e coli epap  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    E coli Poly A Polymerase
    E coli Poly A Polymerase 500 units
    Catalog Number:
    500 units
    DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs e coli epap
    E coli Poly A Polymerase
    E coli Poly A Polymerase 500 units
    https://www.bioz.com/result/e coli epap/product/New England Biolabs
    Average 79 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    e coli epap - by Bioz Stars, 2019-11
    79/100 stars


    Related Articles

    Clone Assay:

    Article Title: Regulation Mechanism Mediated by Trans-Encoded sRNA Nc117 in Short Chain Alcohols Tolerance in Synechocystis sp. PCC 6803
    Article Snippet: Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States). .. Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States).

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. The polyadenylated RNA was reverse transcribed and subsequently amplified by a long-distance RT-PCR following the Super SMART PCR cDNA Synthesis Kit protocol (Clontech).

    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: PCR products were cloned in E. coli and sequenced with virus-specific forward primers. .. Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.

    Article Title: LncRNA AK023948 is a positive regulator of AKT
    Article Snippet: For 3′ RACE we first added poly adenosine by poly A polymerase (NEB) and then reverse transcribed using AKO-polyT adaptor primer. .. PCR used primers AK0-3Race-5.1 and AKO-adaptor-5.1 ( ).


    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Gel bands containing RNA species corresponding to 28 nt were excised and physically disrupted by centrifugation through the holes of the tube. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB).

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: Gel bands containing RNA species corresponding to 28 nt were excised and physically disrupted by using centrifugation through the holes of the tube. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB).


    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA). .. The vsiRNAs were subjected to reverse transcription PCR (RT-PCR) using the SYBR Green sRNA expression assays.

    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: After its synthesis, cDNA was amplified in PCR with virus-specific forward primers and an adaptor-specific reverse primer (5'-ATG ACT CGA GTC GAC ATC GA -3'). .. Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.


    Article Title: Interplay between RNA-binding protein HuR and microRNA-125b regulates p53 mRNA translation in response to genotoxic stress
    Article Snippet: RNA was isolated from the immunoprecipitated complexes by Trizol (Thermo Fisher, 15596-018) followed by semiquantitative RT-PCR or qPCR with p53 3′UTR specific primers and GAPDH primers as control. .. Total cellular RNA was extracted using Trizol and polyadenylated using Poly A polymerase (New England Biolabs, M0276S). cDNA was synthesized from polyadenylated RNA using oligo(dT)-adapter primer by MuMLV reverse transcriptase (Thermo Fisher, 28025-013). .. An adapter-specific primer and microRNA-125b specific primer (miScript primer assay kit, Qiagen, MS00006629) with Power SYBR Green master mix (Applied Biosystems) were used for qPCR reactions in Step One Plus Real time PCR system (Thermo Fisher, 4367659).

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ YAG04, 5′-pTCGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ HTC05, 5′-pAGGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; YAG04, 5′-pAGGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; HTC05, 5′-pTCGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: DMTr protected phosphoramidites were synthesized using standard methods and the identity of the phosphoramidites was confirmed by 31 P NMR (Inova 400 MHz instrument). .. E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs.

    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: The hemi-methylation is necessary to avoid internal cleavage by subsequent Gsu I digestion [ ]. .. The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs). .. Ten units of T4 DNA polymerase (New England Biolabs) were added for 5 minutes and the reaction was stopped by adding EDTA to a final concentration of 30 mM.

    Quantitative RT-PCR:

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol.

    SYBR Green Assay:

    Article Title: The Oncogenic MicroRNA Hsa-miR-155-5p Targets the Transcription Factor ELK3 and Links It to the Hypoxia Response
    Article Snippet: Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA. .. Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA.

    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA). .. The first-strand cDNAs of sRNAs were synthesized using Moloney murine leukemia virus (M-MLV) reverse transcriptase (NEB).

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol. .. The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol.

    Nested PCR:

    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions. .. Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions.


    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: The beads were washed six times in 1 mL of buffer, resuspended in 200 μL of buffer supplemented with SDS to 1% and 10 mM EDTA, and incubated for 30 min at 55°C. .. Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions.

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ YAG04, 5′-pTCGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ HTC05, 5′-pAGGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; YAG04, 5′-pAGGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; HTC05, 5′-pTCGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: Micro(mi) RNA-34a targets protein phosphatase (PP)1γ to regulate DNA damage tolerance
    Article Snippet: TRIzol Reagent (Life Technologies) was used to extract total RNA following manufacturer's instructions. .. The extracted RNA was polyadenylated by mixing 1–10ug of RNA diluted up to 20 μl in RNase free water, 6 μl of 5 x First-Strand Buffer (Life Technologies), 3 μl of 10 mM adenosine triphosphate (ATP) (New England Biolabs), and 1 μl of E. coli poly (A) polymerase (New England Biolabs) and incubating at 37°C for 60 min followed by 65°C incubation for 20 min. .. The same amount of RNA was used for all samples within the same experiment.

    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs). .. Ten units of T4 DNA polymerase (New England Biolabs) were added for 5 minutes and the reaction was stopped by adding EDTA to a final concentration of 30 mM.

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: The precipitated RNA was resuspended in 50μl reaction (45μl of DEPC water, 5.2μl of T4 PNK buffer, 1μl of SUPERase_In and 1μl of T4 PNK (NEB)) and incubated at 37°C for 1 hr. .. First, RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (NEB).


    Article Title: Small RNAs derived from the 5? end of tRNA can inhibit protein translation in human cells
    Article Snippet: The RNA transcript was polyadenylated using E. coli poly(A) polymerase (NEB). .. In vitro translation reactions were performed as described in reference with the following concentrations of factors in 10 µL reactions: 16 mM HEPES-KOH pH 7.6, 75 mM KOAc, 2.5 mM Mg(OAc)2 , 800 µM ATP, 100 µM GTP, 125 µM spermidine (Sigma Aldrich), 100 µM amino acids, 25 mM creatine phosphate (Sigma Aldrich), 80 ng/µL creatine kinase (Sigma Aldrich), 100 ng/µL tRNA (Sigma Aldrich), 1 µL/10 µL RNasin (Promega), 10 ng/µL mRNA and 2 µL HeLa cytoplasmic extract per reaction.

    Activity Assay:

    Article Title: Small RNAs derived from the 5? end of tRNA can inhibit protein translation in human cells
    Article Snippet: The RNA transcript was polyadenylated using E. coli poly(A) polymerase (NEB). .. In vitro translation reactions were performed as described in reference with the following concentrations of factors in 10 µL reactions: 16 mM HEPES-KOH pH 7.6, 75 mM KOAc, 2.5 mM Mg(OAc)2 , 800 µM ATP, 100 µM GTP, 125 µM spermidine (Sigma Aldrich), 100 µM amino acids, 25 mM creatine phosphate (Sigma Aldrich), 80 ng/µL creatine kinase (Sigma Aldrich), 100 ng/µL tRNA (Sigma Aldrich), 1 µL/10 µL RNasin (Promega), 10 ng/µL mRNA and 2 µL HeLa cytoplasmic extract per reaction.

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs. .. Human pol α (N-His6 -p70-p180 complex), expressed in baculovirus-infected Sf 9 insect cells was grown at the Tissue Culture Core Facility at the University of Colorado Health Sciences Center, and purified by nickel nitrilotriacetic acid column chromatography ( ).


    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA). .. The first-strand cDNAs of sRNAs were synthesized using Moloney murine leukemia virus (M-MLV) reverse transcriptase (NEB).

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol. .. Real time PCR was performed using SYBR Green PCR Mix kit (Qiagen), according to the manufacturer's protocol , with the following primers: miR-130a, 5′-TTCACATTGTGCTACTGTCTGC-3′ ; miR-301a, 5′-GCTCTGACTTTATTGCACTACT-3′ ; miR-454, 5′-ACCCTATCAATATTGTCTCTGC-3′ ; universal primer, 5′-GCGAGCACAGAATTAATACGAC-3′ ; U6-F, 5′-CGCTTCGGCAGCACATATACTA-3′ , U6-R, 5′-CGCTTCACGAATTTGCGTGTCA-3′ .

    Acrylamide Gel Assay:

    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: For 3′ chemical end group analysis of crRNAs from CRISPR loci 1–3, 100 μg of Sth total RNA was separated on a 7M urea TBE 15% acrylamide gel and RNAs between ~30 and ~65 nucleotides were gel purified as described previously ( ). .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.

    Gel Purification:

    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions. .. Two reactions of a nested PCR with RACE primers (RACE-O 5′-AAGGCTCCGTCGGCATCG, RACE-I 5′-GCATCGATCGCGCGACTC, H-8633 5′-ACTATCCCGCCAATGAAGAACCTA, H-8862 5′-CTTCCAGGGTTGAACATGCTGTG) were performed to detect the respective MV mRNA transcripts.


    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: After 24 hr, cells were transfected with microRNA mimics as described above. .. Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions.


    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. RT-PCR products were cloned into pCR 2.1-TOPO vector (Invitrogen) and sequenced.

    Protease Inhibitor:

    Article Title: Identification, cloning and characterization of a new DNA-binding protein from the hyperthermophilic methanogen Methanopyrus kandleri
    Article Snippet: Complete protease inhibitor cocktail was purchased from Roche Molecular Systems (Switzerland). .. ThermoFidelase I was from Fidelity Systems (USA), while pUC19 DNA, restriction endonucleases and the Klenow fragment of E.coli DNA polymerase I were purchased from New England Biolabs (USA).

    Northern Blot:

    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP. .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.


    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Fifteen hours post-transfection, cells were washed with 1 mL PBS (Life Technologies) and infected with MV-EGFP-HmiRTS7 , MV-EGFP-HmiRTS7rc , MV-EGFP-HmiRTS122 , MV-EGFP-HmiRTS122rc , or MV-EGFP-HmiRTS124 at an MOI of 0.03. .. Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions.


    Article Title: Small RNAs derived from the 5? end of tRNA can inhibit protein translation in human cells
    Article Snippet: Renilla mRNA was generated by T7 in vitro transcription of psiCheck-2 (Promega) that had been linearized with NotI. .. The RNA transcript was polyadenylated using E. coli poly(A) polymerase (NEB).

    Gel Extraction:

    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions. .. Two reactions of a nested PCR with RACE primers (RACE-O 5′-AAGGCTCCGTCGGCATCG, RACE-I 5′-GCATCGATCGCGCGACTC, H-8633 5′-ACTATCCCGCCAATGAAGAACCTA, H-8862 5′-CTTCCAGGGTTGAACATGCTGTG) were performed to detect the respective MV mRNA transcripts.

    Article Title: NRF2 regulates endothelial glycolysis and proliferation with miR-93 and mediates the effects of oxidized phospholipids on endothelial activation
    Article Snippet: Dephosphorylation reactions were purified with gel extraction on Novex 10% polyacrylamide TBE–urea gel (Life Technologies). .. RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs).

    DNA Sequencing:

    Article Title: LncRNA AK023948 is a positive regulator of AKT
    Article Snippet: For 3′ RACE we first added poly adenosine by poly A polymerase (NEB) and then reverse transcribed using AKO-polyT adaptor primer. .. PCR used primers AK0-3Race-5.1 and AKO-adaptor-5.1 ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA). .. The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA).

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. The polyadenylated RNA was reverse transcribed and subsequently amplified by a long-distance RT-PCR following the Super SMART PCR cDNA Synthesis Kit protocol (Clontech).


    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions.

    RNA Sequencing Assay:

    Article Title: NRF2 regulates endothelial glycolysis and proliferation with miR-93 and mediates the effects of oxidized phospholipids on endothelial activation
    Article Snippet: Paragraph title: RNA sequencing ... RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs).


    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: The other protocol modification was to use methylated dCTP (dm5 CTP, Fermentas). .. The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs).


    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: Total RNAs was isolated from the viruliferous and nonviruliferous rice/planthoppers using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). .. The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA).

    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Thirty-five hours p.i., medium was aspirated, cells were washed with 1 mL PBS, and total RNA was isolated using the RNeasy Mini Kit (QIAGEN). .. Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: For miRNA analysis, poly-A real-time qRT-PCR was used. .. The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol. .. Then, the poly-A tailed RNA was reverse transcribed using ImProm Reverse Transcriptase (Promega), following the manufacturer's protocol, and miR-RT primer (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Regulation Mechanism Mediated by Trans-Encoded sRNA Nc117 in Short Chain Alcohols Tolerance in Synechocystis sp. PCC 6803
    Article Snippet: Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States). .. Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States).

    Article Title: Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus
    Article Snippet: Paragraph title: Reverse transcription PCR for vsiRNAs ... The poly (A) was added to the 3′ end of sRNAs by E. coli Poly(A) Polymerase (NEB, Ipswich, MA, USA).

    Article Title: Enhanced Control of Oncolytic Measles Virus Using MicroRNA Target Sites
    Article Snippet: Poly(A) tail synthesis was performed using E. coli Poly(A) Polymerase (New England Biolabs) according to the manufacturer’s instructions. .. Two reactions of a nested PCR with RACE primers (RACE-O 5′-AAGGCTCCGTCGGCATCG, RACE-I 5′-GCATCGATCGCGCGACTC, H-8633 5′-ACTATCCCGCCAATGAAGAACCTA, H-8862 5′-CTTCCAGGGTTGAACATGCTGTG) were performed to detect the respective MV mRNA transcripts.

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. The polyadenylated RNA was reverse transcribed and subsequently amplified by a long-distance RT-PCR following the Super SMART PCR cDNA Synthesis Kit protocol (Clontech).

    Article Title: The GCN2-ATF4 signaling pathway activates 4E-BP to bias mRNA translation and boost antimicrobial peptide synthesis in response to bacterial infection
    Article Snippet: Transcription templates for monocistronic reporters were created by PCR with a template specific forward primer containing either a T7 or T3 promoter sequence and a vector specific reverse primer. .. Transcripts were poly(A) tailed using E.coli poly(A)polymerase (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation.

    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: PCR products were cloned in E. coli and sequenced with virus-specific forward primers. .. Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol. .. The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol.

    Article Title: LncRNA AK023948 is a positive regulator of AKT
    Article Snippet: We performed 5′ RACE using a previous described procedure , followed by PCR with primers AKO-polyT adaptor, AK0-adaptor and AK0-5Race-3.2 ( ). .. For 3′ RACE we first added poly adenosine by poly A polymerase (NEB) and then reverse transcribed using AKO-polyT adaptor primer.

    Size-exclusion Chromatography:

    Article Title: The Oncogenic MicroRNA Hsa-miR-155-5p Targets the Transcription Factor ELK3 and Links It to the Hypoxia Response
    Article Snippet: Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA. .. Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA.


    Article Title: Regulation Mechanism Mediated by Trans-Encoded sRNA Nc117 in Short Chain Alcohols Tolerance in Synechocystis sp. PCC 6803
    Article Snippet: Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States). .. Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States).

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: The gel debris was removed using a Spin-X column (Corning) and RNA was purified by using ethanol precipitation. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ YAG04, 5′-pTCGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′ HTC05, 5′-pAGGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: For 3′ chemical end group analysis of crRNAs from CRISPR loci 1–3, 100 μg of Sth total RNA was separated on a 7M urea TBE 15% acrylamide gel and RNAs between ~30 and ~65 nucleotides were gel purified as described previously ( ). .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.

    Article Title: The GCN2-ATF4 signaling pathway activates 4E-BP to bias mRNA translation and boost antimicrobial peptide synthesis in response to bacterial infection
    Article Snippet: Transcripts were capped using Vaccinia Virus Capping enzyme (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation. .. Transcripts were poly(A) tailed using E.coli poly(A)polymerase (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation. .. Translation assays were performed in rabbit reticulocyte Lysate (Green Hectares, McFarland, WI) (treated with Micrococcal nuclease for experiments in 3C, D) and mRNA reporter prepared as described above (see for buffer composition details).

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: The gel debris was removed using a Spin-X column (Corning) and RNA was purified by using ethanol precipitation. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB). .. For reverse transcription, the following oligos containing barcodes were synthesized: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; YAG04, 5′-pAGGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATT TTTTTTTTTTTTTTTTTTVN-3′; HTC05, 5′-pTCGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′.

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs. .. E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs.

    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: First strand cDNA was synthesized from the purified mRNA, using the Superscript II Reverse Transcriptase (Invitrogen), according to the manufacturer instructions, with a modified primer, GAGAGAGAGACTGGAG(T)16 VN, containing the Gsu I restriction enzyme site (CTGGAGNNNNNNNNNNNNNNNN^, overhang NN-3'), to trim the polyA tail after cDNA synthesis. .. The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs).

    Article Title: NRF2 regulates endothelial glycolysis and proliferation with miR-93 and mediates the effects of oxidized phospholipids on endothelial activation
    Article Snippet: Dephosphorylation reactions were purified with gel extraction on Novex 10% polyacrylamide TBE–urea gel (Life Technologies). .. RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs).

    Dot Blot:

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions.


    Article Title: Regulation Mechanism Mediated by Trans-Encoded sRNA Nc117 in Short Chain Alcohols Tolerance in Synechocystis sp. PCC 6803
    Article Snippet: Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States). .. Then RNA was added with a poly(A) tail using NEB E. coli poly(A) polymerase (New England Biolabs Inc., Ipswich, MA, United States).

    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: Half of each reaction was separated on 7M urea TBE 15% polyacrylamide gels for Northern analysis, probing for the first spacer sequence from each CRISPR locus (Probe sequences can be found in ). .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.

    Article Title: The GCN2-ATF4 signaling pathway activates 4E-BP to bias mRNA translation and boost antimicrobial peptide synthesis in response to bacterial infection
    Article Snippet: Transcription templates for monocistronic reporters were created by PCR with a template specific forward primer containing either a T7 or T3 promoter sequence and a vector specific reverse primer. .. Transcripts were poly(A) tailed using E.coli poly(A)polymerase (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation.

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: Paragraph title: Global run-on sequencing analysis (GRO-seq) ... First, RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (NEB).

    De-Phosphorylation Assay:

    Article Title: NRF2 regulates endothelial glycolysis and proliferation with miR-93 and mediates the effects of oxidized phospholipids on endothelial activation
    Article Snippet: Dephosphorylation reactions were purified with gel extraction on Novex 10% polyacrylamide TBE–urea gel (Life Technologies). .. RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs).


    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: For 3′ chemical end group analysis of crRNAs from CRISPR loci 1–3, 100 μg of Sth total RNA was separated on a 7M urea TBE 15% acrylamide gel and RNAs between ~30 and ~65 nucleotides were gel purified as described previously ( ). .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.

    cDNA Library Assay:

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: Paragraph title: cDNA library construction of RPF ... Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB).

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: Paragraph title: cDNA library construction of ribosome-protected mRNA fragments ... Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB).

    Activated Clotting Time Assay:

    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: After its synthesis, cDNA was amplified in PCR with virus-specific forward primers and an adaptor-specific reverse primer (5'-ATG ACT CGA GTC GAC ATC GA -3'). .. Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.

    Rapid Amplification of cDNA Ends:

    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: Paragraph title: 3' Rapid amplification of cDNA ends (3' RACE) ... Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.

    Chromatin Immunoprecipitation:

    Article Title: NRF2 regulates endothelial glycolysis and proliferation with miR-93 and mediates the effects of oxidized phospholipids on endothelial activation
    Article Snippet: RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs). .. RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1 mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (New England Biolabs).

    Plasmid Preparation:

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. The polyadenylated RNA was reverse transcribed and subsequently amplified by a long-distance RT-PCR following the Super SMART PCR cDNA Synthesis Kit protocol (Clontech).

    Article Title: The GCN2-ATF4 signaling pathway activates 4E-BP to bias mRNA translation and boost antimicrobial peptide synthesis in response to bacterial infection
    Article Snippet: Transcription templates for monocistronic reporters were created by PCR with a template specific forward primer containing either a T7 or T3 promoter sequence and a vector specific reverse primer. .. Transcripts were poly(A) tailed using E.coli poly(A)polymerase (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation.

    Real-time Polymerase Chain Reaction:

    Article Title: Interplay between RNA-binding protein HuR and microRNA-125b regulates p53 mRNA translation in response to genotoxic stress
    Article Snippet: Paragraph title: Quantitative PCR ... Total cellular RNA was extracted using Trizol and polyadenylated using Poly A polymerase (New England Biolabs, M0276S). cDNA was synthesized from polyadenylated RNA using oligo(dT)-adapter primer by MuMLV reverse transcriptase (Thermo Fisher, 28025-013).

    Article Title: The Oncogenic MicroRNA Hsa-miR-155-5p Targets the Transcription Factor ELK3 and Links It to the Hypoxia Response
    Article Snippet: Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA. .. Total RNA (500 µg) prepared using TRIREAGENT was treated with polymerase A (NEB, Cat. No. M0276L) for 15 min at 37°C to add a poly A tail to the ends of the miRNA.

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol. .. The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol.

    RNA Extraction:

    Article Title: An Essential Pentatricopeptide Repeat Protein Facilitates 5? Maturation and Translation Initiation of rps3 mRNA in Maize Mitochondria
    Article Snippet: Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions. .. Three microliters of the RNA obtained from the pellet was used in a poly(A) tailing reaction using E. coli Poly(A) Polymerase (NEB) according to the manufacturer’s instructions.

    Article Title: Micro(mi) RNA-34a targets protein phosphatase (PP)1γ to regulate DNA damage tolerance
    Article Snippet: Paragraph title: RNA extraction and reverse transcription ... The extracted RNA was polyadenylated by mixing 1–10ug of RNA diluted up to 20 μl in RNase free water, 6 μl of 5 x First-Strand Buffer (Life Technologies), 3 μl of 10 mM adenosine triphosphate (ATP) (New England Biolabs), and 1 μl of E. coli poly (A) polymerase (New England Biolabs) and incubating at 37°C for 60 min followed by 65°C incubation for 20 min.

    Article Title: The Oncogenic Role of microRNA-130a/301a/454 in Human Colorectal Cancer via Targeting Smad4 Expression
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... The isolated RNA was polyadenylated using poly-A polymerase (New England Biolabs) according to the manufacturer's protocol.

    Binding Assay:

    Article Title: Reprogramming Transcription via Distinct Classes of Enhancers Functionally Defined by eRNA
    Article Snippet: After binding, beads were washed once in low salt buffer (0.2×SSPE, 1mM EDTA, 0.05% Tween-20), twice in high salt buffer (0.5% SSPE, 1mM EDTA, 0.05% Tween-20, 150mM NaCl), and twice in TET buffer (TE pH7.4, 0.05% Tween-20). .. First, RNA fragments were subjected to poly-A tailing reaction in 8.0μl volume containing 0.8μl poly-A polymerase buffer, 1μl 1mM ATP, 0.5μl of SUPERase-In, and 0.75μl poly-A polymerase (NEB).

    In Vitro:

    Article Title: Small RNAs derived from the 5? end of tRNA can inhibit protein translation in human cells
    Article Snippet: Paragraph title: In vitro translation ... The RNA transcript was polyadenylated using E. coli poly(A) polymerase (NEB).

    Article Title: The GCN2-ATF4 signaling pathway activates 4E-BP to bias mRNA translation and boost antimicrobial peptide synthesis in response to bacterial infection
    Article Snippet: Paragraph title: In vitro Transcription and mRNA reporter preparation ... Transcripts were poly(A) tailed using E.coli poly(A)polymerase (New England Biolabs) and purified by phenol/chloroform extraction and isopropanol precipitation.


    Article Title: The nucleotide sequence and genome organization of Plasmopara halstedii virus
    Article Snippet: The 3' ends of RNA1 and RNA2 were determined when viral RNA was transcribed into cDNA with an adaptor (5'-ATG ACT CGA GTC GAC ATC GAT TTT TTT TTT TTT TTT TTT TTT TTT TTV N -3') which included a poly(T) tract (adaptor and adaptor-specific primer modified after Sambrook and Russell, 2001). .. Control experiments with E. coli poly(A) polymerase (NewEngland Biolabs, Ipswich, MA) indicated the lack of internal annealing sites for poly(T), thus confirming that both viral RNA segments featured a poly(A) tract at their 3' ends.

    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: The other protocol modification was to use methylated dCTP (dm5 CTP, Fermentas). .. The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs).

    Column Chromatography:

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs. .. E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs.

    Ethanol Precipitation:

    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: The gel debris was removed using a Spin-X column (Corning) and RNA was purified by using ethanol precipitation. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB).

    Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus
    Article Snippet: The reactions were terminated by phenol/chloroform/isoamyl alcohol (PCI) extraction followed by ethanol precipitation. .. Gel-purified RNAs were treated with E. coli poly(A) polymerase (NEB) in reactions containing 10% of the gel-purified RNA, 1X poly(A) reaction buffer, and 1 mM ATP.

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: The gel debris was removed using a Spin-X column (Corning) and RNA was purified by using ethanol precipitation. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB).

    Article Title: Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing
    Article Snippet: The second strand cDNA was synthesized according to the Second Strand Synthesis Invitrogen protocol by adding 1× of Second-Strand Reaction Buffer (Invitrogen), 0.2 mM of classical dNTP mix, 10 U of E. coli DNA Ligase (New England Biolabs), 40 U of E. coli DNA Polymerase (New England Biolabs), 2.5 U of E. coli RNase H (New England Biolabs). .. Samples were then incubated 15 min at 37°C with 5 U of Ribonuclease I (Fermentas).

    Nuclear Magnetic Resonance:

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: DMTr protected phosphoramidites were synthesized using standard methods and the identity of the phosphoramidites was confirmed by 31 P NMR (Inova 400 MHz instrument). .. E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs.

    Concentration Assay:

    Article Title: Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase ? and Klenow Fragment
    Article Snippet: The concentration of the oligonucleotides was determined from their UV absorption at 260 nm. .. E. coli DNA polymerase I Klenow fragment (exo− ) was purchased from New England Biolabs.


    Article Title: Ribosome profiling reveals sequence-independent post-initiation pausing as a signature of translation
    Article Snippet: The gel was stained with SYBR Gold (Invitrogen) to visualize the RNA fragments. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s. Poly-(A) tailing reaction was performed in a 8 μl buffer with 1× poly-(A) polymerase, 1 mM ATP, 0.75 U/μl SUPERase_In, and 3 U E. coli poly-(A) polymerase (NEB).

    Article Title: Quantitative profiling of initiating ribosomes in vivo
    Article Snippet: The gel was stained with SYBR Gold (Invitrogen) to visualize the RNA fragments. .. Purified RNA fragments were resuspended in 10 mM Tris (pH 8) and denatured briefly at 65 °C for 30 s Poly-(A) tailing reaction was performed in a 8 μL with 1 × poly-(A) polymerase buffer, 1 mM ATP, 0.75 U/μL SUPERase_ In, and 3 U E. coli poly-(A) polymerase (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs e coli poly
    E Coli Poly, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli poly/product/New England Biolabs
    Average 99 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    e coli poly - by Bioz Stars, 2019-11
    99/100 stars
      Buy from Supplier

    New England Biolabs e coli epap
    E Coli Epap, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli epap/product/New England Biolabs
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli epap - by Bioz Stars, 2019-11
    79/100 stars
      Buy from Supplier

    New England Biolabs 7 methylguanosine cap structure
    7 Methylguanosine Cap Structure, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7 methylguanosine cap structure/product/New England Biolabs
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    7 methylguanosine cap structure - by Bioz Stars, 2019-11
    82/100 stars
      Buy from Supplier

    Image Search Results