firepol  (Solis BioDyne)


Bioz Verified Symbol Solis BioDyne is a verified supplier
Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne firepol
    Firepol, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/firepol/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    firepol - by Bioz Stars, 2022-07
    96/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Solis BioDyne hot firepol pcr mix
    Integrons detected by long-range <t>PCR.</t> ( a ) 1.5 kb partially sequenced integron by long-range <t>PCR</t> product. ( b ) 1.1 kb partially sequenced integron by long-range PCR. Cylindrical boxes show individual genes that are size dependent, i.e. larger box is longer gene; dotted arrows indicate the direction of transcription; and gradient blue color the end of the acquired sequence. Gene and structural features: attI , primary recombination site; dfrA17 and dfrA12 , dihydrofolate reductase; attC , recombination site; aadA5 and aadA2 , aminoglycoside adenylyltransferase; and orfF , hypothetical protein.
    Hot Firepol Pcr Mix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot firepol pcr mix/product/Solis BioDyne
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hot firepol pcr mix - by Bioz Stars, 2022-07
    97/100 stars
      Buy from Supplier

    96
    Solis BioDyne firepol
    Integrons detected by long-range <t>PCR.</t> ( a ) 1.5 kb partially sequenced integron by long-range <t>PCR</t> product. ( b ) 1.1 kb partially sequenced integron by long-range PCR. Cylindrical boxes show individual genes that are size dependent, i.e. larger box is longer gene; dotted arrows indicate the direction of transcription; and gradient blue color the end of the acquired sequence. Gene and structural features: attI , primary recombination site; dfrA17 and dfrA12 , dihydrofolate reductase; attC , recombination site; aadA5 and aadA2 , aminoglycoside adenylyltransferase; and orfF , hypothetical protein.
    Firepol, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/firepol/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    firepol - by Bioz Stars, 2022-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    Integrons detected by long-range PCR. ( a ) 1.5 kb partially sequenced integron by long-range PCR product. ( b ) 1.1 kb partially sequenced integron by long-range PCR. Cylindrical boxes show individual genes that are size dependent, i.e. larger box is longer gene; dotted arrows indicate the direction of transcription; and gradient blue color the end of the acquired sequence. Gene and structural features: attI , primary recombination site; dfrA17 and dfrA12 , dihydrofolate reductase; attC , recombination site; aadA5 and aadA2 , aminoglycoside adenylyltransferase; and orfF , hypothetical protein.

    Journal: Scientific Reports

    Article Title: The commensal infant gut meta-mobilome as a potential reservoir for persistent multidrug resistance integrons

    doi: 10.1038/srep15317

    Figure Lengend Snippet: Integrons detected by long-range PCR. ( a ) 1.5 kb partially sequenced integron by long-range PCR product. ( b ) 1.1 kb partially sequenced integron by long-range PCR. Cylindrical boxes show individual genes that are size dependent, i.e. larger box is longer gene; dotted arrows indicate the direction of transcription; and gradient blue color the end of the acquired sequence. Gene and structural features: attI , primary recombination site; dfrA17 and dfrA12 , dihydrofolate reductase; attC , recombination site; aadA5 and aadA2 , aminoglycoside adenylyltransferase; and orfF , hypothetical protein.

    Article Snippet: Each PCR reaction (25 μl) contained 1× HOT FIREPol PCR mix (Solis BioDyne, Estonia); 200 nM uniquely tagged forward and reverse primers; 1 μl of sample DNA and water.

    Techniques: Polymerase Chain Reaction, Sequencing

    Gene knockdown of endogenous bcl-2. (A) After lipofectamine 2000-mediated transfection, (B) after unassisted application. The effect of PEG-siRNA conjugates (siRNA-PEG (S), 1 / 6 ; siRNA-PEG2 (S/AS), 5 / 6 ) was evaluated by qPCR-based quantification of bcl-2 mRNA levels in MCF-7 cells. The indicated siRNAs were either transfected into the cells with lipofectamine 2000 (A), or applied without any uptake-enhancing agent (B). Cells were lysed after 24 h, total RNA was extracted, transcribed into cDNA, and quantified with qPCR. Bcl-2 levels were normalized to the reference gene RNA polymerase II, which was shown not to be influenced by siRNA or the transfection procedure. After lipofectamine-mediated delivery, efficient gene silencing occurred with both modified and unmodified siRNAs ( p

    Journal: Bioorganic & Medicinal Chemistry

    Article Title: Chemically defined polyethylene glycol siRNA conjugates with enhanced gene silencing effect

    doi: 10.1016/j.bmc.2014.02.004

    Figure Lengend Snippet: Gene knockdown of endogenous bcl-2. (A) After lipofectamine 2000-mediated transfection, (B) after unassisted application. The effect of PEG-siRNA conjugates (siRNA-PEG (S), 1 / 6 ; siRNA-PEG2 (S/AS), 5 / 6 ) was evaluated by qPCR-based quantification of bcl-2 mRNA levels in MCF-7 cells. The indicated siRNAs were either transfected into the cells with lipofectamine 2000 (A), or applied without any uptake-enhancing agent (B). Cells were lysed after 24 h, total RNA was extracted, transcribed into cDNA, and quantified with qPCR. Bcl-2 levels were normalized to the reference gene RNA polymerase II, which was shown not to be influenced by siRNA or the transfection procedure. After lipofectamine-mediated delivery, efficient gene silencing occurred with both modified and unmodified siRNAs ( p

    Article Snippet: The master mix was prepared with Hot FirePol Polymerase and EvaGreen from Solis Biodyne (Tartu, Estonia) and gene-specific primers for bcl-2 (forward: CCCAAGTTTTGAGCCATTCA, reverse: CCTGGTGGACAACATCGC), CXCR4 (forward: CGTGGAACGTTTTTCCTGTT, reverse: GGTGCTGAAATCAACCCACT), and RNA polymerase II (forward: GAAGGCACTCTCCAGGTTTG, reverse: ATGCTGGTTTTGGTGACGAC) as reference gene from Microsynth (Basel, Switzerland).

    Techniques: Transfection, Real-time Polymerase Chain Reaction, Modification