quick t4 dna ligase  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    T4 DNA Ligase
    T4 DNA Ligase 100 000 units
    Catalog Number:
    100 000 units
    DNA Ligases
    Buy from Supplier

    Structured Review

    New England Biolabs quick t4 dna ligase
    T4 DNA Ligase
    T4 DNA Ligase 100 000 units
    https://www.bioz.com/result/quick t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    quick t4 dna ligase - by Bioz Stars, 2019-07
    99/100 stars


    Related Articles

    Diagnostic Assay:

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: P53β forward primer: 5′- GACCAGACCAGCTTTCAAAAAGA-3′, p53γ forward primer: 5′-ATGCTACTTGACTTACGATGGTGTTACT-3′, p53 isoform reverse primer (Not1 digestion site): 5′aaagcggccgcTCAGTCTGAGTCAGGCCCTTCTG-3′. .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing. .. The cells were transfected using Lipofectamine 2000 (Invitrogen) and harvested after 1.5 days for luciferase detection.

    Clone Assay:

    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: Amplification primers are listed in . .. Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs). .. DNA fragments of arrays of two, three and four FOG1 domains were digested with KpnI and FseI and ligated into the KpnI/FseI digested dCas9 plasmid.

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Homology boxes were cloned into pCC1 plasmid by PCR amplification of the desired regions from 3D7 genomic DNA using specific primers flanked by appropriate restriction sites (list of primers, see Supplementary Table ). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom). .. Sequence of primers used for amplification of homology arms is given in .

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202).

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: A ccdB cassette compatible with Golden Gate cloning ( ) was amplified and inserted into the AvrII/SacI sites of pSEVA191 to create the LII backbone pSEVA191 1–2. .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Article Title: GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris
    Article Snippet: GoldenPi CS module sequences and backbones are listed in Additional file . .. Custom DNA oligonucleotides and gBlocks (from IDT, BE), restriction enzymes, T4 Ligase, Q5 polymerase (all from New England Biolabs, DE, or Fermentas, DE) and DNA cleanup kits (from Qiagen, DE, and Promega, DE) were used for routine cloning work. .. Golden Gate cloning [ , , ], a modular cloning system, was set up for simultaneous overexpression of multiple genes independent of the microorganism and further developed for application in P. pastoris (see Fig. for a schematic overview).

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: The resulting amplicons were loaded on a gel and the appropriate amplicon at 4.4 kb was gel extracted and purified with a Qiagen gel extraction column. .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB). .. The ligation reactions were put in a thermocycler running the program: 60 cycles of 37 °C for 5 minutes, 16 °C for 5 minutes, a final digestion at 37 °C for 30 minutes, and heat inactivation at 65 °C for 20 minutes.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: Paragraph title: Gene cloning, expression and protein purification ... The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.


    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: Amplification primers are listed in . .. Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs).

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Homology boxes were cloned into pCC1 plasmid by PCR amplification of the desired regions from 3D7 genomic DNA using specific primers flanked by appropriate restriction sites (list of primers, see Supplementary Table ). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom). .. Sequence of primers used for amplification of homology arms is given in .

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: The coding sequences of BRUSH and brush were then combined in a BsaI cut-ligation with modules containing the T7 promoter as well as the 5’UTR and 3’UTR sequences of β-globin mRNA (amplified from pEMHE). .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: The resulting amplicons were loaded on a gel and the appropriate amplicon at 4.4 kb was gel extracted and purified with a Qiagen gel extraction column. .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF.

    Article Title: SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states
    Article Snippet: The Hind III-digested and sonicated gDNA was ligated with the SSA of 3N overhang and elongated with the same procedure as the tagmented DNA. .. Then the gDNA was ligated with a T adaptor in a 10-μL containing 1 μL of T adaptor (5 μM), 1× T4 DNA Ligase Reaction Buffer and 1 μL of T4 DNA ligase at 16 °C for 2 h. Finally, the gDNA was purified with 1.2× Ampure XP beads and amplified with different NEB index primers (Additional file : Table S1) in a 50-μL PCR reaction as described above. .. The PCR products were run with agarose gel and the gDNA fragments of 300–1000 bp were extracted with the QIAquick Gel Extraction Kit.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Primers (F: 5′-CATG CCATGGAAAAGCCAGCACCCGGC-3′ and R: 5′-CCCGGAATTCGCGATCAGGAAGACCCTCG-3′) used for the construction of the plasmid containing the RyhB gene were designed in this study. .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs). .. The new constructs along with the empty vector, pBAD202, were transformed into parent strain UTI89 for overexpression experiments.

    Article Title: Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub. Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub
    Article Snippet: The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM). .. The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM).

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Sequencing libraries were constructed using 2 ng of DNA using a low-input protocol . .. Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time. .. DNA was purified between each step using two volumes of NucleoMag NGS DNA purification beads (Macherey–Nagel) except after adapter ligation and PCR amplification where 0.8 volumes were used to facilitate size selection.

    Reporter Assay:

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: Paragraph title: p53 Reporter Assay ... The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    Mass Spectrometry:

    Article Title: Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub. Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub
    Article Snippet: Paragraph title: AFLP and MS‐AFLP protocol ... The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM).


    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The direct RNA sequencing approach Libraries were prepared using the Direct RNA Sequencing Kit (SQK-RNA001; Oxford Nanopore Technologies) The first strand cDNA was synthesized by SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) using an RT adapter with T10 nts. .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).


    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: Finally, the FOG1 epigenetic effector construct was Gibson assembled (New England Biolabs). .. Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs).

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Paragraph title: Plasmid constructs ... Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation. .. Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202).

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: The same backbone was used to express the constructs for BiFC analysis, where LI Golden Gate B-C or D-E parts encoding for the N-terminal (VN) or C-terminal (VC) portions of mVenus ( ) were inserted. .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: Using the pCL-Neo β-globin WT Renilla construct we first digested with Xho1 restriction enzyme (NEB) and treated with T4 DNA polymerase (NEB) purified via PCR column and digested with Not1 restriction enzyme (NEB) for removal of the β-globin portion of the construct. cDNA from wild type HCT116 cells was used to PCR amplify our p53 isoform fragments using the Phusion Polymerase (Thermo Scientific). .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    Article Title: SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states
    Article Snippet: This method can be used to construct NGS library with the DNA fragments sheared by various methods including tagmentation, sonication and enzymatic digestion. .. This method constructs NGS library in several simple steps just dependent on two cheap routine enzymes, T4 DNA ligase and Taq polymerase. .. Combining with Tn5 tagmentation technique, this method can simply the NGS library construction procedure in five steps, including tagmentation, SSA ligation, elongation, T adaptor ligation, and index PCR amplification.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: The arabinose-inducible plasmid pBAD202 was used to construct overexpression strains according to previous report (Ma et al., ). .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs).

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Sequencing libraries were constructed using 2 ng of DNA using a low-input protocol . .. Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time.


    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202).


    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion). .. For adaptor ligation, 10 μl of the inactivated mixture was combined with 1000 units of T4 DNA ligase to a final volume of 20 μl in 1× CutSmart buffer with 1 mM ATP, 1 μM of AT adapter, and 1 μM of TA adapter.

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. For the primary screen, the pBRα-Hfq plasmid library was transformed into KB473 cells along with pKB989 (pACλCI-MS2CP ) and pKB912 (pCDF-MS2hp -OxyS) and plated on LB agar supplemented with inducers (0.2% arabinose and 1.5 μM IPTG), antibiotics (carbenicillin (50 μg/ml), chloramphenicol (25 μg/ml), kanamycin (50 μg/ml), and spectinomycin (100 μg/ml)) and indicators (Xgal (40 μg/ml) and phenylethyl-β-D-thiogalactopyranoside (125 μM; Gold Biotech)).

    Article Title: Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub. Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub
    Article Snippet: 150 ng) was combined with 10 μl double digestion mix containing 1 μl 10 × CutSmart Buffer (New England Biolabs, NEB), 2.5 μEco RI (NEB), 0.5 μMse I or 2.5 μHpa II or 2.5 μMsp I (NEB) in parallel reactions. .. The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM). .. For the preselective amplification (PCR1), 2 μl ligation product was combined with 13 μl PCR1 reaction mix containing 0.7 μl preselective primers (5 μM) each, 0.6 μl dNTPs (TIANGEN, 2.5 mM each), 1.5 μl 10× buffer (TIAGEN), 0.75 U polymerase (TIAGEN), and 9.2 μl H2 O.

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Sequencing libraries were constructed using 2 ng of DNA using a low-input protocol . .. Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time. .. DNA was purified between each step using two volumes of NucleoMag NGS DNA purification beads (Macherey–Nagel) except after adapter ligation and PCR amplification where 0.8 volumes were used to facilitate size selection.


    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing. .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    In Silico:

    Article Title: GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris
    Article Snippet: Primer design and in silico cloning was performed using the CLC Main Workbench Version 7.7.3. .. Custom DNA oligonucleotides and gBlocks (from IDT, BE), restriction enzymes, T4 Ligase, Q5 polymerase (all from New England Biolabs, DE, or Fermentas, DE) and DNA cleanup kits (from Qiagen, DE, and Promega, DE) were used for routine cloning work.


    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: Paragraph title: Construction of dCas9 expression plasmids ... Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs).

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. PCR products were purified and ligated in the vector using T4 DNA ligase and the ligation product, transformed into chemically-competent DH5α E. coli cells.

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202).

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: BRUSH and brush coding sequences were cloned for Xenopus expression with a custom Golden Gate cloning strategy using a modified backbone obtained from the Standard European Vector Architecture 2.0 database ( ). .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: Paragraph title: Gene cloning, expression and protein purification ... The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs). .. The deletion mutants and overexpression strains were verified by DNA sequencing.


    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: BRUSH and brush coding sequences were cloned for Xenopus expression with a custom Golden Gate cloning strategy using a modified backbone obtained from the Standard European Vector Architecture 2.0 database ( ). .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Transformation Assay:

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Homology boxes were cloned into pCC1 plasmid by PCR amplification of the desired regions from 3D7 genomic DNA using specific primers flanked by appropriate restriction sites (list of primers, see Supplementary Table ). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. For protein expression, we designed primers to amplify the N-terminal region of AP2-exp encompassing the AP2 DNA-binding domain into the pGEX-B vector (Pharmacia/GE Healthcare/Life Technologies).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB). .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. Following ligation and transformation into NEB 5-α F’Iq cells (New England Biolabs), cells were grown as near-lawns on LB-carbenicillin plates and a miniprep was performed from resuspension of ∼30,000 colonies to yield the plasmid library.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The PCR products and plasmid pGAPZaA (Invitrogen) were digested with Kpn I and Xba I (New England Biolabs). .. The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a. .. The transformants were selected on low salt LB (10 g/l tryptone, 5 g/l NaCl and 5 g/l yeast extract) agar plate supplemented with 25 μg/ml zeocin (Sangon Biotech, Shanghai).

    Over Expression:

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. Sequencing of recombinant clones was done to confirm the correct ligation of the gene in frame with the glutathione S-transferase in the pGEX plasmid and BL21(DE3)RIL E. coli was transformed to obtain clones for protein expression.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Paragraph title: Construction of deletion mutants and overexpression strains ... Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs).

    Derivative Assay:

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: The backbone (with flanking bacterial transcriptional terminators) was derived from pSEVA191 ( http://wwwuser.cnb.csic.es/~seva/ ) and was chosen to alleviate toxicity issues uncovered while cloning CNGC.IVA sequences into pUC-based Golden Gate backbones and pGEMHE ( ). .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).

    Flow Cytometry:

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The Cap-selected mRNA sample was subjected to end repair and adapter ligation steps – as was described above – before loading on the Flow Cells. .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).


    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Homology boxes were cloned into pCC1 plasmid by PCR amplification of the desired regions from 3D7 genomic DNA using specific primers flanked by appropriate restriction sites (list of primers, see Supplementary Table ). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. For protein expression, we designed primers to amplify the N-terminal region of AP2-exp encompassing the AP2 DNA-binding domain into the pGEX-B vector (Pharmacia/GE Healthcare/Life Technologies).

    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: Before starting the TeSLA procedure, we make stocks of short double-stranded 5′ AT and TA overhang adapters for ligation at genomic and subtelomeric regions. .. To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion).

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The Cap-selected mRNA sample was subjected to end repair and adapter ligation steps – as was described above – before loading on the Flow Cells. .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Primers (F: 5′-CATG CCATGGAAAAGCCAGCACCCGGC-3′ and R: 5′-CCCGGAATTCGCGATCAGGAAGACCCTCG-3′) used for the construction of the plasmid containing the RyhB gene were designed in this study. .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs). .. The new constructs along with the empty vector, pBAD202, were transformed into parent strain UTI89 for overexpression experiments.

    Magnetic Beads:

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The cDNA sample was purified between each step using Agencourt AMPure XP magnetic beads (Beckman Coulter) and the library concentration was determined using a Qubit 2.0 Fluorometer through use of the Qubit (ds)DNA HS Assay Kit (Thermo Fisher Scientific). .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).

    Cell Culture:

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a. .. The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.


    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: Constructs were generated using the NMD assay constructs as a backbone. .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF.


    Article Title: Biomolecular computers with multiple restriction enzymes
    Article Snippet: The restriction enzymes Acu I, Bae I,Bbv I, Mbo II, Btgz I and T4 DNA ligase were obtained from New England Biolabs (Ipswich, MA, USA).

    DNA Sequencing:

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a. .. Single colonies were inoculated into LB medium supplemented with same antibiotics, and cultured overnight.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs). .. The new constructs along with the empty vector, pBAD202, were transformed into parent strain UTI89 for overexpression experiments.


    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. PCR products were purified and ligated in the vector using T4 DNA ligase and the ligation product, transformed into chemically-competent DH5α E. coli cells.

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: A template plasmid, EF- RBS-SpCas9 (Supplementary Fig. ), was created with a ribosome binding site attached to a human codon optimized SpCas9 protein coding sequence (Supplementary Fig. ) and the appropriate Esp3I sites to be used for error-prone PCR by POE-PCR . .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: P53β forward primer: 5′- GACCAGACCAGCTTTCAAAAAGA-3′, p53γ forward primer: 5′-ATGCTACTTGACTTACGATGGTGTTACT-3′, p53 isoform reverse primer (Not1 digestion site): 5′aaagcggccgcTCAGTCTGAGTCAGGCCCTTCTG-3′. .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing. .. The cells were transfected using Lipofectamine 2000 (Invitrogen) and harvested after 1.5 days for luciferase detection.

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: Paragraph title: Oxford Nanopore MinION Sequencing ... Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The nucleotide sequence encoding the NFAmy13A was amplified with Mix (Green) using N3 cDNA as the template, with NFAf 5′ GGTACC GCGACTCCGGATGAGTGGAAAGCTCAG3′ and NFAr5′ TCTAGA CGCCGACGCACACAGACCACTCTTG3′ primers containing Kpn I and Xba I site, respectively. .. The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Paragraph title: Sequencing and bioinformatic analysis ... Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time.


    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. PCR products were purified and ligated in the vector using T4 DNA ligase and the ligation product, transformed into chemically-competent DH5α E. coli cells.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a. .. Plasmids were extracted (Qiagen mini-prep kit) from the cultures, and the inserts were verified by DNA sequencing (TsingKe, Chengdu, China).

    RNA Sequencing Assay:

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The direct RNA sequencing approach Libraries were prepared using the Direct RNA Sequencing Kit (SQK-RNA001; Oxford Nanopore Technologies) The first strand cDNA was synthesized by SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) using an RT adapter with T10 nts. .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).


    Article Title: Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub. Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub
    Article Snippet: The protocol for MSAP was adapted from a standard AFLP (Vos et al. ), replacing the Mse I enzyme in two separate runs with the methylation‐sensitive enzymes Hpa II and Msp I using appropriate adaptors and primers. .. The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM).


    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: Paragraph title: SpCas9 Mutant Library Cloning ... Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF.


    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: To make 40 μM AT and TA adapters, 40 μl of 100 μM TeSLA adapter short oligonucleotide (ONT) was mixed with 40 μl of 100 μM of TeSLA adapter TA and TeSLA adapter AT ONTs individually to make the final volume of 100 μl in 1× TSE buffer (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA). .. To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion). .. The inactivated mixture including two units of Cvi AII in 10 μl 1× CutSmart buffer was incubated at 25 °C for 2 h to generate genomic DNA fragments with 5′ AT overhangs.

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. Plates were incubated overnight at 37°C, then at 4°C for an additional 4–8 h. Colonies that appeared white or pale from the primary screen were restreaked to confirm colony color.

    Bimolecular Fluorescence Complementation Assay:

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: The same backbone was used to express the constructs for BiFC analysis, where LI Golden Gate B-C or D-E parts encoding for the N-terminal (VN) or C-terminal (VC) portions of mVenus ( ) were inserted. .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB).


    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: The resulting amplicons were loaded on a gel and the appropriate amplicon at 4.4 kb was gel extracted and purified with a Qiagen gel extraction column. .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: Using the pCL-Neo β-globin WT Renilla construct we first digested with Xho1 restriction enzyme (NEB) and treated with T4 DNA polymerase (NEB) purified via PCR column and digested with Not1 restriction enzyme (NEB) for removal of the β-globin portion of the construct. cDNA from wild type HCT116 cells was used to PCR amplify our p53 isoform fragments using the Phusion Polymerase (Thermo Scientific). .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. Following ligation and transformation into NEB 5-α F’Iq cells (New England Biolabs), cells were grown as near-lawns on LB-carbenicillin plates and a miniprep was performed from resuspension of ∼30,000 colonies to yield the plasmid library.

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The cDNA sample was purified between each step using Agencourt AMPure XP magnetic beads (Beckman Coulter) and the library concentration was determined using a Qubit 2.0 Fluorometer through use of the Qubit (ds)DNA HS Assay Kit (Thermo Fisher Scientific). .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).

    Article Title: SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states
    Article Snippet: The Hind III-digested and sonicated gDNA was ligated with the SSA of 3N overhang and elongated with the same procedure as the tagmented DNA. .. Then the gDNA was ligated with a T adaptor in a 10-μL containing 1 μL of T adaptor (5 μM), 1× T4 DNA Ligase Reaction Buffer and 1 μL of T4 DNA ligase at 16 °C for 2 h. Finally, the gDNA was purified with 1.2× Ampure XP beads and amplified with different NEB index primers (Additional file : Table S1) in a 50-μL PCR reaction as described above. .. The PCR products were run with agarose gel and the gDNA fragments of 300–1000 bp were extracted with the QIAquick Gel Extraction Kit.

    Protein Purification:

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: Paragraph title: Gene cloning, expression and protein purification ... The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.

    Polymerase Chain Reaction:

    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: For array of two, three and four FOG1 domains to the N-terminus of dCas9, FOG1 monomer coding sequences were amplified separately by PCR introducing a GS linker between individual monomer coding sequences and the KpnI and FseI restriction sites at the beginning of first monomer and the end of the last monomer for each array. .. Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs).

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Homology boxes were cloned into pCC1 plasmid by PCR amplification of the desired regions from 3D7 genomic DNA using specific primers flanked by appropriate restriction sites (list of primers, see Supplementary Table ). .. Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: A method for measuring the distribution of the shortest telomeres in cells and tissues
    Article Snippet: To ligate TeSLA-T (TeSLA-T 1–6) to each telomere overhang, 1000 units of T4 DNA ligase (New England Biolabs), 1 mM ATP, and 10−3 μM of TeSLA-Ts were added to a final volume of 20 μl in 1× CutSmart buffer (New England Biolabs) with 50 ng of isolated genomic DNA (without RE digestion). .. For adaptor ligation, 10 μl of the inactivated mixture was combined with 1000 units of T4 DNA ligase to a final volume of 20 μl in 1× CutSmart buffer with 1 mM ATP, 1 μM of AT adapter, and 1 μM of TA adapter.

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom). .. Sequence of primers used for amplification of homology arms is given in .

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: The resulting amplicons were loaded on a gel and the appropriate amplicon at 4.4 kb was gel extracted and purified with a Qiagen gel extraction column. .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB). .. The ligation reactions were put in a thermocycler running the program: 60 cycles of 37 °C for 5 minutes, 16 °C for 5 minutes, a final digestion at 37 °C for 30 minutes, and heat inactivation at 65 °C for 20 minutes.

    Article Title: Transcription coupled repair and biased insertion of human retrotransposon L1 in transcribed genes
    Article Snippet: Sheared plasmid DNA was primer extended using an oligo specific to the 3′ end of the synL1_neo rescue plasmid (3′_rescue_1: 5′ ATATATGAGTAACCTGAGGC 3′ or 3′_rescue_1_secondpA: 5′ GTGGGCATTCTGTCTTGTTC 3′). .. Duplexed T-linkers were ligated using 10 U T4 DNA ligase and PCR was performed using the primers: linker specific (5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′) and 3′_rescue_1 (or 3′_rescue_1_secondpA) primer. .. PCR was carried out with these steps: initial denaturation at 94°, 20 cycles of 94° for 30s, 60° for 1 min, 72° for 1 min, and a final extension for 10 min at 72°.

    Article Title: Identification of nonsense-mediated mRNA decay pathway as a critical regulator of p53 isoform β
    Article Snippet: Using the pCL-Neo β-globin WT Renilla construct we first digested with Xho1 restriction enzyme (NEB) and treated with T4 DNA polymerase (NEB) purified via PCR column and digested with Not1 restriction enzyme (NEB) for removal of the β-globin portion of the construct. cDNA from wild type HCT116 cells was used to PCR amplify our p53 isoform fragments using the Phusion Polymerase (Thermo Scientific). .. The fragments were ligated using T4 DNA ligase (NEB); in-frame insertion was confirmed via diagnostic restriction enzyme digestion and sequencing.

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. Following ligation and transformation into NEB 5-α F’Iq cells (New England Biolabs), cells were grown as near-lawns on LB-carbenicillin plates and a miniprep was performed from resuspension of ∼30,000 colonies to yield the plasmid library.

    Article Title: SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states
    Article Snippet: The Hind III-digested and sonicated gDNA was ligated with the SSA of 3N overhang and elongated with the same procedure as the tagmented DNA. .. Then the gDNA was ligated with a T adaptor in a 10-μL containing 1 μL of T adaptor (5 μM), 1× T4 DNA Ligase Reaction Buffer and 1 μL of T4 DNA ligase at 16 °C for 2 h. Finally, the gDNA was purified with 1.2× Ampure XP beads and amplified with different NEB index primers (Additional file : Table S1) in a 50-μL PCR reaction as described above. .. The PCR products were run with agarose gel and the gDNA fragments of 300–1000 bp were extracted with the QIAquick Gel Extraction Kit.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The PCR products and plasmid pGAPZaA (Invitrogen) were digested with Kpn I and Xba I (New England Biolabs). .. The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Primers (F: 5′-CATG CCATGGAAAAGCCAGCACCCGGC-3′ and R: 5′-CCCGGAATTCGCGATCAGGAAGACCCTCG-3′) used for the construction of the plasmid containing the RyhB gene were designed in this study. .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs). .. The new constructs along with the empty vector, pBAD202, were transformed into parent strain UTI89 for overexpression experiments.

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Sequencing libraries were constructed using 2 ng of DNA using a low-input protocol . .. Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time. .. DNA was purified between each step using two volumes of NucleoMag NGS DNA purification beads (Macherey–Nagel) except after adapter ligation and PCR amplification where 0.8 volumes were used to facilitate size selection.

    DNA HS Assay:

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs). .. The RNA-DNA hybrid was purified between each step by using Agencourt AMPure XP magnetic beads (Beckman Coulter), treated with RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific).


    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Guide RNAs targeting human LncBISPR gene (chromosome 19, 17405686–17415736, Ncbi Accession no: NC_000019.10) were designed using CRISPR design tool ( crispr.mit.edu ; ). .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom).


    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB). .. The purified ligations were transformed into five 25 µl aliquots of 10 G Elite electrocompetent cells (Lucigen), pulsed at 1800V, and recovered at 37 °C with shaking in 1 mL Recovery Media (Lucigen) for 1 hour.

    Plasmid Preparation:

    Article Title: dCas9-based epigenome editing suggests acquisition of histone methylation is not sufficient for target gene repression
    Article Snippet: Amplification primers are listed in . .. Two, three or four monomer coding sequences were mixed with pFusA plasmid for Golden Gate Assembly cloning with BsaI and T4 DNA ligase (New England Biolabs). .. DNA fragments of arrays of two, three and four FOG1 domains were digested with KpnI and FseI and ligated into the KpnI/FseI digested dCas9 plasmid.

    Article Title: An ApiAP2 member regulates expression of clonally variant genes of the human malaria parasite Plasmodium falciparum
    Article Snippet: Paragraph title: Plasmid constructs ... Ligation was done using T4 DNA ligase (NEB) and transformed into XL10-Gold ultracompetent cells (Agilent).

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Final screening of colonies carrying dual gRNA ligated Cas9 constructs was done by Sanger sequencing using H1 primer. .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom). .. Sequence of primers used for amplification of homology arms is given in .

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202).

    Article Title: A quantitative hypermorphic CNGC allele confers ectopic calcium flux and impairs cellular development
    Article Snippet: The same backbone was used to express the constructs for BiFC analysis, where LI Golden Gate B-C or D-E parts encoding for the N-terminal (VN) or C-terminal (VC) portions of mVenus ( ) were inserted. .. Plasmids were assembled in a 15 µl reaction containing 100 ng of each LI plasmid and backbone, 1.5 µl CutSmart buffer (NEB, Germany), 1.5 µl 10 mM ATP, 0.75 µl BsaI (NEB), 0.75 µl T4 ligase (NEB). .. The reaction was then cycled 6 times (10 min at 37°C, 10 min 16°C) in a PCR machine, followed by incubation at 37°C (10 min) and 65°C (20 min).

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: A template plasmid, EF- RBS-SpCas9 (Supplementary Fig. ), was created with a ribosome binding site attached to a human codon optimized SpCas9 protein coding sequence (Supplementary Fig. ) and the appropriate Esp3I sites to be used for error-prone PCR by POE-PCR . .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Article Title: A bacterial three-hybrid assay detects Escherichia coli Hfq–sRNA interactions in vivo
    Article Snippet: A mutant hfq library (pKB817, pBRα-Hfq) was generated first by 80 rounds of PCR amplification of the hfq portion of the plasmid using Taq DNA Polymerase (GoTaq Green Master Mix, Promega) and primers oKB1077 and oKB1078. .. The PCR product was digested with DpnI (New England Biolabs) to remove template plasmid, then with NotI-HF and BamHI-HF (New England Biolabs), gel purified and ligated (T4 DNA ligase; New England Biolabs) into a pBRα vector cut with NotI-HF and BamHI-HF. .. Following ligation and transformation into NEB 5-α F’Iq cells (New England Biolabs), cells were grown as near-lawns on LB-carbenicillin plates and a miniprep was performed from resuspension of ∼30,000 colonies to yield the plasmid library.

    Article Title: Directly mining a fungal thermostable α-amylase from Chinese Nong-flavor liquor starter
    Article Snippet: The PCR products and plasmid pGAPZaA (Invitrogen) were digested with Kpn I and Xba I (New England Biolabs). .. The resulting DNA fragments were ligated with T4 DNA ligase (New England Biolabs) and the ligated product was transformed into E. coli DH5a.

    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Primers (F: 5′-CATG CCATGGAAAAGCCAGCACCCGGC-3′ and R: 5′-CCCGGAATTCGCGATCAGGAAGACCCTCG-3′) used for the construction of the plasmid containing the RyhB gene were designed in this study. .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs).


    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs). .. Libraries were loaded on R9.4 SpotON Flow Cells.

    Binding Assay:

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: A template plasmid, EF- RBS-SpCas9 (Supplementary Fig. ), was created with a ribosome binding site attached to a human codon optimized SpCas9 protein coding sequence (Supplementary Fig. ) and the appropriate Esp3I sites to be used for error-prone PCR by POE-PCR . .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Agarose Gel Electrophoresis:

    Article Title: Viral proteins as a potential driver of histone depletion in dinoflagellates
    Article Snippet: Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time. .. Briefly, samples were end repaired (1X T4 DNA ligase buffer (NEB), 0.4 mM dNTP mix, 2.25 U T4 DNA polymerase (NEB), 0.75 U Klenow DNA polymerase (NEB), and 7.5 U of T4 polynucleotide kinase (NEB), incubated at room temperature for 30 min), A-tailed (1X NEB buffer 2, 0.4 mM dATP, and 3.75 U of Klenow (exo-) (NEB) incubated at 37 °C for 30 min), ligated to adapters (1X Quick DNA ligase buffer (NEB), 1 mM Illumina PE adapters, and 1600 U Quick DNA-ligase (NEB), incubated at room temperature for 1 h) and PCR amplified (1X NEBNext master mix (NEB) and 0.4 μM indexed primers (Illumina)) using 12 PCR cycles with a 65 °C annealing temperature and a 30 s extension time.


    Article Title: Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism
    Article Snippet: Primers used to amplify all knockout-DNA fragments and verify the correct constructs by polymerase chain reaction (PCR) are shown in Supplementary Tables , . .. Genes were amplified with PCR primers, followed by digestion of both the PCR fragments and pBAD202 with the restriction enzymes Nco I and Eco RI (New England Biolabs, Ipswich, MA, USA) and ligation using the T4 DNA ligase (New England Biolabs).

    Next-Generation Sequencing:

    Article Title: SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states
    Article Snippet: This method can be used to construct NGS library with the DNA fragments sheared by various methods including tagmentation, sonication and enzymatic digestion. .. This method constructs NGS library in several simple steps just dependent on two cheap routine enzymes, T4 DNA ligase and Taq polymerase. .. Combining with Tn5 tagmentation technique, this method can simply the NGS library construction procedure in five steps, including tagmentation, SSA ligation, elongation, T adaptor ligation, and index PCR amplification.


    Article Title: Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub. Genetic and epigenetic variations associated with adaptation to heterogeneous habitat conditions in a deciduous shrub
    Article Snippet: DNA was quantified with both 0.8% agarose gels and microscopic spectrophotometry. .. The reaction was incubated at 37°C for 2 hr and inactivated at 80°C for 20 min. Then, the product was combined with 48 μT4 DNA ligase (NEB), 1.4 μl 10 × T4 DNA ligase buffer, 1 μl EcoR I adapter (5 μM), and 1 μl Mse I adapter (50 μM) or 1 μl Hpa II/Msp I adapter (50 μM).

    Concentration Assay:

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus
    Article Snippet: The cDNA sample was purified between each step using Agencourt AMPure XP magnetic beads (Beckman Coulter) and the library concentration was determined using a Qubit 2.0 Fluorometer through use of the Qubit (ds)DNA HS Assay Kit (Thermo Fisher Scientific). .. Adapters, supplied in the kit, were ligated using T4 DNA ligase (New England Biolabs).

    Gel Extraction:

    Article Title: Deep mutational scanning of S. pyogenes Cas9 reveals important functional domains
    Article Snippet: The resulting amplicons were loaded on a gel and the appropriate amplicon at 4.4 kb was gel extracted and purified with a Qiagen gel extraction column. .. Six 20 µl golden gate cloning reactions were set up with 75 ng PCR product and 50 ng pUC-ProD-LacZ-T2 (Supplementary Fig. ) with 10 U Esp3I (Thermo Fisher Scientific) and 400 U T4 DNA Ligase (NEB) in 1X Ligase Buffer (NEB).

    Blocking Assay:

    Article Title: Hepatitis E Virus (HEV) egress: Role of BST2 (Tetherin) and interferon induced long non- coding RNA (lncRNA) BISPR
    Article Snippet: Both gRNAs ( ) and U6 block (Systems Biosciences, Palo Alto, California, United States) were used as template to perform fusion PCR and generate ~450 bp H1-gRNA1-U6-gRNA2 amplicon ( ) using Precision XTM Cas9 SmartNuclease system (CAS740A). .. The left and right homology arms to be cloned at KpN1 and BamH1 sites of HR vector (Cat no: HR410PA-1, Systems Biosciences, Palo Alto, California, United States) were PCR amplified from region 17405497–17406190 and 17414509–17415316 (on chromosome 19) respectively from Huh7 genomic DNA using combination of Taq (Applied Biosystems, Foster City, California, United States) and Pfu DNA polymerase (Promega, Madison, Wisconsin, United States) in a 4:1 ratio, gel eluted, digested with KpN1 and BamH1 respectively and sequentially ligated into HRP410 vector using T4 DNA Ligase (NEB, Ipswich, Massachusetts, United Kingdom).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    NEBNext Quick Ligation Module 100 rxns
      Buy from Supplier

    New England Biolabs quick t4 dna ligase
    Quick T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    quick t4 dna ligase - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    Image Search Results