hepg2  (ATCC)

Journal: Genes & Diseases

Article Title: Identifying C1orf122 as a potential HCC exacerbated biomarker dependently of SRPK1 regulates PI3K/AKT/GSK3β signaling pathway

doi: 10.1016/j.gendis.2025.101721

Figure Lengend Snippet: C1orf122 was upregulated in HCC patients and correlated with poor survival outcome. ( A ) The abundance of C1orf122 in HCC and normal tissues was assessed using data from TCGA. ( B ) C1orf122 protein expression in seven pairs of tumor tissues (T) and matching non-cancerous tissues (N) as determined by Western blotting. ( C ) Immunohistochemistry labelling was performed to assess C1orf122 expression in HCC tissues and adjacent tissues. ( D ) qRT-PCR and Western blot experiments were performed to measure the levels of C1orf122 in THLE-2 cells and five HCC cell lines. ( E ) Nude mice were administered and the subcutaneous implants of HepG2 cells were infected with either sg-Control or sg-C1orf122. On day 48 post-implantation, the tumors were collected and photographed, and the tumor growth was tracked. Data (tumor weight and volume data) are expressed as the mean ± SD ( n = 4). ( F ) The association of C1orf122 levels with the overall survival of patients with HCC was determined by the Kaplan–Meier survival analysis on the GEPIA database. ∗∗ p < 0.01, ∗∗∗ p < 0.001.

Article Snippet: The HuH-7, HepG2, Hep3B, SMMC7721, MHCC-97H, THLE-2, HeLa, and 293T cell lines were purchased from the ATCC cell bank and cultured at 37 °C under the conditions of 5% CO 2 with the Dulbecco's Modified Eagle Medium (DMEM, Gibco, 11995065, United States) containing 10% Fetal Bovine Serum (FBS, Hyclone, SH30070, United States) and 1% Penicillin-Streptomycin Solution (Hyclone, SV30010, United States).

Techniques: Expressing, Western Blot, Immunohistochemistry, Quantitative RT-PCR, Infection, Control

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: Generation of a model to understand pathogenic mechanisms of DNAJB1-PRKACA in FLC (A) Parent hepatoblastoma cells (HepG2) were transfected with a dual-guide RNA-CAS9 plasmid containing an eGFP tag, to allow for cell sorting of HepG2 cells that took up the plasmid. Each cell was deposited in a single well of a 96-well plate and clonally expanded. The guide RNAs (gRNA1: CAGGAGCCGACCCCGTTCGT, gRNA2: GTAGACGCGGTTGCGCTAAG) directed CAS9 to induce a double-strand break at intron 1 of DNAJB1 and intron 1 of PRKACA , resulting in 400 kb deletion and chromosomal rearrangement to generate the DNAJB1-PRKACA oncogene fusion. (B) After expansion, genomic DNA from each clone was assessed via PCR for presence of DNAJB1-PRKACA gene fusion and six clones manifested appropriately sized PCR products (DNA bands) pertaining to the forward and reverse primers across the breakpoint. (C) The PCR product from each clone and DNAJB1-PRKACA mRNA transcript (across the breakpoint) was sequenced to determine the precise sequence by CRISPR gene editing. (D) Assessment of expression levels of native genes DNAJB1 and PRKACA (light bars), as well as FLC-specific genes including DNAJB1-PRKACA fusion, SLC16A14 , and LINC00473 (dark bars) was performed. Shown is relative fold-change (error bars represent standard deviation) compared to parent HepG2 cells, with four biological replicates per clone. (E) Clone samples and parent HepG2 cells were also evaluated for generation of fusion oncoprotein (DNAJ-PKAc) and native PKA (β-Actin control). Clone selection for subsequent assays was based on these rigorous validation metrics (A–E) yielding H33 (red arrow) and H12 (purple arrow) as the selected clones.

Article Snippet: Hepatoblastoma HepG2 cell line was obtained from ATCC (Manassas, VA).

Techniques: Transfection, Plasmid Preparation, FACS, Clone Assay, Sequencing, CRISPR, Expressing, Standard Deviation, Control, Selection, Biomarker Discovery

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 regulation of RNA Polymerase II phosphorylation and super-enhancer gene expression (A) Protein analysis for phosphorylated RNA polymerase II (serine-2, serine-5, and serine-7), CDK2 and CDK7 was performed and phosphorylation levels were quantified using ImageJ. Shown are two separate biological replicates for each line. Statistically significant differences between HepG2 and H33 are shown ( t test, ∗ p < 0.05). (B) RNA sequencing of HepG2 cells and H33 cells treated at varying doses of SY-5609 for 24 h ( n = 6 biological replicates per group) were evaluated for prominent super-enhancer-associated genes, including SLC16A14 and LINC00473 . Findings from the H33 clone were confirmed in a separate DNAJB1-PRKACA -expressing clone (H12) ( t test, ∗∗ p < 0.01). (C) DNAJB1-PRKACA -expressing H33 cells were treated with a selective CDK7 inhibitor, SY5609 (100 nM, 1 μM, and 10 μM), or DMSO control (0) for 24 h ( n = 3 biological replicates per group, two representative images shown per group for western blot). Known substrate targets of CDK7 were assessed including RNA Pol II CTD (Ser 2, 5, and 7), Thr160 phosphorylated CDK2 (pCDK2) and Thr170 phosphorylated CDK7 (pCDK7) ( t test, ∗ p < 0.05). (D and E) To assess for CDK7-dependent expression of FLC-specific genes, H33 cells were treated with SY-5609 (1–300 nM) for 24 h and levels of mRNA expression (RT-qPCR) versus DMSO control were evaluated, including SLC16A14 and LINC00473 . This was repeated with a separate covalent-binding selective and specific CDK7 inhibitor (YKL-5-124). Shown are three biological replicates per drug dose per mRNA with statistical significance denoted as compared to DMSO control ( t test, ∗ p < 0.05, ∗∗ p < 0.01).

Article Snippet: Hepatoblastoma HepG2 cell line was obtained from ATCC (Manassas, VA).

Techniques: Phospho-proteomics, Gene Expression, RNA Sequencing, Expressing, Control, Western Blot, Quantitative RT-PCR, Binding Assay

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 is a novel therapeutic target in DNAJB1-PRKACA-expressing cells (A) To assess for CDK7 effect on cell viability, HepG2 cells and H33 cells underwent 48-h drug treatment with either SY5609 (1 pM–5 μM) or YKL-5-124 (100 pM–10 μM). Percent viability was determined by normalizing to control (DMSO treated). To confirm the findings in the DNAJB1-PRKACA -expressing H33 cells, a separate clone (H12) was tested with the same drugs over the same dose range. In each figure, the LC 50 (IC 50 ) is represented by the straight line. (B) HepG2 cells and H33 cells were synchronized and treated with either DMSO or SY5609 (1 μm) for 24 h. Percent of cells in G0/G1, S, and G2/M were determined by flow cytometry. Shown are four biological replicates per cell line per treatment ( t test, ∗ p = 0.001, ∗∗ p < 0.0001). (C) HepG2 cells and H33 cells were treated with DMSO (control) or increasing doses of SY5609 for 24 h and caspase 3/7 activity measured. To confirm the increased apoptotic activity in the H33 cells, a separate clone (H12) was utilized. ( t test ∗ p < 0.0001, for H33 vs. HepG2 and H12 vs. HepG2). (D) To validate the results, PARP and cleaved-PARP (marker for apoptosis) protein were evaluated in HepG2 and H33 cells, using two separate antibodies that either recognize both PARP and cleaved-PARP (top bands) or only cleaved-PARP alone (bottom band). (E) Primary human hepatocytes (PHHs) isolated fresh from human donor liver transplant specimens and H33 cells were treated with DMSO, SY5609 100 nM, or SY5609 1 μM for 24 and 48 h. The percent of viable cells was determined by normalizing to DMSO control. There were four biological replicates per group per time/treatment dose ( t test ∗ p = 0.02, ∗∗ p = 0.01, ∗∗∗ p < 0.0001). (F) PHHs and H33 cells were treated with SY5609 (100 pM–5 μM) for 48, 72, or 120 h and percent viability assessed, normalized to DMSO control. The LC 50 (IC 50 ) is demarcated by the solid line. There were four biological replicates for each drug dose at each time point for each line (PHH and H33).

Article Snippet: Hepatoblastoma HepG2 cell line was obtained from ATCC (Manassas, VA).

Techniques: Expressing, Control, Flow Cytometry, Activity Assay, Marker, Isolation

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: Generation of a model to understand pathogenic mechanisms of DNAJB1-PRKACA in FLC (A) Parent hepatoblastoma cells (HepG2) were transfected with a dual-guide RNA-CAS9 plasmid containing an eGFP tag, to allow for cell sorting of HepG2 cells that took up the plasmid. Each cell was deposited in a single well of a 96-well plate and clonally expanded. The guide RNAs (gRNA1: CAGGAGCCGACCCCGTTCGT, gRNA2: GTAGACGCGGTTGCGCTAAG) directed CAS9 to induce a double-strand break at intron 1 of DNAJB1 and intron 1 of PRKACA , resulting in 400 kb deletion and chromosomal rearrangement to generate the DNAJB1-PRKACA oncogene fusion. (B) After expansion, genomic DNA from each clone was assessed via PCR for presence of DNAJB1-PRKACA gene fusion and six clones manifested appropriately sized PCR products (DNA bands) pertaining to the forward and reverse primers across the breakpoint. (C) The PCR product from each clone and DNAJB1-PRKACA mRNA transcript (across the breakpoint) was sequenced to determine the precise sequence by CRISPR gene editing. (D) Assessment of expression levels of native genes DNAJB1 and PRKACA (light bars), as well as FLC-specific genes including DNAJB1-PRKACA fusion, SLC16A14 , and LINC00473 (dark bars) was performed. Shown is relative fold-change (error bars represent standard deviation) compared to parent HepG2 cells, with four biological replicates per clone. (E) Clone samples and parent HepG2 cells were also evaluated for generation of fusion oncoprotein (DNAJ-PKAc) and native PKA (β-Actin control). Clone selection for subsequent assays was based on these rigorous validation metrics (A–E) yielding H33 (red arrow) and H12 (purple arrow) as the selected clones.

Article Snippet: HepG2 cell line , ATCC , ATCC HB-8065.

Techniques: Transfection, Plasmid Preparation, FACS, Clone Assay, Sequencing, CRISPR, Expressing, Standard Deviation, Control, Selection, Biomarker Discovery

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 regulation of RNA Polymerase II phosphorylation and super-enhancer gene expression (A) Protein analysis for phosphorylated RNA polymerase II (serine-2, serine-5, and serine-7), CDK2 and CDK7 was performed and phosphorylation levels were quantified using ImageJ. Shown are two separate biological replicates for each line. Statistically significant differences between HepG2 and H33 are shown ( t test, ∗ p < 0.05). (B) RNA sequencing of HepG2 cells and H33 cells treated at varying doses of SY-5609 for 24 h ( n = 6 biological replicates per group) were evaluated for prominent super-enhancer-associated genes, including SLC16A14 and LINC00473 . Findings from the H33 clone were confirmed in a separate DNAJB1-PRKACA -expressing clone (H12) ( t test, ∗∗ p < 0.01). (C) DNAJB1-PRKACA -expressing H33 cells were treated with a selective CDK7 inhibitor, SY5609 (100 nM, 1 μM, and 10 μM), or DMSO control (0) for 24 h ( n = 3 biological replicates per group, two representative images shown per group for western blot). Known substrate targets of CDK7 were assessed including RNA Pol II CTD (Ser 2, 5, and 7), Thr160 phosphorylated CDK2 (pCDK2) and Thr170 phosphorylated CDK7 (pCDK7) ( t test, ∗ p < 0.05). (D and E) To assess for CDK7-dependent expression of FLC-specific genes, H33 cells were treated with SY-5609 (1–300 nM) for 24 h and levels of mRNA expression (RT-qPCR) versus DMSO control were evaluated, including SLC16A14 and LINC00473 . This was repeated with a separate covalent-binding selective and specific CDK7 inhibitor (YKL-5-124). Shown are three biological replicates per drug dose per mRNA with statistical significance denoted as compared to DMSO control ( t test, ∗ p < 0.05, ∗∗ p < 0.01).

Article Snippet: HepG2 cell line , ATCC , ATCC HB-8065.

Techniques: Phospho-proteomics, Gene Expression, RNA Sequencing, Expressing, Control, Western Blot, Quantitative RT-PCR, Binding Assay

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 is a novel therapeutic target in DNAJB1-PRKACA-expressing cells (A) To assess for CDK7 effect on cell viability, HepG2 cells and H33 cells underwent 48-h drug treatment with either SY5609 (1 pM–5 μM) or YKL-5-124 (100 pM–10 μM). Percent viability was determined by normalizing to control (DMSO treated). To confirm the findings in the DNAJB1-PRKACA -expressing H33 cells, a separate clone (H12) was tested with the same drugs over the same dose range. In each figure, the LC 50 (IC 50 ) is represented by the straight line. (B) HepG2 cells and H33 cells were synchronized and treated with either DMSO or SY5609 (1 μm) for 24 h. Percent of cells in G0/G1, S, and G2/M were determined by flow cytometry. Shown are four biological replicates per cell line per treatment ( t test, ∗ p = 0.001, ∗∗ p < 0.0001). (C) HepG2 cells and H33 cells were treated with DMSO (control) or increasing doses of SY5609 for 24 h and caspase 3/7 activity measured. To confirm the increased apoptotic activity in the H33 cells, a separate clone (H12) was utilized. ( t test ∗ p < 0.0001, for H33 vs. HepG2 and H12 vs. HepG2). (D) To validate the results, PARP and cleaved-PARP (marker for apoptosis) protein were evaluated in HepG2 and H33 cells, using two separate antibodies that either recognize both PARP and cleaved-PARP (top bands) or only cleaved-PARP alone (bottom band). (E) Primary human hepatocytes (PHHs) isolated fresh from human donor liver transplant specimens and H33 cells were treated with DMSO, SY5609 100 nM, or SY5609 1 μM for 24 and 48 h. The percent of viable cells was determined by normalizing to DMSO control. There were four biological replicates per group per time/treatment dose ( t test ∗ p = 0.02, ∗∗ p = 0.01, ∗∗∗ p < 0.0001). (F) PHHs and H33 cells were treated with SY5609 (100 pM–5 μM) for 48, 72, or 120 h and percent viability assessed, normalized to DMSO control. The LC 50 (IC 50 ) is demarcated by the solid line. There were four biological replicates for each drug dose at each time point for each line (PHH and H33).

Article Snippet: HepG2 cell line , ATCC , ATCC HB-8065.

Techniques: Expressing, Control, Flow Cytometry, Activity Assay, Marker, Isolation

Journal: Molecular Therapy. Nucleic Acids

Article Title: Subnuclear organization and mislocalization of plasmids reduce transgene expression

doi: 10.1016/j.omtn.2025.102730

Figure Lengend Snippet: Nuclear redistribution of plasmids carrying Pol III promoters is not promoter type or cell type specific (A) Plasmids carrying an H1-gRNA cassette redistributed into small foci similar to those seen for U6 promoter plasmids. The nuclei of A549 cells were microinjected with 250 ng/μL plasmid and processed for FISH 4 h later. (B) Pol III type 2 promoters also redistribute into small foci. A549 nuclei were injected with plasmids carrying different ACE-tRNA transgenes, and the distribution patterns were detected 4 h later by FISH. (C) pU6-shRNA injected into the nuclei of HepG2 cells showed nuclear redistribution similar to that seen in A549 cells. All nuclei were counterstained with DAPI. The percentage of microinjected cells with positive FISH signal that display the shown redistribution patterns of plasmids are indicated for each plasmid on the overlay image. Bar, 10 μm.

Article Snippet: A549 human adenocarcinoma cells (ATCC, Manassas, VA) and HepG2 human hepatocellular carcinoma cells (ATCC) were grown in high-glucose DMEM supplemented with 10% fetal bovine serum, kanamycin, and antibiotic/antimycotic solution (Thermo Fisher Scientific, Waltham, MA).

Techniques: Plasmid Preparation, Injection, shRNA

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: In vitro screening of bispecific siRNAs exhibiting efficient dual knockdown (A) Schematic representation of the bispecific siRNA. All siRNAs consist of native RNA with 3′ DNA overhangs. (B) The mean Yes1-associated transcriptional regulator ( YAP1 ) and WW domain containing transcription regulator 1 ( WWTR1 ) mRNA expression levels relative to the mock-transfected human HepG2 cells. Twenty-four hours post reverse transfection with 1 nM siRNA, negative control siRNA (siNC), or mock transfection, the mRNA expression levels were quantified by quantitative reverse-transcription polymerase chain reaction (RT-qPCR) ( n = 3, mean ± standard deviation [SD]). The dotted line below indicates siRNAs with ≥50% relative repression. The numbers below represent the targeted nucleotide position on variant 1 of the human YAP1 and WWTR1 mRNA transcripts. The diagram above represents the target region in the YAP1 and WWTR1 mRNAs per siRNA. The colored area represents the hotspots where highly active siRNAs were obtained. (C) Correlations between the suppression of YAP1 and WWTR1 expression levels using 76 bispecific siRNAs. The dot types indicate the number of mismatches against YAP1 and WWTR1 in the 17-nt targeting region of the bispecific siRNAs ( n = 3, mean). (D and E) The lead siRNA candidates were evaluated at three different concentrations in (D) human HepG2 cells and (E) mouse Hepa1-6 cells ( n = 3, mean ± SD). The dotted line below indicates siRNAs with ≥50% relative repression.

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: In Vitro, Knockdown, Expressing, Transfection, Negative Control, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, Variant Assay

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: Cross-species dual targeting by bs YW -61 (A) bs YW -61 targets Yes1-associated transcriptional regulator ( YAP1 ) and WW domain containing transcription regulator 1 ( WWTR1 ) in humans, cynomolgus monkeys, mice, and rats with up to two mismatches. Gray areas represent the targeted regions, and red letters represent the mismatched bases aligned to each sequence. (B) In vitro dose-response curves for bs YW -61 in human HepG2 cells, cynomolgus monkey MK.P3(F) cells, mouse Hepa1-6 cells, and rat H-4-II-E cells. Twenty-four hours post reverse transfection with the small interfering RNA (siRNA) or control, the mRNA expression levels were quantified by quantitative reverse-transcription polymerase chain reaction (RT-qPCR). The data are shown as a percentage of the mock control values; highest dose: 10 or 1 nM, 10-fold serial dilutions ( n = 3, mean ± standard deviation from three experiments).

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: Sequencing, In Vitro, Transfection, Small Interfering RNA, Control, Expressing, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: Synergistic inhibition of YAP/TAZ downstream gene expression and cell proliferation (A) Expression levels of YAP/TAZ downstream genes in human HepG2 cells following knockdown of Yes1-associated transcriptional regulator ( YAP1 ) and WW domain containing transcription regulator 1 ( WWTR1 ) using 1 nM small interfering RNA (siRNA). Twenty-four hours post reverse transfection, the mRNA expression levels were quantified by quantitative reverse-transcription polymerase chain reaction (RT-qPCR). (B and C) HepG2 cell proliferation following YAP1 and WWTR1 knockdown. (B) Cell viability was quantified using the CellTiter-Glo 2.0 Assay, and (C) cell confluence was monitored using the Incucyte system, 7 days after reverse transfection with 10 nM siRNA or control. (A–C) The data are shown as n = 3, mean ± standard deviation, one-way ANOVA with Tukey’s test; ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001.

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: Inhibition, Gene Expression, Expressing, Knockdown, Small Interfering RNA, Transfection, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Control, Standard Deviation

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: In vitro safety evaluation of YAP1 and WWTR1 knockdown (A) Human HepG2 cells were transfected with PTEN -ASO, mipomersen ( APOB -ASO), or bs YW -61. Caspase-3/7 activity was measured 24 h post transfection and normalized to the activity in the untreated control cells ( n = 2, mean). (B) The oxygen consumption rate (OCR) in HepG2 cells was measured using a Flux Analyzer XF96e to evaluate mitochondrial toxicity. Steady-state oxygen consumption was measured 27.5 h post transfection with bs YW -61. Oligomycin was injected to inhibit ATP synthase, and carbonyl cyanide-4-[trifluoromethoxy] phenylhydrazone (FCCP) was injected to uncouple the mitochondria and determine the maximal OCR. Final OCR values were normalized to the mock-transfected control ( n = 3–12, mean ± standard deviation [SD]). (C and D) HepaSH cells (human hepatocytes) were transfected with 10 nM of si YAP1 + si WWTR1 or bs YW -61. (C) Cell viability was measured 72 h after transfection using the CellTiter-Glo 2.0 Max assay. (D) Dead cells were detected using the Cytotox Green Dye and represented as relative fluorescence intensity compared with the mock samples ( n = 3, mean ± SD, one-way ANOVA with Dunnett’s test; ns, not significant [ p ≥ 0.05]).

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: In Vitro, Knockdown, Transfection, Activity Assay, Control, Injection, Standard Deviation, Fluorescence

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: Characterization of off-target activities of bs YW -61 (A) Chemical modification patterns of bs YW -61m1. (B) In vitro dose-response curves for bs YW -61m1 in human HepG2 cells, cynomolgus monkey MK.P3(F) cells, mouse Hepa1-6 cells, and rat H-4-II-E cells. (C) Transcriptional regulation by RNA sequencing (RNA-seq) analysis in human HepG2 cells 24 h after transfection with 10 nM bs YW -61, relative to the mock control ( n = 3, mean). The volcano plot depicts log 2 -fold change (FC) and p values: gray = not significant (n.s.); green = |FC| ≥ 2; blue = p < 0.05; red = |FC| ≥ 2 and p < 0.05. (D) Off-target genes with a half-maximal inhibitory concentration (IC 50 ) value within 100-fold of those for on-target genes. (E) Number of in vitro probable off-target candidates, in silico -predicted genes with complementarity to the 17-nt targeting region (including up to two mismatches), and in silico -predicted 3′ UTR seed-matched genes. (F) Design of the reporter plasmids to evaluate the full-length hybridization-dependent RNA interference (RNAi) on- and off-target activities mediated by either the guide strand (GS-CM) or passenger strand (PS-CM). (G) RNAi on-target activities of bs YW -61 and bs YW -61m1, and full-length hybridization-dependent off-target activity of the bs YW -61 passenger strand. (H) Design of the reporter plasmids to evaluate the seed-mediated off-target activity of the guide strand (GS-SM4) or passenger strand (PS-SM4). (I) Guide strand seed-mediated off-target activity of bs YW -61 and bs YW -61m1, and passenger strand seed-mediated off-target activity of bs YW -61. (G and I) Luciferase activity was measured 24 h after co-transfection of human HeLa cells with the siRNA and plasmids. Relative luciferase (luc) activity was calculated as the Renilla / firefly ratio relative to siNC ( n = 3, mean ± standard deviation).

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: Modification, In Vitro, RNA Sequencing, Transfection, Control, Concentration Assay, In Silico, Hybridization, Activity Assay, Luciferase, Cotransfection, Standard Deviation

Journal: Molecular Therapy. Nucleic Acids

Article Title: A novel bispecific siRNA concept: Efficient dual knockdown of YAP1 and WWTR1 with a single guide strand

doi: 10.1016/j.omtn.2025.102768

Figure Lengend Snippet: Bispecific siRNAs achieving efficient dual knockdown of CREBBP and EP300 (A) The mean of CREB-binding protein ( CREBBP ) and E1A-binding protein p300 ( EP300 ) mRNA expression levels relative to the mock-transfected human HepG2 cells. Twenty-four hours post reverse transfection with 1 nM siRNA, negative control siRNA (siNC), or mock transfection, the mRNA levels were quantified by quantitative reverse-transcription polymerase chain reaction (RT-qPCR) ( n = 3, mean ± standard deviation [SD]). The dotted line below indicates siRNAs with ≥50% relative repression. The numbers below represent the targeted nucleotide position on variant 1 of the human CREBBP and EP300 mRNA transcripts. (B) In vitro dose-response curves for bs CE -55 in human HepG2 cells; highest dose: 10 nM, 10-fold serial dilutions ( n = 3, mean ± SD). (C) Expression levels of CREBBP , EP300 , and MYC mRNA after reverse transfection of 10 nM si CREBBP , si EP300 , si CREBBP + si EP300 , or bs CE -55 in HepG2 cells. (D) c-Myc protein expression levels following CREBBP and EP300 knockdown in HepG2 cells, quantified by Jess 5 days post transfection ( n = 1). (E and F) HepG2 cell proliferation rates following CREBBP and EP300 knockdown. (E) Cell viability was quantified using the CellTiter-Glo 2.0 assay, with (F) cell confluence monitored using the Incucyte system, 5 days after reverse transfection with 10 nM siRNA or control. (C and E–F) The data are shown as n = 3, mean ± SD, one-way ANOVA with Tukey’s test; ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001.

Article Snippet: The OCR was measured using a Flux Analyzer XFe96 (Agilent Technologies) by Axcelead Inc. Human HepG2 cells (ATCC, HB8065) cultured in a 96-well plate were transfected with siRNAs using Lipofectamine RNAiMAX.

Techniques: Knockdown, Binding Assay, Expressing, Transfection, Negative Control, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, Variant Assay, In Vitro, Control