Journal: Bioorganic & Medicinal Chemistry
Article Title: Chemically defined polyethylene glycol siRNA conjugates with enhanced gene silencing effect
doi: 10.1016/j.bmc.2014.02.004
Figure Lengend Snippet: Gene knockdown of endogenous bcl-2. (A) After lipofectamine 2000-mediated transfection, (B) after unassisted application. The effect of PEG-siRNA conjugates (siRNA-PEG (S), 1 / 6 ; siRNA-PEG2 (S/AS), 5 / 6 ) was evaluated by qPCR-based quantification of bcl-2 mRNA levels in MCF-7 cells. The indicated siRNAs were either transfected into the cells with lipofectamine 2000 (A), or applied without any uptake-enhancing agent (B). Cells were lysed after 24 h, total RNA was extracted, transcribed into cDNA, and quantified with qPCR. Bcl-2 levels were normalized to the reference gene RNA polymerase II, which was shown not to be influenced by siRNA or the transfection procedure. After lipofectamine-mediated delivery, efficient gene silencing occurred with both modified and unmodified siRNAs ( p
Article Snippet: The master mix was prepared with Hot FirePol Polymerase and EvaGreen from Solis Biodyne (Tartu, Estonia) and gene-specific primers for bcl-2 (forward: CCCAAGTTTTGAGCCATTCA, reverse: CCTGGTGGACAACATCGC), CXCR4 (forward: CGTGGAACGTTTTTCCTGTT, reverse: GGTGCTGAAATCAACCCACT), and RNA polymerase II (forward: GAAGGCACTCTCCAGGTTTG, reverse: ATGCTGGTTTTGGTGACGAC) as reference gene from Microsynth (Basel, Switzerland).
Techniques: Transfection, Real-time Polymerase Chain Reaction, Modification