Structured Review

New England Biolabs klenow
Klenow, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/klenow/product/New England Biolabs
Average 99 stars, based on 45 article reviews
Price from $9.99 to $1999.99
klenow - by Bioz Stars, 2019-08
99/100 stars

Images

Related Articles

Methylation Sequencing:

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: Paragraph title: Bisulfite sequencing of mtDNA using next-generation sequencing ... For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Clone Assay:

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: This 931 bp band was further digested with Sal I to generate a 589 bp band containing only miR-200c. .. This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence. .. MDA-MB-231 cells were transfected with a 1:3 ratio of the pCAG-PBase transposase plasmid to the PB-CAG-GFP-hsa-miR200c-iNeo or control plasmid with Lipofectamine 2000.

Centrifugation:

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: After centrifugation to pellet the cell nuclei (650 x g for 5 min at 4°C), nuclei were washed once with 1.25 x NEBuffer 2. .. Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C.

Amplification:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: Complete Genome Sequences, before and after Mammalian Cell Culture, of Zika Virus Isolated from the Serum of a Symptomatic Male Patient from Oaxaca, Mexico
Article Snippet: Viral nucleic acids were enriched by filtrating 500 μL of serum or culture supernatant through a 0.45-μm filter (Millipore) followed by Turbo DNase (Ambion) and RNase I (Invitrogen) treatment. .. Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference . .. Libraries were constructed with the Nextera XT DNA library preparation kit (Illumina) and sequenced using the NextSeq Illumina platform (2 × 150 bp).

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: PfuTurbo Cx Hotstart DNA polymerase (Agilent, 600414) and the following PCR conditions were used for amplification: 95°C for 2 min; 9 cycles of 98°C for 15 s, 60°C for 30 s and 72°C for 4 min; and 72°C for 10 min. All the remaining MethylC-seq libraries ( ) were prepared following a slightly modified protocol as detailed in . .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads.

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L). .. Unligated adaptors and adaptor dimers were removed with an AMPure XP bead purification (1.2:1 bead: DNA) performed twice.

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. For the 7 nt-long PAM determination process, the plasmid library was linearized by SapI (NEB) and used as the target.

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: Three hundred microliters of each DNA pool was sheared to an average size range of 500 base pairs using a Bioruptor sonicator (Diagenode). .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. Final library concentrations were quantified using 2× Sybr Green Master Mix on a QuantStudio 6 (Thermo Fisher) qPCR instrument and normalized to a concentration of 5 ng/μl.

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: Paragraph title: SISPA—Sequence independent single primer amplification (sample S1 and S2) ... Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min.

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs). .. DNA was purified using MinElute spin columns (QIAGEN) and double-stranded Illumina paired-end adapters were ligated to the DNA using rapid T4 DNA ligase (New England Biolabs).

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: Briefly, tissues were homogenized and filtered to enrich for viral particles, the filtrate was depleted of host nucleic acid using nucleases, and unbiased sequence-independent amplification was performed using random priming. .. The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen). .. Next, DNA was ligated to multiplex NEXTflex adapters (Bioo Scientific).

Stable Transfection:

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: Paragraph title: Stable cell lines ... This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence.

Synthesized:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: After the double-strand cDNA was synthesized, it was purified with Agencourt AMPure XP Beads (Agencourt), and the 3′ ends were repaired using End Repair Control, followed by purification with AMPure XP beads. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: Reverse transcription was performed using a 28-base oligonucleotide whose 3′ end consisted of eight random nucleotides (primer N1_8N, CCTTGAAGGCGGACTGTGAGNNNNNNNN). .. The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs). .. The resulting double-stranded cDNA and DNA were then PCR amplified using AmpliTaq Gold DNA polymerase and a 20-base primer (primer N1, CCTTGAAGGCGGACTGTGAG).

Construct:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: Illumina fragment libraries were constructed using Illumina paired-end DNA sample prep kit v1 with some modifications . .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: The black pool and yellow pool were constructed by mixing an equal amount of DNA from 50 black individuals and 50 yellow individuals, respectively. .. After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase.

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: Gels were stained with SYBR safe DNA stain (Life Technologies) and imaged with a Gel DocTM EZ gel imaging system (Bio-rad). .. For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The PAM-library fragment and the pNW33n vector were digested by BspHI and BamHI (NEB) and then ligated (T4 ligase, NEB).

Concentration Assay:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The concentration and quality of the extracted DNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and gel electrophoresis. .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments. .. After the ligated cDNAs were purified twice using AMPure XP Beads, they were enriched and amplified using selective PCR according to the following procedure: 98 °C for 30 s; 15 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 30 s, and 72 °C for 5 min; holding at 4 °C, followed by purification with AMPure XP beads.

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Chromatin from the input and IP samples was released by adding NaCl to a final concentration of 10 mM and incubating overnight at 65 °C. .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: Restriction digest was performed overnight at 37°C with agitation (950 rpm) with HindIII (NEB; 1500 units per 7 million cells). .. Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C. .. After addition of SDS (1.42% final concentration) and incubation at 65°C with agitation (950 rpm) for 20 min, ligation was performed for 4 hr at 16°C (50 units T4 DNA ligase (Life Technologies) per 7 million cells starting material) in a total volume of 8.2 ml ligation buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, 100 µg/ml BSA, 0.9% Triton X-100) per 7 million cells starting material.

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: To reverse cross-link, NaCl was added to a final concentration of 200 mM, followed by incubation at 65 °C for 6 h. To digest the remaining protein, 20 μg proteinase K was added and incubated at 45 °C for 30 min. Immunoprecipitated DNA was then purified by phenol/chloroform extraction, ethanol precipitated, then by MinElute Reaction Cleanup column (Qiagen). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: The DNA concentration of each sample was determined by the standard curve method using samples of known DNA concentration. .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads.

Real-time Polymerase Chain Reaction:

Article Title: Complete Genome Sequences, before and after Mammalian Cell Culture, of Zika Virus Isolated from the Serum of a Symptomatic Male Patient from Oaxaca, Mexico
Article Snippet: The blood serum (CIENI551_serum) was positive for ZIKV by reverse transcriptase real-time PCR ( ) and another aliquot was passaged four times in Vero cells (CIENI551P4 isolate). .. Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference .

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Random Hexamer Labeling:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: The first-strand cDNA was synthesized from fragmented mRNA templates using Superscript II reverse transcriptase (Invitrogen), random hexamer primers, and First Strand Master Mix at 25 °C for 10 min, 42 °C for 50 min, and 70 °C for 15 min, with a final hold at 4 °C. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: Second strand synthesis was performed by mixing ssDNA with 250 ng Random Hexamer Primers and 5 μl of 10× NEB Buffer CutSmart. .. The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr.

Significance Assay:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Reads generated from the input and IP samples were aligned to the C. neoformans type strain H99 genome reference sequence using Bowtie .

Expressing:

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence. .. MDA-MB-231 cells were transfected with a 1:3 ratio of the pCAG-PBase transposase plasmid to the PB-CAG-GFP-hsa-miR200c-iNeo or control plasmid with Lipofectamine 2000.

Modification:

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: PfuTurbo Cx Hotstart DNA polymerase (Agilent, 600414) and the following PCR conditions were used for amplification: 95°C for 2 min; 9 cycles of 98°C for 15 s, 60°C for 30 s and 72°C for 4 min; and 72°C for 10 min. All the remaining MethylC-seq libraries ( ) were prepared following a slightly modified protocol as detailed in . .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads.

Transformation Assay:

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The PAM-library fragment and the pNW33n vector were digested by BspHI and BamHI (NEB) and then ligated (T4 ligase, NEB).

Flow Cytometry:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs). .. After another purification step, adaptor-ligated fragments were enriched, and adapters were extended by selective amplification in an 18-cycle PCR reaction using Phusion DNA polymerase (Finnzymes).

Ligation:

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C. .. After addition of SDS (1.42% final concentration) and incubation at 65°C with agitation (950 rpm) for 20 min, ligation was performed for 4 hr at 16°C (50 units T4 DNA ligase (Life Technologies) per 7 million cells starting material) in a total volume of 8.2 ml ligation buffer (50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, 10 mM DTT, 100 µg/ml BSA, 0.9% Triton X-100) per 7 million cells starting material.

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L). .. Unligated adaptors and adaptor dimers were removed with an AMPure XP bead purification (1.2:1 bead: DNA) performed twice.

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The PAM-library fragment and the pNW33n vector were digested by BspHI and BamHI (NEB) and then ligated (T4 ligase, NEB).

Protease Inhibitor:

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: After thawing, the cell pellets were incubated in 50 ml ice-cold lysis buffer (10 mM Tris-HCl pH 8, 10 mM NaCl, 0.2% Igepal CA-630, protease inhibitor cocktail (Roche (Basel, Switzerland)) for 30 min on ice. .. Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C.

Biomarker Assay:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA). .. Size-selected DNA was purified with a Qiagen MinElute gel extraction kit and quantified using the Quant-it dsDNA HS assay kit (Invitrogen).

Infection:

Article Title: Complete Genome Sequences, before and after Mammalian Cell Culture, of Zika Virus Isolated from the Serum of a Symptomatic Male Patient from Oaxaca, Mexico
Article Snippet: In March 2016, three days after the onset of Zika virus (ZIKV) infection symptoms, an 80-year-old male patient from Santa Maria Mixtequilla, a rural town located in Southern Oaxaca, Mexico, agreed to participate in this study by signing the informed consent forms and by donating a blood sample (protocol C16-16 approved and registered at INER). .. Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference .

Generated:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Libraries were 7-way multiplexed on an Illumina MiSeq flow cell using MiSeq Reagent Kit v3 (Illumina, USA).

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads.

Article Title: Regulation of mitotic recombination between DNA repeats in centromeres
Article Snippet: A 3.3 kb Eco81I–SalI fragment containing ade6X and ura4 3′ region from pTN457 was introduced between the Eco81I-SalI of pTN478, yielding pTN480. pTN1015 that contains ade6X and imr1 was generated as follows: pTN905 was digested with NcoI and XhoI, treated with Klenow fragment and self-ligated to delete a 1.5 kb NcoI–XhoI region containing the 3′ region of ade6X , forming pTN1011. .. A 1.2 kb SpeI–EcoRI fragment containing imr1 from pRS140 was introduced between the SpeI–EcoRI sites of pTN1011, yielding pTN1015. pTN1019 that contains dh, irc1R, ura4+ and tam14+ was generated as follows: a 2.7 kb Sau3AI partially digested genome fragment containing ura4+ and tam14+ was introduced at the BamHI site of pBluescript II SK+ , yielding pTN444. pTN444 was then digested with ClaI and EcoRI, treated with Klenow fragment and self-ligated to yield pNT446. .. A 3.8 kb genomic region containing dh and irc1R was amplified from genomic DNA by PCR using NotI-NheI-otr1R and irc1R-BlpI primers and was then digested with XbaI and BlpI.

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: Synthetic mtDNA mimicking the BglII-digested native mtDNA (Supplementary Fig. ) was generated using PCR with standard dNTP and the primers 5′-CTCTTCTCAAGACATCAAGAAGAAGGAGC-3′ and 5′-CATTTCAGGTTTACAAGACCAGAGTAATGTTTATACTATC-3′. .. For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: Double-stranded unlabeled oligonucleotides (cold probes) were generated by annealing in TE buffer (pH 7.9) supplemented with 33.3 mM NaCl and 0.67 mM MgCl2 . .. We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min.

DNA Sequencing:

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Paragraph title: DNA sequencing ... Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L).

Polymerase Chain Reaction:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA). .. Sequencing adapters were ligated to the ends of the end-repaired DNA fragments.

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: Complete Genome Sequences, before and after Mammalian Cell Culture, of Zika Virus Isolated from the Serum of a Symptomatic Male Patient from Oaxaca, Mexico
Article Snippet: Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference . .. Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference .

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Samples were treated with RNase A for 30 min at 37 °C followed by pronase for 2 hr at 42 °C, and extracted using a QIAquick PCR Purification Kit (QIAGEN, Netherlands). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: PfuTurbo Cx Hotstart DNA polymerase (Agilent, 600414) and the following PCR conditions were used for amplification: 95°C for 2 min; 9 cycles of 98°C for 15 s, 60°C for 30 s and 72°C for 4 min; and 72°C for 10 min. All the remaining MethylC-seq libraries ( ) were prepared following a slightly modified protocol as detailed in . .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads.

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. PCR reaction was performed using diluted restriction-ligation DNA samples, dNTP, Q5 High-Fidelity DNA Polymerase and PCR primers: AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACG (PAGE purified, Life Technologies).

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L). .. Unligated adaptors and adaptor dimers were removed with an AMPure XP bead purification (1.2:1 bead: DNA) performed twice.

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. For the 7 nt-long PAM determination process, the plasmid library was linearized by SapI (NEB) and used as the target.

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: Three hundred microliters of each DNA pool was sheared to an average size range of 500 base pairs using a Bioruptor sonicator (Diagenode). .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. Final library concentrations were quantified using 2× Sybr Green Master Mix on a QuantStudio 6 (Thermo Fisher) qPCR instrument and normalized to a concentration of 5 ng/μl.

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min. .. The amplification steps were 95°C for 20 s followed by 30 cycles at 95°C for 30 s, 58°C for 30 s, 72°C for 90 s and completed at 72°C for 10 min.

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: DNA was purified with a QIAquick PCR purification kit (QIAGEN). .. 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs).

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: PCR products were gel-purified and the resulting synthetic mtDNA was 16,291 bp long spanning from nt 15,342 to 15,333 and was free from 5mC. .. For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: 10 ng of input or ChIP-enriched DNA was end-paired using T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase, New England Biolabs), and T4 polynucleotide kinase (New England Biolabs), followed by purification using the QIAquick PCR purification kit (Qiagen). .. Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen).

Sonication:

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: 2 μg of genomic DNA was sonicated into 200 bp fragments using a Covaris S2 Sonicator, followed by purification with Sera-Mag Magnetic SpeedBeads (ThermoScientific, 65152105050250). .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads.

Affinity Purification:

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr.

Hi-C:

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: Paragraph title: Hi-C and promoter capture Hi-C (CHi-C) ... Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C.

ChIP-sequencing:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Paragraph title: ChIP-Seq ... The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: Paragraph title: Chromatin Immunoprecipitation Sequencing ... Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen).

Nucleic Acid Electrophoresis:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The concentration and quality of the extracted DNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and gel electrophoresis. .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr. .. The reaction was terminated by adding 40 μg Proteinase K at 65°C for 20 min. Digested DNA was extracted and purified before loading to 12% native polyacrylamide TBE gel for size-selection.

RNA Sequencing Assay:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Paragraph title: Total RNA extraction, cDNA library construction and Illumina RNA-Seq ... Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Sensitive Assay:

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Following quantification with Q-bit (Qbit 2.0 fluorometer, Qbit dsDNA High Sensitivity Assay kit Invitrogen Q32854), 40 ng DNA were used for the sequencing library. .. Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L).

Magnetic Beads:

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: Three hundred microliters of each DNA pool was sheared to an average size range of 500 base pairs using a Bioruptor sonicator (Diagenode). .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. Final library concentrations were quantified using 2× Sybr Green Master Mix on a QuantStudio 6 (Thermo Fisher) qPCR instrument and normalized to a concentration of 5 ng/μl.

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr.

Multiple Displacement Amplification:

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: The genomic region containing hsa-miR-200c.141 was cloned from genomic DNA of MDA-MB-453 cells into the pGEM-Teasy vector system (Promega, Madison, WI, USA). .. This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence.

Isolation:

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The PAM-library fragment and the pNW33n vector were digested by BspHI and BamHI (NEB) and then ligated (T4 ligase, NEB).

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification. .. The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr.

RNA Extraction:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Paragraph title: Total RNA extraction, cDNA library construction and Illumina RNA-Seq ... Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Labeling:

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: Double-stranded unlabeled oligonucleotides (cold probes) were generated by annealing in TE buffer (pH 7.9) supplemented with 33.3 mM NaCl and 0.67 mM MgCl2 . .. We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min. .. Labeled probes were purified on Illustra MicroSpin G-25 Columns (GE Healthcare Life Sciences), according to the manufacturer’s protocol.

Purification:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA). .. Sequencing adapters were ligated to the ends of the end-repaired DNA fragments.

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: After the double-strand cDNA was synthesized, it was purified with Agencourt AMPure XP Beads (Agencourt), and the 3′ ends were repaired using End Repair Control, followed by purification with AMPure XP beads. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Purified ChIP-DNA from the input and IP samples was end repaired with Klenow DNA polymerase (New England Biolabs, USA) and purified using AMPure XP beads (Agencourt, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: To reverse cross-link, NaCl was added to a final concentration of 200 mM, followed by incubation at 65 °C for 6 h. To digest the remaining protein, 20 μg proteinase K was added and incubated at 45 °C for 30 min. Immunoprecipitated DNA was then purified by phenol/chloroform extraction, ethanol precipitated, then by MinElute Reaction Cleanup column (Qiagen). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: DNA ends were repaired using the End-It DNA End-Repair Kit (Epicentre, ER81050), and the DNA fragments were purified using Sera-Mag Magnetic SpeedBeads. .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads. .. The methylated adapters in the NEXTflex Bisulfite-Seq Barcodes Kit (BIOO Scientific, 511911) were ligated to the DNA fragments using T4 DNA Ligase (New England Biolabs, M0202).

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: Genomic DNA was digested with RsaI (New England Biolabs, NEB). .. After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. PCR reaction was performed using diluted restriction-ligation DNA samples, dNTP, Q5 High-Fidelity DNA Polymerase and PCR primers: AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACG (PAGE purified, Life Technologies).

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Library preparation was as follows: DNA fragments underwent end repair with T4 DNA Polymerase (New England Biolabs (NEB) M0203L), Klenow DNA Polymerase (NEB M0210L), and T4 Polynucleotide Kinase (NEB M0201L). .. Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L). .. Pre-annealed adaptors were ligated overnight at 16°C with T4 DNA Ligase (NEB M0202L).

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: Three hundred microliters of each DNA pool was sheared to an average size range of 500 base pairs using a Bioruptor sonicator (Diagenode). .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. Final library concentrations were quantified using 2× Sybr Green Master Mix on a QuantStudio 6 (Thermo Fisher) qPCR instrument and normalized to a concentration of 5 ng/μl.

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min. .. The amplification steps were 95°C for 20 s followed by 30 cycles at 95°C for 30 s, 58°C for 30 s, 72°C for 90 s and completed at 72°C for 10 min.

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: DNA was purified with a QIAquick PCR purification kit (QIAGEN). .. 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs).

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: Specifically, nucleic acids from nuclease-resistant viral particles were extracted using the QIAquick viral RNA column purification system. .. The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: 10 ng of input or ChIP-enriched DNA was end-paired using T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase, New England Biolabs), and T4 polynucleotide kinase (New England Biolabs), followed by purification using the QIAquick PCR purification kit (Qiagen). .. Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen). .. Next, DNA was ligated to multiplex NEXTflex adapters (Bioo Scientific).

Sequencing:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: Paragraph title: Library construction and genome sequencing ... The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments. .. Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Article Title: Complete Genome Sequences, before and after Mammalian Cell Culture, of Zika Virus Isolated from the Serum of a Symptomatic Male Patient from Oaxaca, Mexico
Article Snippet: Viral nucleic acids were enriched by filtrating 500 μL of serum or culture supernatant through a 0.45-μm filter (Millipore) followed by Turbo DNase (Ambion) and RNase I (Invitrogen) treatment. .. Viral RNA was extracted using the QIAamp viral RNA minikit (Qiagen) and reverse-transcribed with Superscript III reverse transcriptase (Invitrogen), followed by second-strand synthesis with the Klenow fragment (New England Biolabs) for sequence-independent amplification, as described in reference . .. Libraries were constructed with the Nextera XT DNA library preparation kit (Illumina) and sequenced using the NextSeq Illumina platform (2 × 150 bp).

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Libraries were 7-way multiplexed on an Illumina MiSeq flow cell using MiSeq Reagent Kit v3 (Illumina, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: Overall, 20 ng of ChIP DNA or whole-cell extract were used to generate an Illumina sequencing library. .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: Paragraph title: MethylC-seq library construction and sequencing ... The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads.

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: Genomic DNA was digested with RsaI (New England Biolabs, NEB). .. After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. PCR reaction was performed using diluted restriction-ligation DNA samples, dNTP, Q5 High-Fidelity DNA Polymerase and PCR primers: AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACG (PAGE purified, Life Technologies).

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: Following quantification with Q-bit (Qbit 2.0 fluorometer, Qbit dsDNA High Sensitivity Assay kit Invitrogen Q32854), 40 ng DNA were used for the sequencing library. .. Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L).

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: Gels were stained with SYBR safe DNA stain (Life Technologies) and imaged with a Gel DocTM EZ gel imaging system (Bio-rad). .. For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The PAM-library fragment and the pNW33n vector were digested by BspHI and BamHI (NEB) and then ligated (T4 ligase, NEB).

Article Title: Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River. Patterns of genomic variation in Coho salmon following reintroduction to the interior Columbia River
Article Snippet: The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads. .. The sheared DNA was then purified using Qiagen MinElute columns, size selected using Agencourt Ampure XP magnetic beads to a size range of 200 to 700 base pairs, blunt‐ended using a quick blunting kit (NEB), A‐tailed using Klenow fragment DNA polymerase (NEB), second adapter added using T4 ligase (NEB), amplified with 14 cycles of PCR using Phusion Master Mix (NEB), and purified with Agencourt Ampure XP beads.

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: Paragraph title: Sequencing ... 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs).

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: This 931 bp band was further digested with Sal I to generate a 589 bp band containing only miR-200c. .. This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence. .. MDA-MB-231 cells were transfected with a 1:3 ratio of the pCAG-PBase transposase plasmid to the PB-CAG-GFP-hsa-miR200c-iNeo or control plasmid with Lipofectamine 2000.

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′). .. For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: Paragraph title: (ii) Whole-genome sequencing using next-generation sequencing and bioinformatics. ... The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs).

Polyacrylamide Gel Electrophoresis:

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: Genomic DNA was digested with RsaI (New England Biolabs, NEB). .. After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. PCR reaction was performed using diluted restriction-ligation DNA samples, dNTP, Q5 High-Fidelity DNA Polymerase and PCR primers: AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACG (PAGE purified, Life Technologies).

Gel Extraction:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA). .. All reaction clean-ups were performed using a MinElute PCR purification kit (Qiagen, Hilden, Germany).

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase.

cDNA Library Assay:

Article Title: Transcriptomic profiling provides molecular insights into hydrogen peroxide-induced adventitious rooting in mung bean seedlings
Article Snippet: Paragraph title: Total RNA extraction, cDNA library construction and Illumina RNA-Seq ... Subsequently, an A-base was added to the blunt end fragments using Klenow exo (M0212L, NEB) to perform the adenylation of the 3′ ends of the cDNA fragments.

Sample Prep:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: Illumina fragment libraries were constructed using Illumina paired-end DNA sample prep kit v1 with some modifications . .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB). .. The fragments were ligated with Illumina Indexed adaptors (TruSeq DNA Sample Prep Kits) using DNA ligase (NEB).

Article Title: Analysis of chromatin accessibility in human epidermis identifies putative barrier dysfunction-sensing enhancers
Article Snippet: FAIRE DNA sequencing libraries were assembled using the Illumina low throughput sequencing adaptors and indexing primers (see TruSeq DNA Sample Prep Guide Illumina 15026486 C). .. Following purification with Agencourt AmPure XP DNA-binding beads (Beckman Coulter A63880) in polyethylene glycol (PEG) at a 1.9:1 bead: DNA volume ratio, adenine bases were added to the ends of each fragment with Klenow exonuclease (NEB M0212L).

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs). .. The resulting double-stranded cDNA and DNA were then PCR amplified using AmpliTaq Gold DNA polymerase and a 20-base primer (primer N1, CCTTGAAGGCGGACTGTGAG).

Activated Clotting Time Assay:

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min. .. Labeled probes were purified on Illustra MicroSpin G-25 Columns (GE Healthcare Life Sciences), according to the manufacturer’s protocol.

Chromatin Immunoprecipitation:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Purified ChIP-DNA from the input and IP samples was end repaired with Klenow DNA polymerase (New England Biolabs, USA) and purified using AMPure XP beads (Agencourt, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: 10 ng of input or ChIP-enriched DNA was end-paired using T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase, New England Biolabs), and T4 polynucleotide kinase (New England Biolabs), followed by purification using the QIAquick PCR purification kit (Qiagen). .. Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen).

Plasmid Preparation:

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension. .. The ligation mixture was transformed into electro-competent E. coli DH10B cells and plasmids were isolated from liquid cultures.

Article Title: ZEB1-repressed microRNAs inhibit autocrine signaling that promotes vascular mimicry of breast cancer cells
Article Snippet: This 931 bp band was further digested with Sal I to generate a 589 bp band containing only miR-200c. .. This band and the Not I-digested piggybac vector, PB-CAG-GFP-iNeo, were blunted with Klenow (New England Biolabs, Ipswich, MA, USA) and ligated to generate PB-CAG-GFP-hsa-miR200c-iNeo plasmid with miR-200c cloned downstream of green fluorescent protein (GFP) but before the polyA sequence. .. MDA-MB-231 cells were transfected with a 1:3 ratio of the pCAG-PBase transposase plasmid to the PB-CAG-GFP-hsa-miR200c-iNeo or control plasmid with Lipofectamine 2000.

Electrophoresis:

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. The PCR productions were purified using Agencourt AMPure XP beads (Beckman Coulter, High Wycombe, United Kingdom) and then pooled.

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min. .. For supershift assays, nuclear protein lysates were incubated for 30 min on ice with 2 µg of anti-IRF4 (Santa Cruz, M-17) antibody or anti-goat Ig (Santa Cruz) antibody.

Multiplex Assay:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Purified ChIP-DNA from the input and IP samples was end repaired with Klenow DNA polymerase (New England Biolabs, USA) and purified using AMPure XP beads (Agencourt, USA). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA). .. Ligated indexed samples were subsequently amplified as per the kit instructions, and gel purified to remove adapter dimers and select optimal sizes (100 to 500 bp).

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′). .. For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Selection:

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: Subsequently, DNA was dA-tailed using the Klenow fragment (3′ to 5′ exo minus, New England Biolabs), followed by purification using the MinElute Reaction Cleanup kit (Qiagen). .. IP and input DNA were purified by the MinElute reaction Cleanup kit, and amplified by PCR using the KAPA HiFi HotStart ReadyMix PCR kit (KAPA Biosystems) with the following program: 45 s at 98°C for initial denaturation, 15 s at 98°C, 30 s at 65°C, 30 s at 72°C for four cycles, followed by 1 min at 72°C for final extension.

Agarose Gel Electrophoresis:

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: Toward Identification of Black Lemma and Pericarp Gene Blp1 in Barley Combining Bulked Segregant Analysis and Specific-Locus Amplified Fragment Sequencing
Article Snippet: After that, a single-nucleotide A overhang were added to the digested fragments with Klenow Fragment (3′→ 5′ exo–) (NEB) and dATP at 37°C, and then the Duplex Tag-labeled Sequencing adapters (PAGE purified, Life Technologies) were ligated to the A-tailed fragments with T4 DNA ligase. .. The PCR productions were purified using Agencourt AMPure XP beads (Beckman Coulter, High Wycombe, United Kingdom) and then pooled.

In Vitro:

Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
Article Snippet: Paragraph title: Library construction for in vitro PAM screen ... For the construction of the PAM library, a 122-bp long DNA fragment, containing the protospacer and a 7-bp long degenerate sequence at its 3′-end, was constructed by primer annealing and Klenow fragment (exo-) (NEB) based extension.

Ethanol Precipitation:

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: mtNAs from E14 ESCs and liver and brain tissues were treated with the restriction enzyme BglII to linearise mtDNA with a single cut at nt 15,338, followed by sequential extraction using phenol and CI and ethanol precipitation. .. For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Next-Generation Sequencing:

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads. .. After purification using Sera-Mag Magnetic SpeedBeads, the DNA was subjected to bisulfite conversion using the MethylCode Bisulfite Conversion Kit (Invitrogen, MECOV-50).

Article Title: Accurate estimation of 5-methylcytosine in mammalian mitochondrial DNA
Article Snippet: Paragraph title: Bisulfite sequencing of mtDNA using next-generation sequencing ... For each sample, first strand synthesis was performed using Klenow Fragment (3′ → 5′ exo-) (New England Biolabs) with Bio-PEA2-N4 (5′-biotin-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN -3′).

Article Title: Microscopic and Molecular Evidence of the First Elasmobranch Adomavirus, the Cause of Skin Disease in a Giant Guitarfish, Rhynchobatus djiddensis
Article Snippet: Paragraph title: (ii) Whole-genome sequencing using next-generation sequencing and bioinformatics. ... The second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs).

Incubation:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: Dynabeads Protein B (Life Technologies, USA) were pre-hybridized in buffer B (50 mM HEPES pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) sodium deoxycholate) with Mouse anti-HA antibody (Invitrogen, USA) for 1 hr at 4 °C with rotation on a Hula Mixer (Life Technologies, USA) prior to the addition of the protein sample, followed by incubation at 4 °C for an additional 2 hr. .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: Triton X-100 was added to a final concentration of 1.7% and the nuclei were incubated at 37°C for 1 hr with agitation (950 rpm). .. Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C.

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: To reverse cross-link, NaCl was added to a final concentration of 200 mM, followed by incubation at 65 °C for 6 h. To digest the remaining protein, 20 μg proteinase K was added and incubated at 45 °C for 30 min. Immunoprecipitated DNA was then purified by phenol/chloroform extraction, ethanol precipitated, then by MinElute Reaction Cleanup column (Qiagen). .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: Ten μl RNA was reverse transcribed and tagged using 10 μM primer FRoV26-N ( GCC GGA GCT CTG CAG ATA TCN NNN NN ) [ ] and Superscript III (Invitrogen, MA, USA) according to manufacturer’s instructions. .. Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min. .. Double stranded (ds) DNA was kept at -20°C prior to PCR amplification.

Article Title: Patterns of Genomic Variation in the Opportunistic Pathogen Candida glabrata Suggest the Existence of Mating and a Secondary Association with Humans
Article Snippet: DNA was purified with a QIAquick PCR purification kit (QIAGEN). .. 3′-adenylation was performed by incubation with dATP and 3′-5′-exo- Klenow fragment (New England Biolabs). .. DNA was purified using MinElute spin columns (QIAGEN) and double-stranded Illumina paired-end adapters were ligated to the DNA using rapid T4 DNA ligase (New England Biolabs).

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min. .. We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min.

Article Title: GRID-seq reveals the global RNA-chromatin interactome
Article Snippet: Second strand synthesis was performed by mixing ssDNA with 250 ng Random Hexamer Primers and 5 μl of 10× NEB Buffer CutSmart. .. The reaction was incubated at 98°C for 5 min, chilled on ice, added with 8.5 μl H2 O, 5 pmol dNTP and 5 U Klenow Fragment (3′ to 5′ exo-) enzyme (NEB), and further incubated at 37°C for 1 hr. .. After heat inactivation at 70°C for 10 min, 5 pmol S-adenosylmethionine (NEB) and 1 U MmeI enzyme (NEB) were added to the reaction followed by incubation at 37°C for 30 min. Another 3 U MmeI was added and the reaction was incubated for another 30 min.

Spectrophotometry:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The concentration and quality of the extracted DNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and gel electrophoresis. .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Immunoprecipitation:

Article Title: Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans
Article Snippet: The protein-bound beads were sequentially washed with rotation for 5 min in 1 mL buffer A, buffer B (50 mM HEPES pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) sodium deoxycholate), buffer C (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% (v/v) NP-40, 0.5% w/v sodium deoxycholate), and buffer D (10 mM Tris, 1 mM EDTA), with immunoprecipitated protein eluted in buffer E (50 mM Tris pH 8.0, 10 mM EDTA, 1% (w/v) SDS). .. The samples were A-tailed using Klenow fragment (New England Biolabs, USA) before ligating Multiplex Oligos for Illumina (Index primer set 1) (Illumina, USA) using T4 DNA ligase (New England Biolabs, USA).

Article Title: Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression
Article Snippet: In parallel, input DNA was prepared using cell lysate without the immunoprecipitation steps. .. DNA fragments were end-repaired using the End-It DNA End-Repair Kit (Epicentre) and then a single ‘A' base was added using Klenow (NEB).

Migration:

Article Title: IRF4 haploinsufficiency in a family with Whipple’s disease
Article Snippet: We labeled 0.1 µg of cold probe in Klenow buffer supplemented with 9.99 mM dNTP without ATP, 10 U Klenow fragment (NEB) and 50 µCi d-ATP-32 P, at 37°C for 60 min. .. For supershift assays, nuclear protein lysates were incubated for 30 min on ice with 2 µg of anti-IRF4 (Santa Cruz, M-17) antibody or anti-goat Ig (Santa Cruz) antibody.

CTG Assay:

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: Ten μl RNA was reverse transcribed and tagged using 10 μM primer FRoV26-N ( GCC GGA GCT CTG CAG ATA TCN NNN NN ) [ ] and Superscript III (Invitrogen, MA, USA) according to manufacturer’s instructions. .. Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min.

Lysis:

Article Title: Characterization and genome functional analysis of a novel metamitron-degrading strain Rhodococcus sp. MET via both triazinone and phenyl rings cleavage
Article Snippet: The DNA was mechanically fragmented by ultrasonic lysis and then gel size-selected for ~500 base pairs (bp) fragment size. .. The overhangs from the fragmentation were converted into blunt ends using the T4 DNA polymerase, Klenow Fragment, and T4 Polynucleotide Kinase (New England Biolabs, MA, USA).

Article Title: Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells
Article Snippet: After thawing, the cell pellets were incubated in 50 ml ice-cold lysis buffer (10 mM Tris-HCl pH 8, 10 mM NaCl, 0.2% Igepal CA-630, protease inhibitor cocktail (Roche (Basel, Switzerland)) for 30 min on ice. .. Using biotin-14-dATP (Life Technologies (Carlsbad, CA)), dCTP, dGTP and dTTP (all at a final concentration of 30 µM), the HindIII restriction sites were then filled in with Klenow (NEB (Ipswich, MA)) for 75 min at 37°C.

Variant Assay:

Article Title: Single primer isothermal amplification (SPIA) combined with next generation sequencing provides complete bovine coronavirus genome coverage and higher sequence depth compared to sequence-independent single primer amplification (SISPA)
Article Snippet: A variant of the SISPA protocol was followed [ ]. .. Second strand was made by adding 0.5 μl of Klenow fragment (3’ - > 5’ exo-) (New England Biolabs, England) to the cDNA and incubation at 37°C for 60 min and 75°C for 10 min.

Activity Assay:

Article Title: The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status
Article Snippet: DNA ends were repaired using the End-It DNA End-Repair Kit (Epicentre, ER81050), and the DNA fragments were purified using Sera-Mag Magnetic SpeedBeads. .. The purified DNAs were adenylated at the 3’ end using the polymerase activity of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212), followed by purification using Sera-Mag Magnetic SpeedBeads. .. The methylated adapters in the NEXTflex Bisulfite-Seq Barcodes Kit (BIOO Scientific, 511911) were ligated to the DNA fragments using T4 DNA Ligase (New England Biolabs, M0202).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 99
    New England Biolabs klenow fragment
    Klenow Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 91 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klenow fragment/product/New England Biolabs
    Average 99 stars, based on 91 article reviews
    Price from $9.99 to $1999.99
    klenow fragment - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    77
    New England Biolabs fill in mix
    Fill In Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fill in mix/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fill in mix - by Bioz Stars, 2019-08
    77/100 stars
      Buy from Supplier

    99
    New England Biolabs large klenow fragment
    Large Klenow Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/large klenow fragment/product/New England Biolabs
    Average 99 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    large klenow fragment - by Bioz Stars, 2019-08
    99/100 stars
      Buy from Supplier

    Image Search Results