t7 exonuclease  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T7 Exonuclease
    Description:
    T7 Exonuclease 5 000 units
    Catalog Number:
    M0263L
    Price:
    256
    Size:
    5 000 units
    Category:
    Exonucleases
    Buy from Supplier


    Structured Review

    New England Biolabs t7 exonuclease
    T7 Exonuclease
    T7 Exonuclease 5 000 units
    https://www.bioz.com/result/t7 exonuclease/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    t7 exonuclease - by Bioz Stars, 2019-08
    99/100 stars

    Images

    Related Articles

    Polyacrylamide Gel Electrophoresis:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: DNA was then extracted and purified by QIAEX II (QIAGEN) and finally analyzed by 7% denaturing PAGE. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Article Title:
    Article Snippet: T7 exonuclease is known to act in the 5′–3′ direction on a linear DNA but not on circular DNA. .. End joining reaction products resulting from K562 extracts were treated with increasing concentrations (0.1–10 units) or 5 units of T7 exonuclease at 25 °C for 2 h and resolved on an 8% denaturing PAGE. .. Results showed that T7 exonuclease was able to digest the bands corresponding to the substrate and linear dimer DNA but not the one in between ( B , lanes 2 and 3 ) (data not shown), suggesting the circular nature of the products.

    Synthesized:

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: The dsDNA (4,957 bp) constructs were synthesized by using PCR, using a biontinylated primer and a regular primer ( ). .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    Autoradiography:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C. .. This DNA was purified by phenol/chloroform extraction and ethanol precipitation, dissolved in TE (pH 8, 26°C) with an equal volume of urea isolation buffer (10 M urea, 20 mM EDTA, 5 mM Tris-Cl [pH 7.5, 26°C]) and resolved by 5.2% denaturing PAGE.

    Construct:

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: Purified PCR products were incubated with terminal transferase (New England Biolabs) and digoxigenin-11-dideoxyUTP (Roche Applied Science) to label 3′-ends of the PCR product with a single digoxigenin-modified digoxigenin-11-dideoxyUTP ( ) to attach this end to antidigoxigenin-coated beads. .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ). .. Because of the biotin–neutravidin coupling on the 5′-end of one strand, the only available initiation site is the 5′-end of the complementary strand, thus, only the latter strand is selectively digested ( ).

    SYBR Green Assay:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: Reactions were stopped by the addition of EDTA, and samples were resolved by agarose gel electrophoresis as described above, without MgCl2 and ZnCl2 , and visualized with SYBR Green I as described above. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Incubation:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: DNA was then extracted and purified by QIAEX II (QIAGEN) and finally analyzed by 7% denaturing PAGE. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C. .. The reaction was terminated with an equal volume of urea analysis buffer as described above and analyzed by 5.2% denaturing PAGE.

    Article Title:
    Article Snippet: To a 75-μl reaction mixture 1 unit of T4 DNA ligase was added, and incubation continued for various times up to 45 min at 16 °C. .. Finally, the exonuclease reaction was carried out in a 100-μl reaction mix containing 1 unit of T7 exonuclease (NEB 4 buffer) at 25 °C for 6 h. Samples were trichloroacetic acid-precipitated and passed through a GF/C filter.

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: Purified PCR products were incubated with terminal transferase (New England Biolabs) and digoxigenin-11-dideoxyUTP (Roche Applied Science) to label 3′-ends of the PCR product with a single digoxigenin-modified digoxigenin-11-dideoxyUTP ( ) to attach this end to antidigoxigenin-coated beads. .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    Article Title:
    Article Snippet: Exo I removes nucleotides from single-stranded DNA in the 3′–5′ direction. .. G-strand overhang was also measured after incubation of genomic DNA with T7 exonuclease (1 unit/μg DNA) (New England Biolabs) in NE-Buffer 4 at 25 °C for 60 s. T7 exonuclease acts in the 5′–3′ direction to remove 5′ nucleotides from duplex DNA. .. The reaction was stopped by the addition of 20 m m EDTA at 65 °C for 10 min.

    Article Title: Protection of Arabidopsis Blunt-Ended Telomeres Is Mediated by a Physical Association with the Ku Heterodimer
    Article Snippet: The buffer was replaced with 100 μL of buffer with Ku and plates were incubated for 30 min in the dark prior to the second fluorescence measurement (F2 ). in each well was determined with the formula: = (F2 − F1 )/F1 * 100 [%], and this value was further normalized by subtracting in a control well without a protein. .. Following the measurement, the Ku-DNA mixture (15 and 2.5 pmol, respectively, in 100 μL per well) was treated with 10 units of T7 Exonuclease (New England Biolabs) for 1 h at 37°C.

    Article Title: Mapping RNA–RNA interactome and RNA structure in vivo by MARIO
    Article Snippet: The RNA pellet was resuspended in 17 μl of RNase-free water, 4 μl of 10 × NEBuffer4 and 7 μl of 100 μM cDNA oligo. .. The annealed mixture was then mixed with 8 μl of 10 U μl−1 T7 exonuclease (NEB), 4 μl of 1 mg ml−1 BSA and incubated at 37 °C for 1 h. We removed the DNA oligonucleotides and any contaminating genomic DNA using TURBO DNase rigorous treatment: 44 μl of RNase-free water, 10 μl of 10 × TURBO DNase buffer and 6 μl of TURBO DNase (Invitrogen) was added, and the resulting mixture was incubated at 37 °C for 1 h. DNase-treated RNA was purified by phenol:chloroform extraction and ethanol precipitation as described above. .. rRNA was removed according to the manufacturer's instructions with the following modifications.

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Reactions were then incubated statically at room temperature for 5 min before assessing fluorescence of intercalated SYBR Safe on an FLA-9000IR instrument (GE Healthcare Life Sciences). .. Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs).

    Activity Assay:

    Article Title: Mapping RNA–RNA interactome and RNA structure in vivo by MARIO
    Article Snippet: This was based on the RNase H activity of T7 exonuclease, which not only removes 5′-mononucleotides from duplex DNA but also exert exonucleolytic activity on the RNA strand from a RNA–DNA hybrid . .. The annealed mixture was then mixed with 8 μl of 10 U μl−1 T7 exonuclease (NEB), 4 μl of 1 mg ml−1 BSA and incubated at 37 °C for 1 h. We removed the DNA oligonucleotides and any contaminating genomic DNA using TURBO DNase rigorous treatment: 44 μl of RNase-free water, 10 μl of 10 × TURBO DNase buffer and 6 μl of TURBO DNase (Invitrogen) was added, and the resulting mixture was incubated at 37 °C for 1 h. DNase-treated RNA was purified by phenol:chloroform extraction and ethanol precipitation as described above.

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Paragraph title: DNase Activity Assay. ... Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs).

    Hybridization:

    Article Title:
    Article Snippet: Paragraph title: Hybridization Protection Assay ... G-strand overhang was also measured after incubation of genomic DNA with T7 exonuclease (1 unit/μg DNA) (New England Biolabs) in NE-Buffer 4 at 25 °C for 60 s. T7 exonuclease acts in the 5′–3′ direction to remove 5′ nucleotides from duplex DNA.

    Article Title: Effects of Microchannel Shape and Ultrasonic Mixing on Microfluidic Padlock Probe Rolling Circle Amplification (RCA) Reactions
    Article Snippet: In subsequent operations, the reaction solution volume was 3.5 µL for the microdevice and 20 µL for the well, with a washing buffer volume of 60 µL for every device. .. Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs). .. The microchannel was washed with the washing buffer at 25 °C.

    Article Title: Effects of Microchannel Shape and Ultrasonic Mixing on Microfluidic Padlock Probe Rolling Circle Amplification (RCA) Reactions
    Article Snippet: In subsequent operations, the reaction solution volume was 3.5 µL for the microdevice and 20 µL for the well, with a washing buffer volume of 60 µL for every device. .. Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs). .. The microchannel was washed with the washing buffer at 25 °C.

    Ligation:

    Article Title:
    Article Snippet: Paragraph title: Ligation Assay ... Finally, the exonuclease reaction was carried out in a 100-μl reaction mix containing 1 unit of T7 exonuclease (NEB 4 buffer) at 25 °C for 6 h. Samples were trichloroacetic acid-precipitated and passed through a GF/C filter.

    Article Title: Effects of Microchannel Shape and Ultrasonic Mixing on Microfluidic Padlock Probe Rolling Circle Amplification (RCA) Reactions
    Article Snippet: Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs). .. Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs).

    Article Title: Effects of Microchannel Shape and Ultrasonic Mixing on Microfluidic Padlock Probe Rolling Circle Amplification (RCA) Reactions
    Article Snippet: Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs). .. Target sequences were made accessible for hybridization by digestion with 0.5 U/µL Msc I restriction enzyme and 0.4 U/µL T7 exonuclease (both from New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min in 1× restriction enzyme buffer supplemented with 0.2 mg/mL bovine serum albumin (BSA; New England Biolabs).

    Footprinting:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: DNA was then extracted and purified by QIAEX II (QIAGEN) and finally analyzed by 7% denaturing PAGE. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C. .. The reaction was terminated with an equal volume of urea analysis buffer as described above and analyzed by 5.2% denaturing PAGE.

    Generated:

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ). .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    other:

    Article Title:
    Article Snippet: The reaction products were digested with T7 exonuclease, and measurements of π-mediated enhancement of circle formation were carried out by counting the exonuclease-resistant label.

    Article Title:
    Article Snippet: Results showed that following digestion with XhoI, even the circularized band was sensitive to T7 exonuclease ( B , lanes 4 and 5 ).

    Article Title:
    Article Snippet: Interestingly, one of the circular bands (Form I) was sensitive neither to XhoI nor to T7 exonuclease, possibly because of inherent distortion of each nucleotide due to circularization of apparently a 75-mer ( B , lanes 4 and 5 ).

    Article Title:
    Article Snippet: Results showed that T7 exonuclease was able to digest the bands corresponding to the substrate and linear dimer DNA but not the one in between ( B , lanes 2 and 3 ) (data not shown), suggesting the circular nature of the products.

    Article Title: The cohesin-like RecN protein stimulates RecA-mediated recombinational repair of DNA double-strand breaks
    Article Snippet: All restriction endonucleases and T7 exonuclease were purchased from New England Biolabs.

    Sequencing:

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: The PCR product encompassed the sequence (19,360, 24,316) from bacteriophage λ DNA (New England Biolabs). .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    Injection:

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: Purified PCR products were incubated with terminal transferase (New England Biolabs) and digoxigenin-11-dideoxyUTP (Roche Applied Science) to label 3′-ends of the PCR product with a single digoxigenin-modified digoxigenin-11-dideoxyUTP ( ) to attach this end to antidigoxigenin-coated beads. .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ). .. Because of the biotin–neutravidin coupling on the 5′-end of one strand, the only available initiation site is the 5′-end of the complementary strand, thus, only the latter strand is selectively digested ( ).

    Nucleic Acid Electrophoresis:

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Loss of signal is indicative of DNase activity in these assays. .. Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs). .. For assessing the activity of cellular fractions, the genomic DNA of cells was accounted for in total and protoplast fractions and additional linear DNA substrate (salmon sperm DNA) was added to obtain 2 μg total DNA in each reaction.

    Fluorescence:

    Article Title: Protection of Arabidopsis Blunt-Ended Telomeres Is Mediated by a Physical Association with the Ku Heterodimer
    Article Snippet: The buffer was replaced with 100 μL of buffer with Ku and plates were incubated for 30 min in the dark prior to the second fluorescence measurement (F2 ). in each well was determined with the formula: = (F2 − F1 )/F1 * 100 [%], and this value was further normalized by subtracting in a control well without a protein. .. Following the measurement, the Ku-DNA mixture (15 and 2.5 pmol, respectively, in 100 μL per well) was treated with 10 units of T7 Exonuclease (New England Biolabs) for 1 h at 37°C.

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Reactions were then incubated statically at room temperature for 5 min before assessing fluorescence of intercalated SYBR Safe on an FLA-9000IR instrument (GE Healthcare Life Sciences). .. Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs).

    Isolation:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Purification:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: DNA was then extracted and purified by QIAEX II (QIAGEN) and finally analyzed by 7% denaturing PAGE. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Article Title: 5?CAG and 5?CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs
    Article Snippet: Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB). .. Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB).

    Article Title:
    Article Snippet: The purity of cytoplasmic and nuclear extracts was tested by immunoblotting using the markers α-tubulin and histone 3, respectively. .. T7 exonuclease digestion was performed by incubating purified EJ products with either increasing concentrations or 5 units of T7 exonuclease (New England Biolabs) at 25 °C for 2 h. In some cases, a fraction of EJ products was digested with XhoI (4 units) (37 °C for 4 h) prior to T7 exonuclease digestion. .. The EJ products of interest were cut out from PAGE, and DNA was eluted in a solution containing Tris (10 m m ), EDTA (1 m m ) and NaCl (0.5 m ).

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: Purified PCR products were incubated with terminal transferase (New England Biolabs) and digoxigenin-11-dideoxyUTP (Roche Applied Science) to label 3′-ends of the PCR product with a single digoxigenin-modified digoxigenin-11-dideoxyUTP ( ) to attach this end to antidigoxigenin-coated beads. .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    Article Title: Mapping RNA–RNA interactome and RNA structure in vivo by MARIO
    Article Snippet: The RNA pellet was resuspended in 17 μl of RNase-free water, 4 μl of 10 × NEBuffer4 and 7 μl of 100 μM cDNA oligo. .. The annealed mixture was then mixed with 8 μl of 10 U μl−1 T7 exonuclease (NEB), 4 μl of 1 mg ml−1 BSA and incubated at 37 °C for 1 h. We removed the DNA oligonucleotides and any contaminating genomic DNA using TURBO DNase rigorous treatment: 44 μl of RNase-free water, 10 μl of 10 × TURBO DNase buffer and 6 μl of TURBO DNase (Invitrogen) was added, and the resulting mixture was incubated at 37 °C for 1 h. DNase-treated RNA was purified by phenol:chloroform extraction and ethanol precipitation as described above. .. rRNA was removed according to the manufacturer's instructions with the following modifications.

    Polymerase Chain Reaction:

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes
    Article Snippet: Assembly reactions were prepared in 0.2 ml PCR tubes and cycled in a thermocycler as follows: 25°C for 1 h, 75°C for 20 min, 50°C for 30 min, then held at 4°C. .. Assembly reactions with other exonucleases were cycled as follows: T5 exonuclease (T5exo; NEB, cat. no. M0363): 50°C for 30 min, then held at 4°C; T7 exonuclease (T7exo; NEB, cat. no. M0263): 25°C for 20 min, 50°C for 30 min, then held at 4°C; DNA polymerase I Klenow fragment (Kle; NEB, cat. no. M0210), T7 DNA polymerase (T7pol; NEB, cat. no. M0274) and λ exonuclease (λexo; NEB, cat. no. M0262): 25°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Exonuclease III (ExoIII; NEB, cat. no. M0206): 37°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Phusion DNA polymerase (Phu; NEB, cat. no. M0530): 37°C for 20 min, 50°C for 30 min, then held at 4°C.

    Article Title: Direct imaging of single UvrD helicase dynamics on long single-stranded DNA
    Article Snippet: Purified PCR products were incubated with terminal transferase (New England Biolabs) and digoxigenin-11-dideoxyUTP (Roche Applied Science) to label 3′-ends of the PCR product with a single digoxigenin-modified digoxigenin-11-dideoxyUTP ( ) to attach this end to antidigoxigenin-coated beads. .. After the 5-kbp dsDNA (4,957 bp+1 nt) constructs are immobilized on the surface, T7 exonuclease (New England Biolabs) is injected into the chamber ( ).

    Blocking Assay:

    Article Title: Mapping RNA–RNA interactome and RNA structure in vivo by MARIO
    Article Snippet: A complementary DNA oligonucleotide (5′- T*C*G*C*ATTGCATGGGCTACTAGCAT -3′, where * denotes the phosphorothioate bond to block its digestion by T7 exonuclease ) was annealed to the RNA linker, creating a double-stranded DNA–RNA hybrid between the RNA linker and the cDNA strand. .. The annealed mixture was then mixed with 8 μl of 10 U μl−1 T7 exonuclease (NEB), 4 μl of 1 mg ml−1 BSA and incubated at 37 °C for 1 h. We removed the DNA oligonucleotides and any contaminating genomic DNA using TURBO DNase rigorous treatment: 44 μl of RNase-free water, 10 μl of 10 × TURBO DNase buffer and 6 μl of TURBO DNase (Invitrogen) was added, and the resulting mixture was incubated at 37 °C for 1 h. DNase-treated RNA was purified by phenol:chloroform extraction and ethanol precipitation as described above.

    Spectroscopy:

    Article Title: 5?CAG and 5?CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs
    Article Snippet: Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB). .. The proteins purified in our laboratory were estimated to be at least 90% pure by Coomassie Blue staining.

    Activated Clotting Time Assay:

    Article Title:
    Article Snippet: To identify the nature of the bands, we carried out T7 exonuclease digestion of these reaction products ( A ). .. T7 exonuclease is known to act in the 5′–3′ direction on a linear DNA but not on circular DNA. .. End joining reaction products resulting from K562 extracts were treated with increasing concentrations (0.1–10 units) or 5 units of T7 exonuclease at 25 °C for 2 h and resolved on an 8% denaturing PAGE.

    Plasmid Preparation:

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes
    Article Snippet: Ten micrograms of genomic DNA and 200 ng of 2.2-kb p15A-cm linear vector (1 μg of 8-kb linear BAC vector) were assembled in 20 μl reactions consisting of 2 μl of 10 × NEBuffer 2.1 and 0.13 μl of 3 U μl−1 T4pol (NEB, cat. no. M0203). .. Assembly reactions with other exonucleases were cycled as follows: T5 exonuclease (T5exo; NEB, cat. no. M0363): 50°C for 30 min, then held at 4°C; T7 exonuclease (T7exo; NEB, cat. no. M0263): 25°C for 20 min, 50°C for 30 min, then held at 4°C; DNA polymerase I Klenow fragment (Kle; NEB, cat. no. M0210), T7 DNA polymerase (T7pol; NEB, cat. no. M0274) and λ exonuclease (λexo; NEB, cat. no. M0262): 25°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Exonuclease III (ExoIII; NEB, cat. no. M0206): 37°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Phusion DNA polymerase (Phu; NEB, cat. no. M0530): 37°C for 20 min, 50°C for 30 min, then held at 4°C.

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Loss of signal is indicative of DNase activity in these assays. .. Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs). .. For assessing the activity of cellular fractions, the genomic DNA of cells was accounted for in total and protoplast fractions and additional linear DNA substrate (salmon sperm DNA) was added to obtain 2 μg total DNA in each reaction.

    Electrophoresis:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: Reactions were stopped by the addition of EDTA, and samples were resolved by agarose gel electrophoresis as described above, without MgCl2 and ZnCl2 , and visualized with SYBR Green I as described above. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Negative Control:

    Article Title:
    Article Snippet: As a negative control, genomic DNA was treated with Exo I (0.2 unit/μg DNA) (New England Biolabs) in exonuclease buffer (67 m m glycine-KOH, 6.7 m m MgCl2 , 10 m m 2-mercaptoethanol) at 37 °C for 2 h and heat-inactivated at 80 °C for 20 min before G-strands were assayed. .. G-strand overhang was also measured after incubation of genomic DNA with T7 exonuclease (1 unit/μg DNA) (New England Biolabs) in NE-Buffer 4 at 25 °C for 60 s. T7 exonuclease acts in the 5′–3′ direction to remove 5′ nucleotides from duplex DNA.

    Agarose Gel Electrophoresis:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: Reactions were stopped by the addition of EDTA, and samples were resolved by agarose gel electrophoresis as described above, without MgCl2 and ZnCl2 , and visualized with SYBR Green I as described above. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    In Vitro:

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes
    Article Snippet: Paragraph title: In vitro assembly ... Assembly reactions with other exonucleases were cycled as follows: T5 exonuclease (T5exo; NEB, cat. no. M0363): 50°C for 30 min, then held at 4°C; T7 exonuclease (T7exo; NEB, cat. no. M0263): 25°C for 20 min, 50°C for 30 min, then held at 4°C; DNA polymerase I Klenow fragment (Kle; NEB, cat. no. M0210), T7 DNA polymerase (T7pol; NEB, cat. no. M0274) and λ exonuclease (λexo; NEB, cat. no. M0262): 25°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Exonuclease III (ExoIII; NEB, cat. no. M0206): 37°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Phusion DNA polymerase (Phu; NEB, cat. no. M0530): 37°C for 20 min, 50°C for 30 min, then held at 4°C.

    Ethanol Precipitation:

    Article Title: Stability, Flexibility, and Dynamic Interactions of Colliding RNA Polymerase II Elongation Complexes
    Article Snippet: T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C. .. T7 exonuclease footprinting: radioactively end-labeled ECs were incubated with 0.4 units/μl T7 exonuclease (NEB) at 26°C.

    Article Title: Mapping RNA–RNA interactome and RNA structure in vivo by MARIO
    Article Snippet: The RNA pellet was resuspended in 17 μl of RNase-free water, 4 μl of 10 × NEBuffer4 and 7 μl of 100 μM cDNA oligo. .. The annealed mixture was then mixed with 8 μl of 10 U μl−1 T7 exonuclease (NEB), 4 μl of 1 mg ml−1 BSA and incubated at 37 °C for 1 h. We removed the DNA oligonucleotides and any contaminating genomic DNA using TURBO DNase rigorous treatment: 44 μl of RNase-free water, 10 μl of 10 × TURBO DNase buffer and 6 μl of TURBO DNase (Invitrogen) was added, and the resulting mixture was incubated at 37 °C for 1 h. DNase-treated RNA was purified by phenol:chloroform extraction and ethanol precipitation as described above. .. rRNA was removed according to the manufacturer's instructions with the following modifications.

    Concentration Assay:

    Article Title: 5?CAG and 5?CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs
    Article Snippet: Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB). .. The proteins purified in our laboratory were estimated to be at least 90% pure by Coomassie Blue staining.

    Article Title: A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae
    Article Snippet: Because Mg2+ is essential for the activity of DNA endonucleases, assays were started by the addition of MgSO4 to a final concentration of 30 mM. .. Supercoiled plasmid preps of pGhost9 were confirmed to be intact and unnicked by gel electrophoresis as well as resistance to cleavage with T7 exonuclease (New England Biolabs).

    BAC Assay:

    Article Title: ExoCET: exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes
    Article Snippet: Ten micrograms of genomic DNA and 200 ng of 2.2-kb p15A-cm linear vector (1 μg of 8-kb linear BAC vector) were assembled in 20 μl reactions consisting of 2 μl of 10 × NEBuffer 2.1 and 0.13 μl of 3 U μl−1 T4pol (NEB, cat. no. M0203). .. Assembly reactions with other exonucleases were cycled as follows: T5 exonuclease (T5exo; NEB, cat. no. M0363): 50°C for 30 min, then held at 4°C; T7 exonuclease (T7exo; NEB, cat. no. M0263): 25°C for 20 min, 50°C for 30 min, then held at 4°C; DNA polymerase I Klenow fragment (Kle; NEB, cat. no. M0210), T7 DNA polymerase (T7pol; NEB, cat. no. M0274) and λ exonuclease (λexo; NEB, cat. no. M0262): 25°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Exonuclease III (ExoIII; NEB, cat. no. M0206): 37°C for 20 min, 75°C for 20 min, 50°C for 30 min, then held at 4°C; Phusion DNA polymerase (Phu; NEB, cat. no. M0530): 37°C for 20 min, 50°C for 30 min, then held at 4°C.

    Staining:

    Article Title: 5?CAG and 5?CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs
    Article Snippet: Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB). .. Herculase-enhanced DNA polymerase was from Stratagene; Phusion high-fidelity DNA polymerase was from Finnzymes; T7 exonuclease, T4 polynucleotide kinase (PNK), and Klenow fragment were from New England Biolabs (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t7 exonuclease
    T7 Exonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 exonuclease/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    t7 exonuclease - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results