagen, West Sussex, UK). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Plasmid Preparation:

    Article Title: Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates
    Article Snippet: Plasmid pBSK(+/−) was bought from Promega, and the four 77-bp target duplexes were inserted between its BamHI and EcoRI sites (Fig. contains the sequences). .. Digestion of the plasmid by PvuII and EcoRI yielded a 324-mer fragment suitable for 3′-end labeling by the avian myeloblastosis virus reverse transcriptase (New England Biolabs) and [α-32 P]ddATP(Amersham), used for Topo I cleavage assays. .. The procedures used for isolation, purification, and labeling of this duplex DNA fragment have been described previously ( ).


    Article Title:
    Article Snippet: One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions. .. One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: LOTUS domain protein MARF1 binds CCR4-NOT deadenylase complex to post-transcriptionally regulate gene expression in oocytes
    Article Snippet: RNA from oocytes was prepared using miRVana (Thermo Fisher Scientific). .. RNAs extracted from oocytes and RNAs coimmunoprecipitated with proteins were treated with Turbo DNase (Thermo Fisher Scientific), and then were reverse-transcribed into cDNA using a random hexamer primer and AMV Reverse Transcriptase (NEB). qPCR was performed using iTaq Universal SYBR Green Supermix or SsoAdvanced Universal SYBR Green Supermix on CFX96 (Biorad). .. 6xHis-MBP-HRV3Csite-HA-Cyclin A protein was expressed using a modified pET plasmid vector in E. coli .

    Article Title: DIP1 modulates stem cell homeostasis in Drosophila through regulation of sisR-1
    Article Snippet: For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1 h using AMV-RT (New England Biolabs), M-MLV RT (Promega) or Superscript III (Invitrogen). .. PCR was carried out using the resulting cDNA.

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: To measure RT activity, we used a real-time qPCR-based RT assay , . .. AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: For RT real-time PCR experiments, total RNA was isolated from exponential, early stationary and stationary phases of B. clausii growing cultures, using the RNeasy midi-kit (Qiagen). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title:
    Article Snippet: HEK293T cells were treated with either 5 m m dithiothreitol, 0.5 μ m thapsigargin, 5 μg/ml tunicamycin, or starved for Cys and Met for 8 h prior to RNA isolation with the RNeasy mini kit (Qiagen). .. One μg of purified RNA was reverse-transcribed into cDNA using the avian myeloblastosis virus reverse transcriptase kit (New England Biolabs). qRT-PCRs were performed in 20-μl reactions using FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics Corp.) on an Mx3000P real time PCR machine (Agilent Technologies) according to the manufacturer's instructions. .. Changes in mRNA levels were calculated using the change in cycle threshold value method with β-actin as the reference gene ( ).

    RNA Extraction:

    Article Title: Role of CTCF in Regulating SLC45A3-ELK4 Chimeric RNA
    Article Snippet: Paragraph title: RNA extraction and Reverse Transcription ... All of the RNA samples used in this study were treated with DNase I, followed by standard Reverse Transcription using AMV RT (NEB).

    Binding Assay:

    Article Title: Structure of the mammalian antimicrobial peptide Bac7(1–16) bound within the exit tunnel of a bacterial ribosome
    Article Snippet: Briefly, each translation reaction consisted of 1 μl solution A, 0.5 μl Δisoleucine amino acid mixture, 0.5 μl tRNA mixture, 1.5 μl solution B, 0.5 μl (0.5 pmol) hns37aa template: (5′-ATTAATACGACTCACTATAGGGATATAAGGAGGAAAACAT atg AGCGAAGCACTTAAA att CTGAACAACCTGC GTACTCTTCGTGCGCAGGCAAGACCGCCGCCGC TTGAAACGCTGGAAGAAATGCTGGAAAAATTA GAAGTTGTTGTT taa GTGATAGAATTCTATCGTTAATAAGCAAAATTCATTATAAC -3′, with start codon ATG, catch isoleucine codon ATT and stop codon TAA in bold, the hns37aa ORF underlined and toe-print primer binding site in italics) and 0.5 μl additional agents (nuclease-free water, water dissolved Bac7(1–35) Bac7(1–16), Bac7(5–35) (1, 10 or 100 μM final concentration) or antibiotics (100 μM thiostrepton, 50 μM edeine, 50 μM clindamycin final concentration)). .. Reverse transcription was performed with 0.5 μl of AMV RT (NEB), 0.1 μl dNTP mix (10 mM) and 0.4 μl Pure System Buffer and incubated at 37°C for 20 min.

    Agarose Gel Electrophoresis:

    Article Title: Identification of hub genes and pathways associated with hepatocellular carcinoma based on network strategy
    Article Snippet: For the first, cDNA synthesis, RNA was mixed with oligo (dT)18 primers adjusted to 10 µl and incubated at 70°C for 5 min. Next, RNA/primer mix was used in 20-µl reactions containing 2 µl RNasin (40 U/µl), 8.0 µl 5X reverse transcriptase buffer, 8.0 µl dNTPs and 2 µl AMV reverse transcriptase (5 U/µl) (all reagents from New England Biolabs, Inc., Ipswich, MA, USA). .. Reactions were performed using the following program: 2 min at 94°C for predenaturation, followed by 35 cycles of 20 sec at 94°C, 15 sec at 60°C and 1 min at 68°C, and a final 7 min extension at 72°C.

    Article Title: The respiratory chains of four strains of the alkaliphilic Bacillus clausii
    Article Snippet: The amplified products were separated on 1% agarose gel, stained by ethidium bromide and purified from the gel using the PCR purification kit (Qiagen, West Sussex, UK). .. Total RNA (1 μg) was reverse transcribed by using random hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs).

    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA). .. EIII inserts were amplified from cDNA generated from viral genomic RNA or a synthetic plasmid using the Roche High Fidelity PCR master mix (Roche, Indianapolis, IN).

    In Vitro:

    Article Title: Structure of the mammalian antimicrobial peptide Bac7(1–16) bound within the exit tunnel of a bacterial ribosome
    Article Snippet: The position of the ribosome on the mRNA was monitored with a toe-printing assay ( ) based on an in vitro –coupled transcription-translation system with the PURExpress in vitro protein synthesis kit (NEB), as described previously ( , ). .. Reverse transcription was performed with 0.5 μl of AMV RT (NEB), 0.1 μl dNTP mix (10 mM) and 0.4 μl Pure System Buffer and incubated at 37°C for 20 min.

    Ethanol Precipitation:

    Article Title: Two Tandem RNase III Cleavage Sites Determine betT mRNA Stability in Response to Osmotic Stress in Escherichia coli
    Article Snippet: Primer extension analysis was performed using total RNA purified via heated phenol extraction and ethanol precipitation. .. RNA with labeled primers were annealed at 65°C for 15 min, slowly cooled down to room temperature for 2.5 h, and extended at 42°C for 1 h using AMV reverse transcriptase (New England Biolabs).

    Article Title: Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin
    Article Snippet: Reactions were quenched and rRNA recovered by phenol/ chloroform extraction and followed by ethanol precipitation. .. Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB).


    Article Title: RNA modification enzyme TruB is a tRNA chaperone
    Article Snippet: RNA from total extracts was reverse transcribed using AMV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol, using a TruB specific antisense primer that anneals to the 3′ end of the gene ( ). .. Briefly, total RNA (0.5 µg) was incubated with TruB antisense primer (∼50 µg) for 5 min at 65 °C, cooled, and added (5 µL) to the nuclease-free reaction mixture (20 µL) containing AMV reaction buffer (1×), AMV reverse transcriptase (4 U), and RNase inhibitor (8 U).

    Article Title: Expansion of the aminoglycoside-resistance 16S rRNA (m1A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin
    Article Snippet: Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB). .. Reverse transcriptase (RT) primer extension was carried out using a 5’-end 32 P-labeled DNA primer complementary to E. coli 16S rRNA nucleotides 1457–1473 (5’-CAAAGTGGTAAGCGCCC) and AMV reverse transcriptase (NEB).

    Article Title: Identification of hub genes and pathways associated with hepatocellular carcinoma based on network strategy
    Article Snippet: RT-PCR was performed in two steps. .. For the first, cDNA synthesis, RNA was mixed with oligo (dT)18 primers adjusted to 10 µl and incubated at 70°C for 5 min. Next, RNA/primer mix was used in 20-µl reactions containing 2 µl RNasin (40 U/µl), 8.0 µl 5X reverse transcriptase buffer, 8.0 µl dNTPs and 2 µl AMV reverse transcriptase (5 U/µl) (all reagents from New England Biolabs, Inc., Ipswich, MA, USA). .. For the second-strand synthesis, PCRs were conducted using specific primers , 0.2 mM dNTPs, 1 unit Taq DNA polymerase, 10X PCR buffer and 2 µl first-strand cDNA.

    Article Title: RNA modification enzyme TruB is a tRNA chaperone
    Article Snippet: RNA from total extracts was reverse transcribed using AMV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol, using a TruB specific antisense primer that anneals to the 3′ end of the gene ( ). .. Briefly, total RNA (0.5 µg) was incubated with TruB antisense primer (∼50 µg) for 5 min at 65 °C, cooled, and added (5 µL) to the nuclease-free reaction mixture (20 µL) containing AMV reaction buffer (1×), AMV reverse transcriptase (4 U), and RNase inhibitor (8 U). .. Following incubation for 1 h at 42 °C, the reaction mixture was heated for 5 min at 100 °C to denature the reverse transcriptase, cooled on ice for 5 min, and immediately used in PCR reactions.

    Article Title: Structure of the mammalian antimicrobial peptide Bac7(1–16) bound within the exit tunnel of a bacterial ribosome
    Article Snippet: After translation, 2 pmol Alexa647-labelled NV-1 toe-print primer (5′-GGTTATAATGAATTTTGCTTATTAAC-3′) was added to each reaction. .. Reverse transcription was performed with 0.5 μl of AMV RT (NEB), 0.1 μl dNTP mix (10 mM) and 0.4 μl Pure System Buffer and incubated at 37°C for 20 min. .. Reverse transcription was quenched and RNA degraded by addition of 1 μl 10 M NaOH and incubation for at least 15 min at 37°C and then was neutralized with 0.82 μl of 12 M HCl.


    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: HIV-1 LAI virus produced in the presence or absence of BI-D was diluted 1:10 in RT dilution buffer B (20 mM Tris-HCl pH 7.5, 50 mM KCl, 0.25 mM EDTA pH 8.0, 0.2 mM DTT, 0.025% Triton X-100, 50% glycerol) and 4 µl diluted virus was mixed with 6 µl RT mix (10 mM Tris-Cl pH 8.3, 50 mM KCl, 5 mM MgCl2 , 0.0035% Triton X-100, 0.2 mM dNTPs, 2 mM DTT, 36 nM 3 primer A [GCCTTAGCAGTGCCCTGTCT], 8 units RNAsin [Roche] and 120 ng MS2 RNA [Roche]). .. AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.

    Concentration Assay:

    Article Title: Dual nature of pseudouridylation in U2 snRNA: Pus1p-dependent and Pus1p-independent activities in yeasts and higher eukaryotes
    Article Snippet: To detect pseudouridines, test RNA samples were treated first with CMC [ N -cyclohexyl- N ′-(2-morpholinoethyl) carbodiimide metho- p -toluene sulfonate] (Sigma-Aldrich) for 20–30 min and then with pH 10.4 sodium carbonate buffer for 3–4 h at 37°C. .. Primer extension was performed using either AMV-RT (New England Biolabs) or EpiScript RT (Epicentre) at 0.5 mM dNTP concentration. .. Reaction products were purified by ethanol precipitation; dry pellets were dissolved in formamide, mixed with the GeneScan-500 LIZ Size Standard and separated on an ABI3730xl capillary electrophoresis instrument (Applied Biosystems).

    Article Title: The Allosteric HIV-1 Integrase Inhibitor BI-D Affects Virion Maturation but Does Not Influence Packaging of a Functional RNA Genome
    Article Snippet: AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve. .. AMV-RT (New England Biolabs) diluted in RT dilution buffer B was used to generate a standard curve.

    Article Title: Structure of the mammalian antimicrobial peptide Bac7(1–16) bound within the exit tunnel of a bacterial ribosome
    Article Snippet: Briefly, each translation reaction consisted of 1 μl solution A, 0.5 μl Δisoleucine amino acid mixture, 0.5 μl tRNA mixture, 1.5 μl solution B, 0.5 μl (0.5 pmol) hns37aa template: (5′-ATTAATACGACTCACTATAGGGATATAAGGAGGAAAACAT atg AGCGAAGCACTTAAA att CTGAACAACCTGC GTACTCTTCGTGCGCAGGCAAGACCGCCGCCGC TTGAAACGCTGGAAGAAATGCTGGAAAAATTA GAAGTTGTTGTT taa GTGATAGAATTCTATCGTTAATAAGCAAAATTCATTATAAC -3′, with start codon ATG, catch isoleucine codon ATT and stop codon TAA in bold, the hns37aa ORF underlined and toe-print primer binding site in italics) and 0.5 μl additional agents (nuclease-free water, water dissolved Bac7(1–35) Bac7(1–16), Bac7(5–35) (1, 10 or 100 μM final concentration) or antibiotics (100 μM thiostrepton, 50 μM edeine, 50 μM clindamycin final concentration)). .. Reverse transcription was performed with 0.5 μl of AMV RT (NEB), 0.1 μl dNTP mix (10 mM) and 0.4 μl Pure System Buffer and incubated at 37°C for 20 min.

    Gel Extraction:

    Article Title: Recovery of West Nile Virus Envelope Protein Domain III Chimeras with Altered Antigenicity and Mouse Virulence
    Article Snippet: Reverse transcription to generate viral cDNA was performed using New England BioLabs avian myeloblastosis virus reverse transcriptase (New England BioLabs, Ipswich, MA). .. EIII inserts were amplified from cDNA generated from viral genomic RNA or a synthetic plasmid using the Roche High Fidelity PCR master mix (Roche, Indianapolis, IN).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs amv reverse transcriptase
    Amv Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more reverse transcriptase/product/New England Biolabs
    Average 99 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    amv reverse transcriptase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results