firepol  (Solis BioDyne)

Journal: Scientific Reports

Article Title: The commensal infant gut meta-mobilome as a potential reservoir for persistent multidrug resistance integrons

doi: 10.1038/srep15317

Figure Lengend Snippet: Integrons detected by long-range PCR. ( a ) 1.5 kb partially sequenced integron by long-range PCR product. ( b ) 1.1 kb partially sequenced integron by long-range PCR. Cylindrical boxes show individual genes that are size dependent, i.e. larger box is longer gene; dotted arrows indicate the direction of transcription; and gradient blue color the end of the acquired sequence. Gene and structural features: attI , primary recombination site; dfrA17 and dfrA12 , dihydrofolate reductase; attC , recombination site; aadA5 and aadA2 , aminoglycoside adenylyltransferase; and orfF , hypothetical protein.

Article Snippet: Each PCR reaction (25 μl) contained 1× HOT FIREPol PCR mix (Solis BioDyne, Estonia); 200 nM uniquely tagged forward and reverse primers; 1 μl of sample DNA and water.

Techniques: Polymerase Chain Reaction, Sequencing

Journal: Bioorganic & Medicinal Chemistry

Article Title: Chemically defined polyethylene glycol siRNA conjugates with enhanced gene silencing effect

doi: 10.1016/j.bmc.2014.02.004

Figure Lengend Snippet: Gene knockdown of endogenous bcl-2. (A) After lipofectamine 2000-mediated transfection, (B) after unassisted application. The effect of PEG-siRNA conjugates (siRNA-PEG (S), 1 / 6 ; siRNA-PEG2 (S/AS), 5 / 6 ) was evaluated by qPCR-based quantification of bcl-2 mRNA levels in MCF-7 cells. The indicated siRNAs were either transfected into the cells with lipofectamine 2000 (A), or applied without any uptake-enhancing agent (B). Cells were lysed after 24 h, total RNA was extracted, transcribed into cDNA, and quantified with qPCR. Bcl-2 levels were normalized to the reference gene RNA polymerase II, which was shown not to be influenced by siRNA or the transfection procedure. After lipofectamine-mediated delivery, efficient gene silencing occurred with both modified and unmodified siRNAs ( p

Article Snippet: The master mix was prepared with Hot FirePol Polymerase and EvaGreen from Solis Biodyne (Tartu, Estonia) and gene-specific primers for bcl-2 (forward: CCCAAGTTTTGAGCCATTCA, reverse: CCTGGTGGACAACATCGC), CXCR4 (forward: CGTGGAACGTTTTTCCTGTT, reverse: GGTGCTGAAATCAACCCACT), and RNA polymerase II (forward: GAAGGCACTCTCCAGGTTTG, reverse: ATGCTGGTTTTGGTGACGAC) as reference gene from Microsynth (Basel, Switzerland).

Techniques: Transfection, Real-time Polymerase Chain Reaction, Modification