mouse cpg dna  (Hycult Biotech)


Bioz Verified Symbol Hycult Biotech is a verified supplier
Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg dna
    Mouse Cpg Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg dna/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg dna - by Bioz Stars, 2024-07
    92/100 stars

    Images

    mouse cpg dna  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg dna
    Mouse Cpg Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg dna/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg dna - by Bioz Stars, 2024-07
    92/100 stars

    Images

    cpg  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech cpg
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Cpg, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg - by Bioz Stars, 2024-07
    92/100 stars

    Images

    1) Product Images from "Activation of CD11b + Kupffer Cells/Macrophages as a Common Cause for Exacerbation of TNF/Fas-Ligand-Dependent Hepatitis in Hypercholesterolemic Mice"

    Article Title: Activation of CD11b + Kupffer Cells/Macrophages as a Common Cause for Exacerbation of TNF/Fas-Ligand-Dependent Hepatitis in Hypercholesterolemic Mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0049339

    HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Figure Legend Snippet: HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.

    Techniques Used: Injection

    The HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of cytokines at the indicated times were examined. The data shown are the means ± SE from three mice in each group.* P <0.01 vs. CD and HFCD.
    Figure Legend Snippet: The HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of cytokines at the indicated times were examined. The data shown are the means ± SE from three mice in each group.* P <0.01 vs. CD and HFCD.

    Techniques Used: Injection

    The mice received HFCD for four weeks and then the HFCD diet was changed to a CD diet (HFCD/CD). After four weeks, the mice were injected with either α-GalCer or CpG-ODN, and the serum ALT levels were examined. The data shown are the means ± SE from six to ten mice in each group. * P <0.05 vs. other groups.
    Figure Legend Snippet: The mice received HFCD for four weeks and then the HFCD diet was changed to a CD diet (HFCD/CD). After four weeks, the mice were injected with either α-GalCer or CpG-ODN, and the serum ALT levels were examined. The data shown are the means ± SE from six to ten mice in each group. * P <0.05 vs. other groups.

    Techniques Used: Injection

    cpgodn  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech cpgodn
    Cpgodn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpgodn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpgodn - by Bioz Stars, 2024-07
    92/100 stars

    Images

    cpg odn  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech cpg odn
    Cpg Odn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg odn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg odn - by Bioz Stars, 2024-07
    92/100 stars

    Images

    cpg dna for mouse  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech cpg dna for mouse
    Cpg Dna For Mouse, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg dna for mouse/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg dna for mouse - by Bioz Stars, 2024-07
    92/100 stars

    Images

    mouse hycult biotech hc4033 pam3csk4 invivogen tlr  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse hycult biotech hc4033 pam3csk4 invivogen tlr
    Mouse Hycult Biotech Hc4033 Pam3csk4 Invivogen Tlr, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse hycult biotech hc4033 pam3csk4 invivogen tlr/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse hycult biotech hc4033 pam3csk4 invivogen tlr - by Bioz Stars, 2024-07
    92/100 stars

    Images

    mouse cpg odn  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg odn
    HBs-Tg mice are more susceptible to <t>CpG-induced</t> liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or <t>ODN</t> control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 <t>CpG</t> <t>ODN</t> and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.
    Mouse Cpg Odn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg odn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg odn - by Bioz Stars, 2024-07
    92/100 stars

    Images

    1) Product Images from "CD205-TLR9-IL-12 axis contributes to CpG-induced oversensitive liver injury in HBsAg transgenic mice by promoting the interaction of NKT cells with Kupffer cells"

    Article Title: CD205-TLR9-IL-12 axis contributes to CpG-induced oversensitive liver injury in HBsAg transgenic mice by promoting the interaction of NKT cells with Kupffer cells

    Journal: Cellular and Molecular Immunology

    doi: 10.1038/cmi.2015.111

    HBs-Tg mice are more susceptible to CpG-induced liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or ODN control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 CpG ODN and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.
    Figure Legend Snippet: HBs-Tg mice are more susceptible to CpG-induced liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or ODN control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 CpG ODN and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.

    Techniques Used: Injection, Staining, Transgenic Assay

    HBs-Tg mice are associated with upregulated expression of FasL on liver NKT cells and Fas on hepatocytes. C57BL/6 mice and HBs-Tg mice were treated with ODN control or CpG-ODN, and killed at 12 h after challenge. ( a ) Hepatic MNCs were isolated and examined by flow cytometry using anti-NK1.1, anti-CD3, PBS57-loaded CD1d tetramer and anti-FasL Abs. ( b ) Fas expression on hepatocytes was analyzed by flow cytometry. ( c ) Statistical analysis of the percentage of Fas-positive hepatocytes in b . Data are shown as the mean±s.e.m. ( n =6 mice per group) and are from one representative experiment of three independent experiments. * P <0.05. Ab, antibody; HBs-Tg, hepatitis B surface antigen transgenic; MNC, mononuclear cell; NKT, natural killer T; ODN, oligodeoxynucleotide.
    Figure Legend Snippet: HBs-Tg mice are associated with upregulated expression of FasL on liver NKT cells and Fas on hepatocytes. C57BL/6 mice and HBs-Tg mice were treated with ODN control or CpG-ODN, and killed at 12 h after challenge. ( a ) Hepatic MNCs were isolated and examined by flow cytometry using anti-NK1.1, anti-CD3, PBS57-loaded CD1d tetramer and anti-FasL Abs. ( b ) Fas expression on hepatocytes was analyzed by flow cytometry. ( c ) Statistical analysis of the percentage of Fas-positive hepatocytes in b . Data are shown as the mean±s.e.m. ( n =6 mice per group) and are from one representative experiment of three independent experiments. * P <0.05. Ab, antibody; HBs-Tg, hepatitis B surface antigen transgenic; MNC, mononuclear cell; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Techniques Used: Expressing, Isolation, Flow Cytometry, Transgenic Assay

    NKT cell-mediated liver injury is Kupffer cell- and IL-12-dependent in HBs-Tg mice after CpG injection. ( a , b ) Depletion of Kupffer cells was achieved by pretreatment with GdCl 3 24 h before CpG injection in HBs-Tg mice. Endogenous IL-12 was neutralized by pretreatment with anti-IL-12 mAb 12 h before CpG injection in HBs-Tg mice. Serum ALT levels were determined 24 h after CpG injection ( a ), and the expression levels of FasL and CD69 on hepatic NKT cells were determined by FACS analysis ( b ). ( c ) Kupffer cells were isolated from ODN control or CpG-ODN-treated HBs-Tg mice. After 48 h of culture, the supernatants were collected for IL-12 measurement by ELISA. ( d ) HBs-Tg mice were pretreated with GdCl 3 or saline. Serum IL-12 levels were determined 3 h after CpG injection. All values are shown as the mean±s.e.m. from 6–8 mice per group and are representative of two experiments. * P <0.05 versus control group by Student’s t -test. ALT, alanine aminotransferase; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting; HBs-Tg, hepatitis B surface antigen transgenic; IL, interleukin; mAb, antibody; NKT, natural killer T; ODN, oligodeoxynucleotide.
    Figure Legend Snippet: NKT cell-mediated liver injury is Kupffer cell- and IL-12-dependent in HBs-Tg mice after CpG injection. ( a , b ) Depletion of Kupffer cells was achieved by pretreatment with GdCl 3 24 h before CpG injection in HBs-Tg mice. Endogenous IL-12 was neutralized by pretreatment with anti-IL-12 mAb 12 h before CpG injection in HBs-Tg mice. Serum ALT levels were determined 24 h after CpG injection ( a ), and the expression levels of FasL and CD69 on hepatic NKT cells were determined by FACS analysis ( b ). ( c ) Kupffer cells were isolated from ODN control or CpG-ODN-treated HBs-Tg mice. After 48 h of culture, the supernatants were collected for IL-12 measurement by ELISA. ( d ) HBs-Tg mice were pretreated with GdCl 3 or saline. Serum IL-12 levels were determined 3 h after CpG injection. All values are shown as the mean±s.e.m. from 6–8 mice per group and are representative of two experiments. * P <0.05 versus control group by Student’s t -test. ALT, alanine aminotransferase; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting; HBs-Tg, hepatitis B surface antigen transgenic; IL, interleukin; mAb, antibody; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Techniques Used: Injection, Expressing, Isolation, Enzyme-linked Immunosorbent Assay, Fluorescence, FACS, Transgenic Assay

    mouse cpg  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg
    Mouse Cpg, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg - by Bioz Stars, 2024-07
    92/100 stars

    Images

    mouse cpg dna  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg dna
    Mouse Cpg Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg dna/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg dna - by Bioz Stars, 2024-07
    92/100 stars

    Images

    mouse cpg dna  (Hycult Biotech)


    Bioz Verified Symbol Hycult Biotech is a verified supplier
    Bioz Manufacturer Symbol Hycult Biotech manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Hycult Biotech mouse cpg dna
    Mouse Cpg Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg dna/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg dna - by Bioz Stars, 2024-07
    92/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Hycult Biotech mouse cpg dna
    Mouse Cpg Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg dna/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg dna - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech cpg
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Cpg, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech cpgodn
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Cpgodn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpgodn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpgodn - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech cpg odn
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Cpg Odn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg odn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg odn - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech cpg dna for mouse
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Cpg Dna For Mouse, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg dna for mouse/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg dna for mouse - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech mouse hycult biotech hc4033 pam3csk4 invivogen tlr
    HFCD and CD mice were injected i.v. with either α-GalCer <t>or</t> <t>CpG-ODN,</t> and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.
    Mouse Hycult Biotech Hc4033 Pam3csk4 Invivogen Tlr, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse hycult biotech hc4033 pam3csk4 invivogen tlr/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse hycult biotech hc4033 pam3csk4 invivogen tlr - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech mouse cpg odn
    HBs-Tg mice are more susceptible to <t>CpG-induced</t> liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or <t>ODN</t> control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 <t>CpG</t> <t>ODN</t> and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.
    Mouse Cpg Odn, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg odn/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg odn - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    92
    Hycult Biotech mouse cpg
    HBs-Tg mice are more susceptible to <t>CpG-induced</t> liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or <t>ODN</t> control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 <t>CpG</t> <t>ODN</t> and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.
    Mouse Cpg, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse cpg/product/Hycult Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mouse cpg - by Bioz Stars, 2024-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.

    Journal: PLoS ONE

    Article Title: Activation of CD11b + Kupffer Cells/Macrophages as a Common Cause for Exacerbation of TNF/Fas-Ligand-Dependent Hepatitis in Hypercholesterolemic Mice

    doi: 10.1371/journal.pone.0049339

    Figure Lengend Snippet: HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of ALT (12 h after reagent injection) ( a, b ) and TNF (1 h after reagent injection) ( c, d ) were examined. The data shown are the means ± SE from eight mice in each group. * P <0.05 vs. CD and HFD, ** P <0.01 vs. CD and HFCD.

    Article Snippet: The bacterial DNA motifs, CpG-oligonucleotides (ODN) (HC4033): TCCATGACGTTCCTGATGCT , were purchased from Hycult Biotechnology (Uden, Netherlands).

    Techniques: Injection

    The HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of cytokines at the indicated times were examined. The data shown are the means ± SE from three mice in each group.* P <0.01 vs. CD and HFCD.

    Journal: PLoS ONE

    Article Title: Activation of CD11b + Kupffer Cells/Macrophages as a Common Cause for Exacerbation of TNF/Fas-Ligand-Dependent Hepatitis in Hypercholesterolemic Mice

    doi: 10.1371/journal.pone.0049339

    Figure Lengend Snippet: The HFCD and CD mice were injected i.v. with either α-GalCer or CpG-ODN, and the serum levels of cytokines at the indicated times were examined. The data shown are the means ± SE from three mice in each group.* P <0.01 vs. CD and HFCD.

    Article Snippet: The bacterial DNA motifs, CpG-oligonucleotides (ODN) (HC4033): TCCATGACGTTCCTGATGCT , were purchased from Hycult Biotechnology (Uden, Netherlands).

    Techniques: Injection

    The mice received HFCD for four weeks and then the HFCD diet was changed to a CD diet (HFCD/CD). After four weeks, the mice were injected with either α-GalCer or CpG-ODN, and the serum ALT levels were examined. The data shown are the means ± SE from six to ten mice in each group. * P <0.05 vs. other groups.

    Journal: PLoS ONE

    Article Title: Activation of CD11b + Kupffer Cells/Macrophages as a Common Cause for Exacerbation of TNF/Fas-Ligand-Dependent Hepatitis in Hypercholesterolemic Mice

    doi: 10.1371/journal.pone.0049339

    Figure Lengend Snippet: The mice received HFCD for four weeks and then the HFCD diet was changed to a CD diet (HFCD/CD). After four weeks, the mice were injected with either α-GalCer or CpG-ODN, and the serum ALT levels were examined. The data shown are the means ± SE from six to ten mice in each group. * P <0.05 vs. other groups.

    Article Snippet: The bacterial DNA motifs, CpG-oligonucleotides (ODN) (HC4033): TCCATGACGTTCCTGATGCT , were purchased from Hycult Biotechnology (Uden, Netherlands).

    Techniques: Injection

    HBs-Tg mice are more susceptible to CpG-induced liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or ODN control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 CpG ODN and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.

    Journal: Cellular and Molecular Immunology

    Article Title: CD205-TLR9-IL-12 axis contributes to CpG-induced oversensitive liver injury in HBsAg transgenic mice by promoting the interaction of NKT cells with Kupffer cells

    doi: 10.1038/cmi.2015.111

    Figure Lengend Snippet: HBs-Tg mice are more susceptible to CpG-induced liver injury and cytokine production. HBs-Tg mice and C57BL/6 mice were injected intravenously with CpG (6 μg/g body weight). ( a ) Serum ALT levels and ( b ) liver samples were collected 24 h after CpG challenge and then were prepared and stained with H&E (original magnification × 200). The arrows show hepatocyte damage and the circle shows leukocyte infiltration. ( c – e ) Serum cytokine levels were measured at the indicated time points after CpG or ODN control challenge. Values in a , c , d and e are shown as the mean±s.e.m. from five mice at each time point in each group and are from one representative experiment of two independent experiments. * P <0.05 compared with the other three groups (that is, B6 ODN control, B6 CpG ODN and HBs-Tg ODN control) determined by one-way ANOVA/Tukey’s test. ALT, alanine aminotransferase; ANOVA, analysis of variance; HBs-Tg, hepatitis B surface antigen transgenic; H&E, hematoxylin and eosin; ODN, oligodeoxynucleotide.

    Article Snippet: Mouse CpG-ODN (HC4033: 5′-TCCATGACGTTCCTGATGCT-3′) and non-CpG-ODN control (HC4034: 5′-GCTTGATGACTCAGCCGGAA-3′) were purchased from HyCult Biotechnology (Uden, Netherlands) and were dissolved in pyrogen-free saline.

    Techniques: Injection, Staining, Transgenic Assay

    HBs-Tg mice are associated with upregulated expression of FasL on liver NKT cells and Fas on hepatocytes. C57BL/6 mice and HBs-Tg mice were treated with ODN control or CpG-ODN, and killed at 12 h after challenge. ( a ) Hepatic MNCs were isolated and examined by flow cytometry using anti-NK1.1, anti-CD3, PBS57-loaded CD1d tetramer and anti-FasL Abs. ( b ) Fas expression on hepatocytes was analyzed by flow cytometry. ( c ) Statistical analysis of the percentage of Fas-positive hepatocytes in b . Data are shown as the mean±s.e.m. ( n =6 mice per group) and are from one representative experiment of three independent experiments. * P <0.05. Ab, antibody; HBs-Tg, hepatitis B surface antigen transgenic; MNC, mononuclear cell; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Journal: Cellular and Molecular Immunology

    Article Title: CD205-TLR9-IL-12 axis contributes to CpG-induced oversensitive liver injury in HBsAg transgenic mice by promoting the interaction of NKT cells with Kupffer cells

    doi: 10.1038/cmi.2015.111

    Figure Lengend Snippet: HBs-Tg mice are associated with upregulated expression of FasL on liver NKT cells and Fas on hepatocytes. C57BL/6 mice and HBs-Tg mice were treated with ODN control or CpG-ODN, and killed at 12 h after challenge. ( a ) Hepatic MNCs were isolated and examined by flow cytometry using anti-NK1.1, anti-CD3, PBS57-loaded CD1d tetramer and anti-FasL Abs. ( b ) Fas expression on hepatocytes was analyzed by flow cytometry. ( c ) Statistical analysis of the percentage of Fas-positive hepatocytes in b . Data are shown as the mean±s.e.m. ( n =6 mice per group) and are from one representative experiment of three independent experiments. * P <0.05. Ab, antibody; HBs-Tg, hepatitis B surface antigen transgenic; MNC, mononuclear cell; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Article Snippet: Mouse CpG-ODN (HC4033: 5′-TCCATGACGTTCCTGATGCT-3′) and non-CpG-ODN control (HC4034: 5′-GCTTGATGACTCAGCCGGAA-3′) were purchased from HyCult Biotechnology (Uden, Netherlands) and were dissolved in pyrogen-free saline.

    Techniques: Expressing, Isolation, Flow Cytometry, Transgenic Assay

    NKT cell-mediated liver injury is Kupffer cell- and IL-12-dependent in HBs-Tg mice after CpG injection. ( a , b ) Depletion of Kupffer cells was achieved by pretreatment with GdCl 3 24 h before CpG injection in HBs-Tg mice. Endogenous IL-12 was neutralized by pretreatment with anti-IL-12 mAb 12 h before CpG injection in HBs-Tg mice. Serum ALT levels were determined 24 h after CpG injection ( a ), and the expression levels of FasL and CD69 on hepatic NKT cells were determined by FACS analysis ( b ). ( c ) Kupffer cells were isolated from ODN control or CpG-ODN-treated HBs-Tg mice. After 48 h of culture, the supernatants were collected for IL-12 measurement by ELISA. ( d ) HBs-Tg mice were pretreated with GdCl 3 or saline. Serum IL-12 levels were determined 3 h after CpG injection. All values are shown as the mean±s.e.m. from 6–8 mice per group and are representative of two experiments. * P <0.05 versus control group by Student’s t -test. ALT, alanine aminotransferase; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting; HBs-Tg, hepatitis B surface antigen transgenic; IL, interleukin; mAb, antibody; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Journal: Cellular and Molecular Immunology

    Article Title: CD205-TLR9-IL-12 axis contributes to CpG-induced oversensitive liver injury in HBsAg transgenic mice by promoting the interaction of NKT cells with Kupffer cells

    doi: 10.1038/cmi.2015.111

    Figure Lengend Snippet: NKT cell-mediated liver injury is Kupffer cell- and IL-12-dependent in HBs-Tg mice after CpG injection. ( a , b ) Depletion of Kupffer cells was achieved by pretreatment with GdCl 3 24 h before CpG injection in HBs-Tg mice. Endogenous IL-12 was neutralized by pretreatment with anti-IL-12 mAb 12 h before CpG injection in HBs-Tg mice. Serum ALT levels were determined 24 h after CpG injection ( a ), and the expression levels of FasL and CD69 on hepatic NKT cells were determined by FACS analysis ( b ). ( c ) Kupffer cells were isolated from ODN control or CpG-ODN-treated HBs-Tg mice. After 48 h of culture, the supernatants were collected for IL-12 measurement by ELISA. ( d ) HBs-Tg mice were pretreated with GdCl 3 or saline. Serum IL-12 levels were determined 3 h after CpG injection. All values are shown as the mean±s.e.m. from 6–8 mice per group and are representative of two experiments. * P <0.05 versus control group by Student’s t -test. ALT, alanine aminotransferase; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting; HBs-Tg, hepatitis B surface antigen transgenic; IL, interleukin; mAb, antibody; NKT, natural killer T; ODN, oligodeoxynucleotide.

    Article Snippet: Mouse CpG-ODN (HC4033: 5′-TCCATGACGTTCCTGATGCT-3′) and non-CpG-ODN control (HC4034: 5′-GCTTGATGACTCAGCCGGAA-3′) were purchased from HyCult Biotechnology (Uden, Netherlands) and were dissolved in pyrogen-free saline.

    Techniques: Injection, Expressing, Isolation, Enzyme-linked Immunosorbent Assay, Fluorescence, FACS, Transgenic Assay